Prosecution Insights
Last updated: July 17, 2026
Application No. 18/182,413

NUCLEIC ACID ENCODING HUMAN HGF AND USE THEREOF

Non-Final OA §101§102§103§112
Filed
Mar 13, 2023
Priority
Oct 31, 2022 — CN 202211345337.7
Examiner
JOHNSON, TIRONE DEREK
Art Unit
1675
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Peking University
OA Round
1 (Non-Final)
Grant Probability
Favorable
1-2
OA Rounds

Examiner Intelligence

Grants only 0% of cases
0%
Career Allowance Rate
0 granted / 0 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
Avg Prosecution
17 currently pending
Career history
15
Total Applications
across all art units

Statute-Specific Performance

§103
77.3%
+37.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 0 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status The preliminary amendment filed 4/18/26 is acknowledged. Claims 4-10 are amended. Claims 1-10 are pending and examined. Claim Objections Claims 1 and 5 are objected to because of the following informalities: Claim 1 recites the acronym “HGF” without providing its full meaning in its first use. Claim 5 contains the claim identifier “currently amended” within the text of the claim, but status identifiers should only appear in the claim listing. Appropriate correction is required. Claim Rejections - 35 USC § 112b The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 3-7 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claims 3-7, the phrase "preferably" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d). Description of examples or preferences is properly set forth in the specification rather than the claims. Therefore, claims 3-7 are rejected under 35 U.S.C. 112(b). Claim Rejections - 35 USC § 112a The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1 and 4-10 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice (see MPEP 2163(II)(3)(a)(i)(A), reduction to drawings MPEP 2163(II)(3)(a)(i)(B), or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus MPEP 2163(II)(3)(a)(i)(C). Independent claim 1 recites a nucleic acid encoding human hepatocyte growth factor (HGF) having an ORF that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:s 21-31, which encompasses a large genus of nucleic acid sequences. The specification only discloses the specific nucleic acid sequences of SEQ ID NOs: 21-31, and experimental data relating to those disclosed sequences. The claims, however are not limited to those species but also includes up to 437 possible nucleotide substitutions over the claimed ORFs, notwithstanding potential deletions and insertions. The specification fails to provide a representative number of species within the recited genus, adequate structure-function correlation, or other identifying characteristics of the genus as a whole. Accordingly, the disclosure does not reasonably convey possession of the full scope of modifications across all positions. Claims 4-10 explicitly or implicitly require the composition of claim 1 but do not materially limit the genus of agents, and are therefore included in the rejection. Therefore, claims 1 and 4-10 are rejected under 35 U.S.C. 112(a) for lack of written description. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1, 4, 5, and 9 are rejected under 35 U.S.C. 101 because do not constitute patent eligible subject matter. Claims 1, 4, and 5 are drawn to a nucleic acid and claim 9 is drawn to a cell comprising a nucleic acid. Claims 1, 4, 5, and 9 are drawn to compositions, which are a statutory class (Step 1: Yes). Claim 1 recites a nucleic acid at least 80% similar to one of the enumerated sequences encoding human hepatocyte growth factor (HGF). The naturally occurring human liver HGF ORF sequence is 84.2% identical to instant SEQ ID NO 25 [see Miyazawa et al. (1989), FIG 1; see NCBI Accession #: M29145.1; sequence alignment below]. Human HGF aligned to instant SEQ ID NO: 25 Query Match 84.2%; Score 1838.4; Length 2187; Best Local Similarity 90.1%; Matches 1968; Conservative 0; Mismatches 216; Indels 0; Gaps 0; Qy 1 ATGTGGGTGACCAAGCTCCTGCCGGCCCTGCTGCTCCAGCATGTCCTTCTGCATCTCCTC 60 |||||||||||||| |||||||| ||||||||||| ||||||||||| |||||||||||| Db 1 ATGTGGGTGACCAAACTCCTGCCAGCCCTGCTGCTGCAGCATGTCCTCCTGCATCTCCTC 60 Qy 61 CTGCTACCCATAGCGATCCCCTATGCAGAAGGACAAAGGAAACGCAGAAATACAATTCAT 120 ||||| ||||| || |||||||||||||| |||||||||||| | ||||||||||||||| Db 61 CTGCTCCCCATCGCCATCCCCTATGCAGAGGGACAAAGGAAAAGAAGAAATACAATTCAT 120 Qy 121 GAATTCAAGAAATCAGCGAAGACTACCCTAATCAAGATAGATCCAGCACTGAAGATAAAA 180 |||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||| Db 121 GAATTCAAAAAATCAGCAAAGACTACCCTAATCAAAATAGATCCAGCACTGAAGATAAAA 180 Qy 181 ACCAAGAAAGTGAATACCGCAGACCAGTGTGCTAACCGTTGTACGAGGAACAAAGGACTG 240 ||||| ||||||||||| |||||||| |||||||| | ||||| ||||| |||||||| Db 181 ACCAAAAAAGTGAATACTGCAGACCAATGTGCTAATAGATGTACTAGGAATAAAGGACTT 240 Qy 241 CCATTCACTTGCAAGGCTTTTGTTTTTGATAAGGCCCGTAAACAATGCTTGTGGTTCCCC 300 |||||||||||||||||||||||||||||||| || | ||||||||| | ||||||||| Db 241 CCATTCACTTGCAAGGCTTTTGTTTTTGATAAAGCAAGAAAACAATGCCTCTGGTTCCCC 300 Qy 301 TTCAACAGCATGTCAAGTGGCGTGAAGAAAGAGTTCGGACACGAATTTGACCTCTATGAG 360 ||||| |||||||||||||| ||||| ||||| || || || ||||||||||||||||| Db 301 TTCAATAGCATGTCAAGTGGAGTGAAAAAAGAATTTGGCCATGAATTTGACCTCTATGAA 360 Qy 361 AACAAAGACTACATTAGGAACTGCATCATCGGTAAGGGACGCTCGTATAAGGGCACAGTT 420 ||||||||||||||||| ||||||||||| ||||| |||||| || ||||| ||||| Db 361 AACAAAGACTACATTAGAAACTGCATCATTGGTAAAGGACGCAGCTACAAGGGAACAGTA 420 Qy 421 TCTATCACTAAGAGTGGCATTAAATGTCAGCCCTGGTCGTCCATGATACCACACGAACAC 480 |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| Db 421 TCTATCACTAAGAGTGGCATCAAATGTCAGCCCTGGAGTTCCATGATACCACACGAACAC 480 Qy 481 AGCTTTCTTCCTTCTTCCTATCGCGGAAAGGACTTGCAGGAAAACTACTGTCGCAATCCG 540 |||||| | ||||| |||||| || || ||| | ||||||||||||||||| ||||| Db 481 AGCTTTTTGCCTTCGAGCTATCGGGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCT 540 Qy 541 CGAGGGGAAGAAGGGGGACCCTGGTGCTTCACAAGCAACCCTGAGGTACGCTACGAAGTC 600 |||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| Db 541 CGAGGGGAAGAAGGGGGACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTC 600 Qy 601 TGTGACATTCCTCAGTGTTCCGAAGTTGAATGCATGACCTGCAACGGGGAGTCGTATCGA 660 |||||||||||||||||||| ||||||||||||||||||||||| |||||| |||||| Db 601 TGTGACATTCCTCAGTGTTCAGAAGTTGAATGCATGACCTGCAATGGGGAGAGTTATCGA 660 Qy 661 GGTCTCATGGATCACACAGAATCAGGCAAGATTTGTCAGCGGTGGGATCACCAGACCCCC 720 |||||||||||||| |||||||||||||||||||||||||| |||||||| ||||| || Db 661 GGTCTCATGGATCATACAGAATCAGGCAAGATTTGTCAGCGCTGGGATCATCAGACACCA 720 Qy 721 CATCGCCACAAATTCTTGCCTGAACGATACCCTGACAAGGGTTTTGATGATAATTACTGC 780 || || |||||||||||||||||| |||| || |||||||| |||||||||||||| ||| Db 721 CACCGGCACAAATTCTTGCCTGAAAGATATCCCGACAAGGGCTTTGATGATAATTATTGC 780 Qy 781 CGTAACCCCGACGGCCAGCCGAGGCCCTGGTGTTACACTCTTGACCCTCACACCCGATGG 840 || || ||||| |||||||||||||| ||||| || |||||||||||||||||||| ||| Db 781 CGCAATCCCGATGGCCAGCCGAGGCCATGGTGCTATACTCTTGACCCTCACACCCGCTGG 840 Qy 841 GAGTACTGTGCTATTAAGACGTGCGCGGACAATACTATGAATGACACTGATGTGCCTTTG 900 ||||||||||| ||||| || ||||| |||||||||||||||||||||||||| |||||| Db 841 GAGTACTGTGCAATTAAAACATGCGCTGACAATACTATGAATGACACTGATGTTCCTTTG 900 Qy 901 GAGACAACTGAGTGCATACAAGGTCAAGGCGAAGGCTACCGGGGTACTGTGAATACAATT 960 || |||||||| ||||| ||||||||||| ||||||||| |||| ||||| ||||| ||| Db 901 GAAACAACTGAATGCATCCAAGGTCAAGGAGAAGGCTACAGGGGCACTGTCAATACCATT 960 Qy 961 TGGAATGGGATACCATGTCAGAGATGGGATTCGCAGTACCCTCACGAGCATGACATGACT 1020 |||||||| || ||||||||| | |||||||| ||||| ||||||||||||||||||||| Db 961 TGGAATGGAATTCCATGTCAGCGTTGGGATTCTCAGTATCCTCACGAGCATGACATGACT 1020 Qy 1021 CCTGAAAATTTCAAGTGCAAGGACCTACGAGAGAATTACTGCCGAAATCCAGATGGGTCT 1080 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 1021 CCTGAAAATTTCAAGTGCAAGGACCTACGAGAAAATTACTGCCGAAATCCAGATGGGTCT 1080 Qy 1081 GAGAGCCCCTGGTGCTTTACCACTGATCCGAACATCAGAGTTGGTTACTGCTCCCAAATA 1140 || |||||||| |||||||||||||| |||||| ||||||| |||||||||||||| Db 1081 GAATCACCCTGGTGTTTTACCACTGATCCAAACATCCGAGTTGGCTACTGCTCCCAAATT 1140 Qy 1141 CCAAACTGTGATATGTCGCACGGACAAGATTGCTATCGGGGGAATGGCAAAAACTACATG 1200 ||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || ||| Db 1141 CCAAACTGTGATATGTCACATGGACAAGATTGTTATCGTGGGAATGGCAAAAATTATATG 1200 Qy 1201 GGCAACCTGAGTCAAACAAGATCTGGACTAACATGTTCTATGTGGGACAAGAACATGGAA 1260 |||||| | |||||||||||||||||||||||||| ||||||||||||||||||||| Db 1201 GGCAACTTATCCCAAACAAGATCTGGACTAACATGTTCAATGTGGGACAAGAACATGGAA 1260 Qy 1261 GATCTTCATCGTCATATCTTCTGGGAACCGGATGCAAGTAAGCTGAACGAGAATTACTGC 1320 || | ||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Db 1261 GACTTACATCGTCATATCTTCTGGGAACCAGATGCAAGTAAGCTGAATGAGAATTACTGC 1320 Qy 1321 AGAAATCCAGACGATGATGCTCACGGACCCTGGTGCTACACGGGAAATCCACTCATTCCT 1380 |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| Db 1321 CGAAATCCAGATGATGATGCTCATGGACCCTGGTGCTACACGGGAAATCCACTCATTCCT 1380 Qy 1381 TGGGATTACTGCCCCATTTCTCGTTGTGAAGGTGACACCACACCTACCATAGTCAACCTG 1440 |||||||| ||||| |||||||||||||||||||| ||||||||||| |||||||| | Db 1381 TGGGATTATTGCCCTATTTCTCGTTGTGAAGGTGATACCACACCTACAATAGTCAATTTA 1440 Qy 1441 GACCATCCCGTTATATCATGTGCCAAAACGAAACAATTGCGAGTTGTCAATGGGATCCCA 1500 ||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| ||| Db 1441 GACCATCCCGTAATATCTTGTGCCAAAACGAAACAATTGCGAGTTGTAAATGGGATTCCA 1500 Qy 1501 ACTCGAACTAACATCGGATGGATGGTTTCCCTCAGATACCGTAACAAACATATCTGCGGG 1560 || ||||| ||||| |||||||||||| | |||||| | || |||||||||||||| Db 1501 ACACGAACAAACATAGGATGGATGGTTAGTTTGAGATACAGAAATAAACATATCTGCGGA 1560 Qy 1561 GGATCATTGATCAAGGAGAGTTGGGTTCTTACGGCAAGGCAGTGTTTCCCTTCGCGAGAC 1620 ||||||||||| |||||||||||||||||||| ||| | |||||||||||||| |||||| Db 1561 GGATCATTGATAAAGGAGAGTTGGGTTCTTACTGCACGACAGTGTTTCCCTTCTCGAGAC 1620 Qy 1621 TTGAAGGATTACGAAGCTTGGCTTGGAATTCACGATGTCCACGGAAGAGGAGATGAGAAA 1680 ||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||| Db 1621 TTGAAAGATTATGAAGCTTGGCTTGGAATTCATGATGTCCACGGAAGAGGAGATGAGAAA 1680 Qy 1681 TGCAAACAGGTTCTCAATGTTTCGCAGCTTGTATATGGCCCGGAAGGATCAGATCTGGTG 1740 ||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| Db 1681 TGCAAACAGGTTCTCAATGTTTCCCAGCTGGTATATGGCCCTGAAGGATCAGATCTGGTT 1740 Qy 1741 TTAATGAAGTTAGCCAGGCCGGCCGTCCTGGATGATTTCGTTAGTACAATCGATCTTCCC 1800 ||||||||| | |||||||| || |||||||||||||| |||||||| || ||| | || Db 1741 TTAATGAAGCTTGCCAGGCCTGCTGTCCTGGATGATTTTGTTAGTACGATTGATTTACCT 1800 Qy 1801 AATTATGGTTGCACAATCCCGGAGAAGACCAGTTGTAGCGTCTATGGCTGGGGCTACACT 1860 |||||||| |||||||| || || ||||||||||| || || |||||||||||||||||| Db 1801 AATTATGGATGCACAATTCCTGAAAAGACCAGTTGCAGTGTTTATGGCTGGGGCTACACT 1860 Qy 1861 GGATTGATCAACTATGATGGGCTATTACGAGTGGCACATCTCTATATAATGGGAAATGAG 1920 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Db 1861 GGATTGATCAACTATGATGGCCTATTACGAGTGGCACATCTCTATATAATGGGAAATGAG 1920 Qy 1921 AAATGCTCGCAGCATCACCGAGGGAAGGTGACTCTGAACGAGTCGGAAATATGTGCTGGG 1980 |||||| |||||||| |||||||||||||||||||| ||||| ||||||||||||||| Db 1921 AAATGCAGCCAGCATCATCGAGGGAAGGTGACTCTGAATGAGTCTGAAATATGTGCTGGG 1980 Qy 1981 GCCGAGAAGATTGGTTCTGGCCCATGTGAGGGGGATTACGGTGGCCCACTGGTTTGTGAG 2040 || || |||||||| || || ||||||||||||||||| ||||||||||| ||||||||| Db 1981 GCTGAAAAGATTGGATCAGGACCATGTGAGGGGGATTATGGTGGCCCACTTGTTTGTGAG 2040 Qy 2041 CAACACAAAATGAGGATGGTTCTTGGTGTTATTGTTCCTGGTCGGGGATGTGCCATTCCA 2100 ||||| |||||||| |||||||||||||| |||||||||||||| ||||||||||||||| Db 2041 CAACATAAAATGAGAATGGTTCTTGGTGTCATTGTTCCTGGTCGTGGATGTGCCATTCCA 2100 Qy 2101 AACCGTCCTGGTATTTTTGTCCGTGTGGCATATTACGCAAAATGGATACACAAGATTATT 2160 || |||||||||||||||||||| || |||||||| ||||||||||||||||| |||||| Db 2101 AATCGTCCTGGTATTTTTGTCCGAGTAGCATATTATGCAAAATGGATACACAAAATTATT 2160 Qy 2161 CTCACCTATAAGGTACCCCAGTCA 2184 | || ||||||||||| |||||| Db 2161 TTAACATATAAGGTACCACAGTCA 2184 Claims 4 and 5 recite the additional components of a 5’ UTR and 3’ UTR, which are known components of the naturally occurring human HGF sequence [see Mungunsukh et al., p. 2089, col. 1, par. 3]. Claim 9 recites a cell comprising said nucleic acid; however, the nucleic acid is naturally synthesized and secreted by mesenchymal cells of the human body [see Mungunsukh et al., p. 2088, col. 2, par 2]. These claims therefore recite a judicial exception (Step 2A, Prong 1: Yes). According to Step 2A, Prong 2, set forth in set forth in MPEP 2106.04 II A (2), the claims are next evaluated with respect to whether the judicial exception is integrated into a practical application. These considerations are set forth in MPEP 2106.05 (a) through (c), (e), and (h). Claims 1, 4, and 5 are drawn to the composition itself and claim 9 is drawn to a cell comprising the composition. Neither of these claims recite additional elements that reflect an improvement within the technical field, recite additional elements that apply the natural phenomena judicial exception to a particular treatment or which utilize a particular machine, provide additional elements that effect a transformation, or provide additional elements that apply the judicial exception in some other meaningful way (STEP 2A, Prong Two: No). The claims are therefore directed only to the naturally occurring protein rather than to a practical application of that protein, and the discovery of a naturally-occurring product does not amount to significantly more: "Groundbreaking, innovative, or even brilliant discovery does not by itself satisfy the § 101 inquiry." Myriad, 133 S. Ct. at 2117. (Step 2B: No). Therefore, claims 1, 4, 5, and 9 are rejected under 35 U.S.C. 101 as they do not constitute patent eligible subject matter. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 4, 5, and 9 are rejected under 35 U.S.C. 102a1 as being anticipated by Miyazawa et al. (1991). Claims 1, 4, and 5 are drawn to a nucleic acid, and claim 9 is drawn to a cell comprising a nucleic acid. Miyazawa et al. (1991) discloses isolation and cloning of the DNA sequence of human HGF [see p. 9172, Col. 1, par. 1, lines 8-10] from hepatoma cells and lung fibroblasts [see p. 9170, col. 2, par. 4] (instant claim 9); this sequence inherently comprises an ORF sequence that is 84.2% identical to instant SEQ ID NO: 25 [see sequence alignment above] (instant claim 1). This sequence comprises 5’ and 3’ UTRs, also known as noncoding regions [see p. 9172, “Structural Organization of the hHGF Gene”] (instant claims 4 and 5) as well as a short poly-A sequence [see p. 9174, col. 1, par. 3]. Therefore, claims 1, 4, 5, and 9 are rejected under 35 U.S.C. 102a1. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 6, 8, and 10 are rejected under 35 U.S.C. 103 as being unpatentable over by Miyazawa et al. (1991) in view of Rizvi et al. Claims 1 and 6 are drawn to a nucleic acid, claim 8 is drawn to a vector, and claim 10 is drawn to a pharmaceutical composition. The disclosure of Miyazawa et al. (1991) is discussed above. Miyazawa et al. (1991) does not disclose or suggest a poly-A region comprising 70-150 nucleotides, a vector comprising the nucleic acid, or a pharmaceutical composition comprising the claimed nucleic acid. Rizvi et al. discloses a codon optimized HGF mRNA comprising a poly-A tail comprising 101 nucleotides [see p. 7, col. 2, “mRNA production”] (instant claim 6). Rizvi et al. discloses a lipid nanoparticle (LNP) comprising the mRNA [see p. 7, col. 2, “LNP formulation of the mRNA”] (instant claim 8), and a pharmaceutical composition comprising the mRNA-LNP and phosphate buffered saline, which was then administered to mice [see p. 7, col. 2, “LNP formation of the mRNA” and p. 8, col. 1,“in vivo administration”] (instant claim 10). Rizvi et al. teaches that incorporation of modifications including optimized poly-A tails improves mRNA stability, translation, and reduces inflammatory responses [see p. 2, col. 1, par. 1, lines 1-12]. It would have been obvious to modify the native HGF nucleic acid poly-A sequence as disclosed by Miyazawa et al. (1991) to include a poly-A tail of the claimed length, because Rizvi et al. discloses a length that is optimized for HGF, and teaches that optimizing tail length improves mRNA stability, translational efficiency, and protein expression, while reducing immune activation. Furthermore, it would have been obvious to insert the native HGF sequence into a vector because vectors were conventional tools for cloning, propagation, and expression of nucleic acids. Finally, it would have been obvious to formulate the HGF nucleic acid of Miyazawa et al (1991) into a pharmaceutical composition because the art teaches that HGF mRNA formulated for administration is useful for therapeutic treatment, and describes suitable formulations for in vivo delivery. There would have been a reasonable expectation of success because Rizvi et al. demonstrates successful expression of HGF using this mRNA platform. Therefore, claims 1, 6, 8, and 10 are rejected under 35 U.S.C. 103. Allowable Subject Matter Claims 2, 3, and 7 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. The prior art does not teach or suggest the specific claimed sequences of SEQ ID NOs: 21-31 are required in claims 2 or the specific construct sequences as required by claim 7. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Tirone D Johnson whose telephone number is (571)272-1256. The examiner can normally be reached M-F, 9-5 ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jeffrey Stucker can be reached at (571)272-0911. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TIRONE D. JOHNSON/Examiner, Art Unit 1675 /JEFFREY STUCKER/Supervisory Patent Examiner, Art Unit 1675
Read full office action

Prosecution Timeline

Mar 13, 2023
Application Filed
Jul 10, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
Grant Probability
Low
PTA Risk
Based on 0 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month