DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 5/12/2026 has been entered.
Claim Status
Claims 1-8, 10-16, 18-25 and 27-52 are pending.
Claims 38-52 are withdrawn from examination as being drawn to non-elected inventions.
Claims 9, 17 and 26 are cancelled by the Applicant.
Claims 1-8, 10-16, 18-25 and 27-37 are being examined as part of the elected group of invention.
All previous objections and rejections not set forth below have been withdrawn in view of applicant’s amendments to the claims.
Claim Rejections - 35 USC § 103
Due to Applicant’s amendments, the rejection is modified from the rejection set forth on pages 16-26 in the Office action dated 01/12/2026.
Claims 1-8, 10-14 and 33-37 are rejected under 35 U.S.C. 103 as being obvious over Ntui et al. (Robust CRISPR/Cas9 mediated genome editing tool for banana and plantain (Musa spp.), 2020, Current Plant Biology 21:100128) in view of Barten et al. (US 2020/0140874 A1, published on 7th May 2020), Riesenberg et al. (Improved gRNA secondary structures allow editing of target sites resistant to CRISPR-Cas9 cleavage, 2022, Nat. Commun., 13:489; published online on 25th Jan. 2022) and Nishida et al. (WO2017090761 A1, published in 2017); in evidence of Lowder et al. (A CRISPR/Cas9 Toolbox for Multiplexed Plant Genome Editing and Transcriptional Regulation, 2015, Plant Physiology, 169:971–985), GenBank Accession No. OL452023 (submitted to GenBank on 10 November 2021), Addgene brochures for pYPQ131C, pYPQ132C, and pYPQ142), NovoPro pMDC32 brochure.
Claim 1 is drawn to a gene editing cloning system comprising a plurality of expression cassettes encoding a Cas protein, at least two gRNAs each having at last 15 nucleotide long sequence complementary to a target gene sequence wherein the gRNA scaffold sequence is a nucleic acid sequence comprising SEQ ID NO: 2, or a sequence at least 98% identical thereto.
Claim 33 is drawn to a vector comprising the gene editing cloning system of claim 1.
Ntui et al. teaches an efficient CRISPR/Cas9 genome editing protocol for banana and plantain using multiple gRNAs targeting phytoene desaturase (PDS) gene (abstract, line 3-5). Banana and plantain are monocot plants, as recited in claim 10. The Cas9 based genome editing system comprises two guide RNAs (gRNAs) (page 1, Abstract) having at least 15 nucleotides complementary to a target gene (page 2, left column, para 6, line 8-9) in banana and plantain plants (page 1, Abstract). The two gRNAs are cloned in at least two expression cassettes including pYPQ131C (for gRNA1) and pYPQ132C (for gRNA2), then assembled in the Golden Gate recipient Gateway vector pYPQ142 (page 3, left column, para 4, line 1-3), and finally cloned in a Gateway binary vector pMDC32 (page 3, left column, para 4, line 7-9). All the vectors contain selectable marker genes and promoters (Addgene brochure for pYPQ131C and pYPQ132C, pYPQ142, NovoPro pMDC32 brochure). Binary vector pMDC32 contains 35S CaMV promoter driving the selectable marker gene HPT (hygromycin phosphotransferase, which is also known as HTPII), as recited in claims 4 and 7; and the Cas9 gene driven by 2x 35S CaMV promoter (page 5, Fig. 2), as recited in claims 3 and 5; Nos Poly A transcription stop signal, as recited in claim 8 (page 5, Fig. 2). The gRNAs are driven by rice OsU6 promoter (page 5, Fig. 2), as recited in claim 2.
However, Ntui et al. does not explicitly describe any gRNA scaffold sequence comprising SEQ ID NO: 2 or a sequence at least 98% identical thereto.
Barten et al. defines the term “scaffold sequence” as a short RNA sequence comprising necessary for binding with an RNA-guided nuclease (p.15, para 0153, line 2-4) (e.g., Cas9). Barten et al. describes a CRISPR/Cas9 based genome editing system comprising gRNAs completed with scaffold sequences (page 15, para 0153) to edit endogenous target genes in a plant. Barten et al. describes several gRNAs (SEQ ID NOs: 27-30) comprising a scaffold sequence (p.25, para 0320, line 5-11) capable of binding to a corn optimized version of a Cas9 endonuclease (p.25, para 0320, line 5-8), which has more than 99% identical (100%) with instant SEQ ID NO: 2, fulfilling limitations of claims 1 and 13, as shown below using SEQ ID NO: 27 described by Barten et al.
RESULT 15
US-16-472-140-27
Sequence 28, US/16472140
Patent No. 12241074
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC
APPLICANT: Barten, Ty
APPLICANT: Cargill, Edward J
APPLICANT: Lamb, Jonathan C
APPLICANT: Lemke, Bryce M
APPLICANT: Rymarquis, Linda A
APPLICANT: Yang, Dennis H
TITLE OF INVENTION: GENOME EDITING-BASED CROP ENGINEERING AND PRODUCTION OF BRACHYTIC
TITLE OF INVENTION: PLANTS
FILE REFERENCE: P34495US01
CURRENT APPLICATION NUMBER: US/16/472,140
CURRENT FILING DATE: 2019-06-20
PRIOR APPLICATION NUMBER: PCT/US2017/067888
PRIOR FILING DATE: 2017-12-21
PRIOR APPLICATION NUMBER: US 62/438,370
PRIOR FILING DATE: 2016-12-22
NUMBER OF SEQ ID NOS: 43
SEQ ID NO 28
LENGTH: 314
TYPE: DNA
ORGANISM: Artificial Sequence
OTHER INFORMATION: Synthetic Sequence
Best Local Similarity 100.0%; Query Match 100.0%; Score 86; Length 314;
Matches 86; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAAC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 221 GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAAC 280
Qy 61 TTGAAAAAGTGGCACCGAGTCGGTGC 86
||||||||||||||||||||||||||
Db 281 TTGAAAAAGTGGCACCGAGTCGGTGC 306
Moreover, the gRNA scaffold sequences for various Cas proteins including Cas9, as used in this invention, are well-known in the art and as described by GenBank Accession No. OL452023 (from position 5033 to 5133 as clearly annotated; submitted on 10 November 2021) which has more than 98% sequence identity to instant SEQ ID NO: 2 (data not shown), and also publicly available as part of the commercially CRISPR-Cas9 gene editing vectors including Golden Gate and Gateway cloning vectors, such as pYPQ131C, as described by Lowder et al. (Abstract).
Before the effective filing date, it would have been obvious to one ordinarily skilled artisan to modify the system to edit target gene(s) in a plant genome by using plurality of expression cassettes comprising: at least two gRNAs and each having at least 15 nucleotide guide sequence complementary to a target gene, a Cas protein, a selectable marker gene, and a promoter, as described by Ntui et al. The modification would include linking the at least 15 nucleotide long gRNA, as described by Ntui et al., to contain a suitable gRNA scaffold sequence comprising more than 99% identity to instant SEQ ID NO: 2, as described by Barten et al. It is prudent to mention here that gRNA scaffold sequence is necessary by the gRNA to bind specific Cas endonuclease (Barten et al., p. 15, para 0153, line 2-4) and all the gRNAs (SEQ ID NOs: 27-30) with a scaffold sequence are capable to bind to a (plant) corn optimized version of Cas9 endonuclease (p. 15, para 0153, line 2-4), as recited in claims 5-6. Using a gRNA design comprising a scaffold sequence optimized for a specific Cas endonuclease would be beneficial to increase editing efficiency of most targets and allow cleavage of otherwise non-editable loci by minimize misfolding of the gRNA arising due to its secondary structure, while promoting the Cas9 polypeptide to bind to the target region (Riesenberg et al; page 6, right column, para 4). An ordinarily skilled artisan would acknowledge that transcription of any DNA sequence including the ones encoding the gRNA scaffold sequence needs to be operably linked to a transcription stop signal to maintain sequence integrity of the transcribed sequence. An ordinarily skilled artisan would also acknowledge that poly thymine (Poly T) sequence is a well-known and widely used transcription stop signal, as recited in claim 8.
Before the effective filing date of the invention, An ordinarily skilled artisan would have been motivated to develop a system comprising: at least two gRNAs which would include a scaffold sequence having at least 99% identical with SEQ ID NO: 2 and operably linked to a (transcription) stop signal; each gRNA having at least 15 nucleotide guide sequence complementary to a target gene; a Cas protein; a selectable marker gene; a promoter; with a realistic goal to edit specific target gene(s) in a plant genome more efficiently.
Regarding claims 2 and 14, Ntui et al. describes using plasmid pYPQ131C (for gRNA1) and pYPQ132C (for gRNA2) and using rice OsU6 promoter to drive the expression of the gRNAs (page 5, Fig. 2). Two plasmids (pYPQ131C and pYPQ132C) are the source for the OsU6 promoter used. The OsU6 promoter sequence (obtained from Addgene website: https://www.addgene.org/69284/sequences/) driving the first gRNA in pYPQ131C has more than 99% (100% identity while Query match is 99.4%) identical with instant SEQ ID NO: 24, as shown below.
Title: US-18-182-936-24
Perfect score: 247
Sequence: 1 ggatcatgaaccaacggcct..........gcgcgctgtcgcttgtgttg 247
Searched: 1 seqs, 3506 residues
Database : NASEQ2_06242025_153251.seq:*
RESULT 1
NASEQ2_06242025_153251
Best Local Similarity 100%; Query Match 99.4%; Score 245.4; DB 1; Length 3506;
Matches 246; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1819 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 1878
Qy 61 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1879 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 1938
Qy 121 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1939 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 1998
Qy 181 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1999 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 2058
Qy 241 TGTGTTG 245
||||| |
Db 2059 TGTGTGG 2063
There is only 1 nucleotide difference at the 3’ end of the OsU6 promoter (resulting in 99.4% query match) which generally occurs due to specific cloning strategy to fuse the downstream polynucleotide sequence, i.e., gRNA sequences in this case which would not affect the biological activity of the OsU6 promoter given the well-characterized nature of the OsU6 promoter.
Moreover, there are several known variants of the OsU6 promoters including one comprising 100% sequence identity to instant SEQ ID NO: 24, as shown below (SEQ ID NO: 11 in Nishida et al.; page 11, para 0113).
RESULT 9
BDY42676/c
ID BDY42676 standard; DNA; 18695 BP.
AC BDY42676;
DT 27-JUL-2017 (first entry)
DE Double-stranded DNA modification related vector 2408, SEQ ID 11.
KW cas9 gene; dna detection; ds; plant; plasmid; rna detection; site-specific mutagenesis; vector.
OS Oryza sativa.
OS Synthetic.
OS Unidentified.
CC PN WO2017090761-A1.
CC PD 01-JUN-2017.
CC PF 25-NOV-2016; 2016WO-JP085075.
PR 27-NOV-2015; 2015JP-00232379.
PR 06-JUL-2016; 2016JP-00134613.
CC PA (UYKO-) UNIV KOBE NAT CORP.
CC PI Nishida K, Shimatani Z, Kondo A;
DR WPI; 2017-35554A/41.
CC PT Modifying targeted site of double-stranded DNA possessed by bringing
CC PT complex comprising nucleic acid sequence-recognizing module bonded with
CC PT nucleic acid base converting enzyme into contact with double-stranded
CC PT DNA.
CC PS Example; SEQ ID NO 11; 59pp; Japanese.
CC The present invention relates to a method for modifying a targeted site
CC in double-stranded DNA possessed by monocot plant cells. The invention
CC further relates to: (1) a complex in which the nucleic acid sequence-
CC recognizing module that specifically binds with a target nucleotide
CC sequence in a double-stranded DNA possessed by monocot plant cells is
CC bonded with a nucleic acid base converting enzyme; and (2) a nucleic acid
CC encoding the nucleic acid altered enzyme complex. The method enables site
CC -specific modification of a nucleic acid base and introduction of site-
CC specific mutation in the genome of monocotyledonous plants, without
CC double-strand break or cleavage of the DNA. The method is safe, has high
CC mutagenesis efficiency, and avoids chromosomal dislocation due to off-
CC target cleavage. The present sequence represents a vector DNA comprising
CC rice cas9 gene, which is useful for modifying a targeted site in double-
CC stranded DNA possessed by monocot plant cells.
XX
SQ Sequence 18695 BP; 4829 A; 4530 C; 4713 G; 4623 T; 0 U; 0 Other;
Query Match 100.0%; Score 247; Length 18695; Best Local Similarity 100.0%;
Matches 247; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 883 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 824
Qy 61 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 823 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 764
Qy 121 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 763 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 704
Qy 181 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 703 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 644
Qy 241 TGTGTTG 247
|||||||
Db 643 TGTGTTG 637
It would have been an experimental design choice of an ordinarily skilled artisan to use any of the functional equivalent of the OsU6 promoter including the one described by Nishida et al., without negatively affecting the outcome.
Regarding claims 10-12, Ntui et al. describes using the gene editing system in banana and plantain plants (page 1, abstract). Both the plants are monocots (Wikipedia: https://en.wikipedia.org/wiki/Banana), as recited in claim 10. Plantain is an orphan crop (Spec, page 2, para 09), as recited in claims 11-12.
Regarding claims 34-35, Ntui et al. describes a plant and plant cells thereof, as well as tissue culture of the genome edited transgenic explant in embryogenic cell suspension culture after delivering the CRISPR/Cas vector containing the two gRNAs (page 1, abstract; page 5, left column, para 3).
Regarding claims 36-37, Ntui et al. describes regeneration of many viable mutant plants containing the desired change in the genome (page 6, Table 1). It is implied that the plants would produce seeds, and the seeds would be having the same genetic change in its genome. The seeds of the genome edited plants would produce plants.
Claims 15-16, 18-24, 27 and 30-31 are rejected under 35 U.S.C. 103 as being obvious over Lowder et al. (A CRISPR/Cas9 Toolbox for Multiplexed Plant Genome Editing and Transcriptional Regulation, 2015, Plant Physiology, 169:971–985), in view of Barten et al. (US US 2020/0140874 A1).
Claim 15 is drawn to a cloning kit comprising various components including a gRNA scaffold, wherein the gRNA scaffold sequence is a nucleic acid sequence comprising SEQ ID NO: 2, or a sequence at least 98% identical thereto.
Lowder et al. teaches a molecular toolbox for multifaceted CRISPR/Cas9 applications in plants (page 971, abstract). The toolbox is interpreted as a cloning kit as it provides researchers with a protocol and reagents to quickly and efficiently assemble functional CRISPR/Cas9 transfer DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods (page 971, abstract).
Lowder et al. teaches at least two (three) cloning vectors (pYPQ142, pYPQ143, and pYPQ144) containing LacZ gene (page 974, Fig. 2; page 975, left column, para 1, line 17-19; Table 1; and Addgene brochure with a map for pYPQ142, pYPQ143, and pYPQ144). Loweder et al. also teaches cloning vectors (for example, pYPQ131C and pYPQ132C) comprising a gRNA scaffold (page 975, Table 1; and Addgene brochure with a map for pYPQ131C and pYPQ132C). It also teaches Cas9 containing entry vector module comprising eight plasmids, viz. pYPQ150-167 (Table I; Supplemental Fig. S1) which comprises three Cas9 genes, as recited in claim 20. Three (pYPQ150, pYPQ154, and pYPQ167) of the Cas9 genes are plant codon-optimized Cas9 (page 973, right column, para 2), as recited in claim 21. All these vectors also comprise gRNA scaffold sequence that recognizes and binds to Cas9 endonuclease, as evident in the sequences of the vectors (as published in the Addgene brochures).
The cloning vectors contain different selectable markers including tetracycline resistance gene in pYPQ131C and pYPQ132C; and spectinomycin resistance gene in pYPQ143 and pYPQ144 (Addgene brochure with maps for pYPQ131C, pYPQ132C, pYPQ143, and pYPQ144). The modular design of these cloning vectors would enable an ordinarily skilled artisan to assemble a multiplex of CRISPR/Cas9 T-DNA vectors in three steps and requires very basic and well-known molecular biology techniques (page 976, left column, para 2). The assembled vector would be interpreted as a “destination vector”, in line of the instant specification describing “In some embodiments, multiple cassettes comprising said at least two cassettes from (i), said cassette from (ii), and said cassette from (iii) are assembled into a destination vector based on the unique overhangs. In some embodiments, the destination vector comprises the assembled multiple cassettes from (i), (ii), and (iii) vectors.” (Spec, para 10, last 2 lines).
However, Lowder et al. does not explicitly describe any gRNA scaffold sequence comprising more than 98% sequence identity to instant SEQ ID NO: 2.
Barten et al. describes a CRISPR/Cas9 based genome editing system comprising a gRNA scaffold sequence (within SEQ ID NO: 27) having more than 98% (100%) sequence identity with instant SEQ ID NO: 2, as evidenced by GenBank Accession No. OL452023 and the Golden Gate and Gateway cloning vector pYPQ131C, as discussed above.
Before the effective filing date, it would have been obvious to one ordinarily skilled artisan to develop a cloning kit comprising all the needed components by modifying the system, described by Loweder et al., to edit specific target gene(s) by using a gRNA comprising a gRNA scaffold sequence having more than 99% (as recited in claim 30) to instant SEQ ID NO: 2 (as described by Barten et al.), a vector comprising a nucleotide sequence encoding a suitable Cas protein like Cas9, selectable marker genes for each of the vectors or expression cassettes used, as described by Lowder et al. Choice of the scaffold sequence would have depended on the Cas protein used. The Cas protein needs to be Cas9 if the scaffold sequence is at least 98% identical to instant SEQ ID NO: 2, as described by Barten et al. Developing such a cloning kit would have enabled the artisan to quickly and efficiently assemble functional CRISPR/Cas9 DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods, as discussed by Lowder et al.
Before the effective filing date of the invention, an ordinarily skilled artisan would have been motivated to develop a cloning kit comprising all the needed components to edit target gene(s) by using a gRNA sequence comprising a scaffold sequence having more than 98% or 99%, or 100% sequence identity to instant SEQ ID NO: 2, a vector comprising a nucleotide sequence encoding a suitable Cas protein, selectable marker genes for each of the vectors or expression cassettes used. Developing such a cloning kit would have enabled the artisan to quickly and efficiently assemble functional CRISPR/Cas9 DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods.
It is noted here that claim 32 reciting “…the third selectable marker gene is GFP or eGFP”, depends from claim 15 reciting “…. Optionally (v) a vector comprising a cassette comprising a third selectable marker…”. Therefore, the third selectable marker gene as recited in claim 32 is optional. Thus, claim 32 can be included in this rejection. However, claim 32 is examined, nonetheless.
Regarding claim 16, all the reagents including primers and premixed buffers for various enzymes and for different reactions are part of standard, well known, and widely practiced protocols and used by Lowder et al. (page 974, Fig. 2). Designing primers including the control primers is also a well-known and widely practiced method.
Regarding claims 18-19, Lowder et al. describes the first set of Golden Gate entry vectors (pYPQ131C and pYPQ132C) each carrying a complete expression cassette for one gRNA under different promoters including the rice OsU3 promoter (page 975, left column, para 1, line 4-8) and OsU6 promoter sequence, as described later.
Regarding claim 22, Lowder et al. teaches hygromycin selection, which relies on presence of the hygromycin resistant gene HPTII, in the T-DNA vector (page 982, left column, para 4). The Applicant does not describe what the term “first” means in the context of the invention. Moreover, the term “first” does not confer any structural limitations on the product (the cloning kit) or change its property in any way.
Regarding claims 23-24, Lowder et al. describes first set of Golden Gate entry vectors (e.g., pYPQ131C and pYPQ132C) containing BasI and BbsI restriction sites (Addgene brochure for pYPQ131C and pYPQ132C). Both BasI and BbsI are type IIS restriction enzymes (New England Biolab website, FAQ: https://www.neb.com/en-us/faqs/2017/07/17/ which-restriction-enzymes-are-used-in-golden-gate-assembly) and used in cloning in the Golden Gate Assembly vectors.
Enzyme mix and the buffers for BasI and BbsI are well known and commercially available products. Moreover, the toolbox, as described by Lowder et al., includes the protocol and the reagents (page 1, Abstract) which would include required enzyme mixes for BasI and BbsI as well.
Regarding claim 27, Lowder et al. describes using the cloning kit for dicot and monocot plant cells (page 972, right column, para 3, last 3 lines).
Regarding claim 31, Lowder et al. describes a cloning kit containing a plasmid pYPQ131C which contains the OsU6 promoter. The OsU6 promoter sequence (obtained from Addgene website: https://www.addgene.org/69284/sequences/) driving the first gRNA in pYPQ131C has more than 99% (99.4%) sequence identical with instant SEQ ID NO: 24, as shown below.
Title: US-18-182-936-24
Perfect score: 247
Sequence: 1 ggatcatgaaccaacggcct..........gcgcgctgtcgcttgtgttg 247
Searched: 1 seqs, 3506 residues
Database : NASEQ2_06242025_153251.seq:*
RESULT 1
NASEQ2_06242025_153251
Query Match 99.4%; Score 245.4; DB 1; Length 3506; Best Local Similarity 99.6%;
Matches 246; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1819 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 1878
Qy 61 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1879 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 1938
Qy 121 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1939 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 1998
Qy 181 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1999 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 2058
Qy 241 TGTGTTG 247
||||| |
Db 2059 TGTGTGG 2065
There is only 1 nucleotide different almost at the 3’ end of the OsU6 promoter sequence. Given the well-characterized nature of the OsU6 promoter, a skilled artisan in the art would expect that sequences with >99% identity to SEQ ID NO: 24 would retain the biological activity of the OsU6 promoter.
Moreover, there are several known variants of the OsU6 promoter comprising 100% sequence identity to instant SEQ ID NO: 24, as discussed above. It would have been an experimental design choice of an ordinarily skilled artisan to use any of the functional equivalent of the OsU6 promoter without negatively affecting the outcome.
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Lowder et al. in view of Barten et al. as applied to reject claims 15-16, 18-24, 27 and 30-31 under 35 U.S.C. 103 above, and further in view Püllmann et al. (Golden Mutagenesis: An efficient multi-site-saturation mutagenesis approach by Golden Gate cloning with automated primer design, 2019, Scientific Repot, 9:10932).
Claim 25 depends from claim 15 and is drawn to a second red color selectable marker gene that is designed to be replaced with the assembled multiple cassettes.
Instant specification describes the “red color selectable marker” as “CRed, containing an artificial bacterial operon responsible for canthaxanthin biosynthesis” (Spec, page 5, para 19).
Lowder et al. in view of Barten et al. describes a Golden Gate vector based cloning kit comprising several cloning vectors with specific selection markers (page 974, Fig. 2), as described above.
However, Lowder et al. in view of Barten et al. does not describe any red color selectable marker including CRed.
Püllmann et al. describes optimization of a protocol for the implementation of Golden Gate-based mutagenesis system focusing on rational or random protein engineering. The success of the respective Golden Gate digestion-ligation approach can be directly observed and estimated on the agar plate due to the utilized blue (LacZ; pAGM9121) or orange (CRed; pAGM22082_CRed) selection markers (page 2, para 4; page 3, Fig. 1; page 4, Fig. 2). The screening of colonies containing recombinant constructs without inducing expression of the cloned genes requires a visual selection marker other than the widely spread blue/white LacZ color selection cassette, which requires basal lac promoter regulated expression and an IPTG/lactose induction (page 4, para 1). A novel pET28b based expression vector was therefore constructed, which carries an orange dye forming biosynthesis operon (termed CRed) under the control of a constitutive promotor.
Before the effective filing date, it would have been obvious to one ordinarily skilled artisan to modify the Golden Gate vectors such as pYPQ142, as described by Lowder et al., by replacing the LacZ with CRed, as described by Püllmann et al. Replacing LacZ with CRed would benefit in screening of colonies containing recombinant constructs without inducing expression by applying IPTG/lactose as needed for LacZ.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to replace LacZ coding sequence in a cloning vector like pYPQ142 with CRed with the objective to avoid induction of the LacZ using IPTG/Lactose while being able to detect recombinant constructs.
Claims 28-29 are rejected under 35 U.S.C. 103 as being unpatentable over Lowder et al. in view of Barten et al., as applied to reject claims 15-16, 18-24, 27 and 30-31 under USC 103 above, and further in view of Ntui et al.
Claims 28-29 directly or indirectly depend from claim 15, and are broadly drawn to a cell derived from a group of monocot or dicot orphan plants including plantain.
Lowder et al. in view of Barten et al. describes a cloning kit providing researchers with a protocol and reagents to quickly and efficiently assemble functional CRISPR/Cas9 transfer DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods, as described above.
However, Lowder et al. in view of Barten et al. does not describe any plant cell derived from orphan plants including plantain.
Ntui et al. describes gene editing in plantain (page 1, abstract). Plantain is described by the Applicant as an orphan crop (Spec, page 2, para 09).
Before the effective filing date, it would have been obvious to one ordinarily skilled artisan to use the genome editing cloning kit, as described by Lowder et al. in view of Barten et al., in commercially important orphan crop plantain, as described by Ntui et al.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to use the genome editing cloning kit in commercially important orphan crop plantain.
Claim 32 is rejected under 35 U.S.C. 103 as being unpatentable over Lowder et al. in view of Barten et al. as applied to reject claims 15-16, 18-24, 27 and 30-31 under 35 U.S.C. 103 above, and further in view of Riesenberg et al.
Claim 32 depends on indirectly depends from claim 15 and is drawn to a third selectable marker gene is GFP or eGFP.
Lowder et al. in view of Barten et al. describes a cloning kit providing researchers with a protocol and reagents to quickly and efficiently assemble functional CRISPR/Cas9 transfer DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods, as described above.
However, Lowder et al. in view of Barten et al. does not describe a GFP or eGFP marker gene.
Riesenberg et al. describes using a Cas9 based gene editing system containing a GFP/eGFP as a selection marker while using the pX458 cloning vector (page 7, left column, para 2; Addgene brochure for pX458). Using GFP/eGFP, as taught by Riesenberg et al., instead of LacZ in pYPQ143, as described by Lowder et al (page 974, Fig. 2), would have enabled an ordinarily skilled artisan to benefit from screening the colonies containing recombinant constructs without inducing expression by applying IPTG/lactose as needed for LacZ.
Response to Applicants’ arguments
The argument set forth in the Applicant’s reply on 5/212/2026 to the rejection of claims under 35 U.S.C. 103 has been fully considered but not found persuasive.
The Applicant argues “The Office has not established a motivation to combine the disclosure of Ntui with Barten's SEQ ID NO: 27, which is not annotated, identified, or exemplified anywhere in Barten” (response, p.9, para 5). All other objections by the Applicant boils down to the same argument.
The Examiner disagrees. Barten et al. teaches that a gRNA scaffold sequence is necessary for the gRNA to bind specific Cas endonuclease (p. 15, para 0153, line 2-4). Barten et al. describes several gRNAs (SEQ ID NOs: 27-30) attached to a specific scaffold sequence capable to bind to a corn optimized version of Streptococcus pyogenes Cas9 (spCas9) endonuclease (p. 15, para 0153, line 2-4) and fused to spacer sequence of the gRNA which, in turn, fused to a promoter sequence (SEQ ID NO: 4) (p. 15, para 0153, line 8-11). Polynucleotide sequence from nucleotide position 221 to 306 in every gRNA sequence (SEQ ID NO: 27-30) has the same scaffold sequence (data not shown) which has more than 99% sequence identity to instant SEQ ID NO: 2, as shown above; and the scaffold sequence binds to the Cas9 endonuclease. It is prudent to mention here that the gRNA scaffold sequence is needed only for the specific Cas endonuclease to bind the gRNA comprising a spacer sequence which actually decide target sequence recognition and subsequent cleavage at/near the PAM sequence in the target sequence. Any scaffold sequence, which would be functional equivalent of instant SEQ ID NO: 2, that is recognized by the Cas9 endonuclease would be sufficient to perform all the functions of the genome editing.
Given the well-characterized nature of the gRNA scaffold sequences for various Cas proteins including Cas9, as used in this invention, are well-known in the art and as described by GenBank Accession No. OL452023 (from position 5033 to 5133 and clearly annotated; submitted on 10 November 2021) which has 100% sequence identity to instant SEQ ID NO: 2 (data not shown), and also publicly available as part of the commercially CRISPR-Cas9 gene editing vectors including Golden Gate and Gateway cloning vectors, as described by Lowder et al. (Abstract). Many of the components of the CRISPR-Cas based techniques including designing gRNAs with a scaffold sequence became a routine and standard process in the art1. Designing and using any specific gRNA sequence depends on the Cas protein being used, which dictates specific scaffold sequence to be used, and the target sequence to be edited, became a routine and standard technique in the art.
Conclusion
No claim is allowed.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
1 Cui et al. (Review of CRISPR/Cas9 sgRNA Design Tools, Interdisciplinary Sciences: Computational Life Sciences, 2018, 10:455-465) provides the evidence that designing gRNA along with its scaffold sequence became a routine and standard process in the art (page 455, bridging paragraph between last para in the left column and first para in the right column).
Prosecution Insights