DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-16 and 18-52 are pending.
Claims 38-52 are withdrawn from examination as being drawn to non-elected inventions.
Claim 17 is cancelled by the Applicant.
Claims 1- 16 and 18-37 are being examined as part of the elected group of invention.
All previous objections and rejections not set forth below have been withdrawn in view of applicant’s amendments to the claims.
However, the claim amendments by the Applicant by adding new issues, which was not present in any of the claims before, necessitated new prior art references and new grounds of rejections, as discussed below.
Claim Rejections - 35 USC § 112(b) and 102(a)(1)
Response to Applicants’ arguments: Amendments made to the claims and the arguments filed in Applicant’s response submitted on 10/23/2025 overcame the rejections of record.
Claim Rejections - 35 USC § 112(a)
Written Description
Claims 9, 26, and 34 remain rejected and claims 35-37 are newly rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new rejection necessitated by the claim amendments.
Claims 9, 26 and 34-37 are broadly drawn to the gRNA binding to at least one genomic region of a target gene, thereby acquiring or enhancing a trait selected from a broad genus comprising of pest and pathogen resistance, insect resistance, plant-disease resistance, drought tolerance, flood tolerance, nutrient biofortification and high yield.
The Applicant describes editing the Phytoene desaturase (PDS) gene in banana and plantain (Musa spp.) (Spec, page 55, para 217). PDS is a key enzyme in the carotenoid biosynthesis pathway. The gene has been used as a marker to establish CRISPR/Cas9-mediated genome editing in several plant species (Ntui et al., page 2, left column, para 4). Disruption of PDS affects photosynthesis, gibberellin and carotenoid biosynthesis causing albinism and dwarfing (Ntui et al., page 2, left column, para 4). Neither PDS nor any mutation in the PDS gene/polypeptide is known to be involved in any of the traits claimed hereto.
The Applicant does not describe the structure function relationship between mutating/ editing the PDS gene and/or the PDS protein with acquiring or enhancing resistance against any insect or any pathogen, plant-disease resistance, drought tolerance, flood tolerance, nutrient biofortification, or high yield. Current status of the art also does not establish any structure function relationship between editing the PDS gene and/or the PDS protein with acquiring or enhancing resistance against any insect or any pathogen, plant-disease resistance, drought tolerance, flood tolerance, nutrient biofortification, or high yield.
Considering the breadth of the claims, lack of any representative species of the broad genus claimed, lack of structure function relationship of the broad genus claimed and the claimed functions, the Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Response to Applicants’ arguments: The Applicant argues that, “The specification describes the components and functionality of the system in detail, and a person of ordinary skill in the art would understand how to apply it to different genes to achieve trait enhancement recited in the specification. Accordingly, the claimed invention is sufficiently described and reasonably conveyed by the specification” (Response, page 9, para 5).
The Examiner disagrees. The instant description including Paragraph [0161], [0013]-[0015], [0175], [0181], and [0184], as cited in the footnote (Response, page 9), describes probable use (“some embodiments”) of the instant invention as stipulated by the Applicant. The actual examples (which starts at page 21, para 202) neither contain any data or result nor describe any structure-function relationship between mutating/editing the PDS gene and/or the PDS protein with several economically important traits comprising acquiring or enhancing resistance against any insect or any pathogen, plant-disease resistance, drought tolerance, flood tolerance, nutrient biofortification, or high yield. Current status of the art also does not establish any structure function relationship between editing the PDS gene and/or the PDS protein with acquiring or enhancing resistance against any insect or any pathogen, plant-disease resistance, drought tolerance, flood tolerance, nutrient biofortification, or high yield.
The Applicant is reminded that an invention described solely in terms of a method of making and/or its function may lack written descriptive support where there is no described or art-recognized correlation between the disclosed function and the structure(s), which include(s) polynucleotide and/or polypeptide sequences, responsible for the function. See MPEP § 2163.
Claim Rejections - 35 USC § 103
Due to Applicant’s amendments, the rejection is modified from the rejection set forth on pages 16-26 in the Office action dated 07/15/2025.
Claims 1-8, 10-14, and 33-37 are rejected under 35 U.S.C. 103 as being obvious over Ntui et al. (Robust CRISPR/Cas9 mediated genome editing tool for banana and plantain (Musa spp.), 2020, Current Plant Biology 21:100128) in view of Barten et al. (US 2020/0140874 A1, published on 7th May 2020), in evidence of Riesenberg et al. (Improved gRNA secondary structures allow editing of target sites resistant to CRISPR-Cas9 cleavage, 2022, Nat. Commun., 13:489; published online on 25th Jan. 2022), Addgene brochures for pYPQ131C, pYPQ132C, and pYPQ142), NovoPro pMDC32 brochure, and Nishida et al. (WO2017090761 A1, published in 2017).
Claim 1 is drawn to a gene editing cloning system comprising a plurality of expression cassettes comprising at last 15 nucleotide long gRNA sequence complementary to a target gene sequence wherein the gRNA scaffold sequence is a nucleic acid sequence comprising SEQ ID NO: 2, or a sequence at least 98% identical thereto.
Claim 33 is drawn to a vector comprising the gene editing cloning system of claim 1.
Ntui et al. teaches a Cas9 based genome editing system using two guide RNAs (gRNAs) (page 1, Abstract) having at least 15 nucleotides complementary to a target gene (page 2, left column, para 6, line 8-9) in banana and plantain plants (page 1, Abstract). The two gRNAs are cloned in at least two expression cassettes including pYPQ131C (for gRNA1) and pYPQ132C (for gRNA2), then assembled in the Golden Gate recipient and Gateway vector pYPQ142 (page 3, left column, para 4, line 1-3), and finally cloned in a Gateway binary vector pMDC32 (page 3, left column, para 4, line 7-9). All the vectors contain selectable marker genes and promoters (Addgene brochure for pYPQ131C and pYPQ132C, pYPQ142, NovoPro pMDC32 brochure). Binary vector pMDC32 contains the Cas9 gene (page 5, Fig. 2), as recited in claim 5.
However, Ntui et al. does not explicitly describe any gRNA scaffold sequence comprising SEQ ID NO: 2 or a sequence at least 98% identical thereto.
Barten et al. describes a CRISPR/Cas9 based genome editing system comprising gRNAs completed with scaffold sequences (page 15, para 0153) to edit endogenous target genes in a plant. It describes several gRNA scaffold sequences including the one comprising SEQ ID NO: 27 having more than 99% identical with instant SEQ ID NO: 2, fulfilling limitations of claims 1 and 13, as shown below.
RESULT 14
US-16-472-140-27 (US20200140874A1, published on 2020/05/07)
Sequence 27, US/16472140
Patent No. 12241074
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC
APPLICANT: Barten, Ty
APPLICANT: Cargill, Edward J
APPLICANT: Lamb, Jonathan C
APPLICANT: Lemke, Bryce M
APPLICANT: Rymarquis, Linda A
APPLICANT: Yang, Dennis H
TITLE OF INVENTION: GENOME EDITING-BASED CROP ENGINEERING AND PRODUCTION OF BRACHYTIC
TITLE OF INVENTION: PLANTS
FILE REFERENCE: P34495US01
CURRENT APPLICATION NUMBER: US/16/472,140
CURRENT FILING DATE: 2019-06-20
PRIOR APPLICATION NUMBER: PCT/US2017/067888
PRIOR FILING DATE: 2017-12-21
PRIOR APPLICATION NUMBER: US 62/438,370
PRIOR FILING DATE: 2016-12-22
NUMBER OF SEQ ID NOS: 43
SEQ ID NO 27
LENGTH: 314
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic Sequence
Query Match 100.0%; Score 86; Length 314; Best Local Similarity 100.0%;
Matches 86; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAAC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 221 GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAAC 280
Qy 61 TTGAAAAAGTGGCACCGAGTCGGTGC 86
||||||||||||||||||||||||||
Db 281 TTGAAAAAGTGGCACCGAGTCGGTGC 306
Before the effective filing date, it would have been obvious to one ordinarily skilled artisan to modify the system to edit target gene(s) in a plant genome by using plurality of expression cassettes comprising: at least two gRNAs and each having at least 15 nucleotide guide sequence complementary to a target gene, a Cas protein, a selectable marker gene, and a promoter, as described by Ntui et al. The modification would include linking the at least 15 nucleotide long gRNA, as described by Ntui et al., to contain a suitable gRNA scaffold sequence comprising more than 99% identity to instant SEQ ID NO: 2, as described by Barten et al. Using a gRNA design comprising a scaffold sequence would be beneficial to increase editing efficiency of most targets and allow cleavage of otherwise non-editable loci by minimize misfolding of the gRNA arising due to its secondary structure, while promoting the Cas9 polypeptide to bind to the target region (Riesenberg et al; page 6, right column, para 4). An ordinarily skilled artisan would acknowledge that transcription of any DNA sequence including the ones encoding the gRNA scaffold sequence needs to be operably linked to a transcription stop signal to maintain sequence integrity of the transcribed sequence. An ordinarily skilled artisan would also acknowledge that poly thymine (Poly T) sequence is a well-known and widely used transcription stop signal, as recited in claim 8.
Before the effective filing date of the invention, An ordinarily skilled artisan would have been motivated to develop a system comprising: at least two gRNAs which would include a scaffold sequence having at least 99% identical with SEQ ID NO: 2 and operably linked to a (transcription) stop signal; each gRNA having at least 15 nucleotide guide sequence complementary to a target gene; a Cas protein; a selectable marker gene; a promoter; with a realistic goal to edit specific target gene(s) in a plant genome more efficiently.
Regarding claims 2 and 14, Ntui et al. describes using plasmid pYPQ131C (for gRNA1) and pYPQ132C (for gRNA2) and using rice OsU6 promoter to drive the expression of the gRNAs (page 5, Fig. 2). Two plasmids (pYPQ131C and pYPQ132C) are the source for the OsU6 promoter used. The OsU6 promoter sequence (obtained from Addgene website: https://www.addgene.org/69284/sequences/) driving the first gRNA in pYPQ131C has more than 99% (99.4%) identical with instant SEQ ID NO: 24, as shown below.
Title: US-18-182-936-24
Perfect score: 247
Sequence: 1 ggatcatgaaccaacggcct..........gcgcgctgtcgcttgtgttg 247
Searched: 1 seqs, 3506 residues
Database : NASEQ2_06242025_153251.seq:*
RESULT 1
NASEQ2_06242025_153251
Query Match 99.4%; Score 245.4; DB 1; Length 3506; Best Local Similarity 99.6%;
Matches 246; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1819 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 1878
Qy 61 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1879 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 1938
Qy 121 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1939 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 1998
Qy 181 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1999 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 2058
Qy 241 TGTGTTG 247
||||| |
Db 2059 TGTGTGG 2065
There is only 1 nucleotide difference at the 3’ end of the OsU6 promoter. Given the well-characterized nature of the OsU6 promoter, a skilled artisan in the art would expect that sequences with >99% identity to SEQ ID NO: 24 would retain the biological activity of the OsU6 promoter.
Moreover, there are several known variants of the OsU6 promoters including one comprising 100% sequence identity to instant SEQ ID NO: 24, as shown below (SEQ ID NO: 11 in Nishida et al.; page 11, para 0113).
RESULT 9
BDY42676/c
ID BDY42676 standard; DNA; 18695 BP.
AC BDY42676;
DT 27-JUL-2017 (first entry)
DE Double-stranded DNA modification related vector 2408, SEQ ID 11.
KW cas9 gene; dna detection; ds; plant; plasmid; rna detection; site-specific mutagenesis; vector.
OS Oryza sativa.
OS Synthetic.
OS Unidentified.
CC PN WO2017090761-A1.
CC PD 01-JUN-2017.
CC PF 25-NOV-2016; 2016WO-JP085075.
PR 27-NOV-2015; 2015JP-00232379.
PR 06-JUL-2016; 2016JP-00134613.
CC PA (UYKO-) UNIV KOBE NAT CORP.
CC PI Nishida K, Shimatani Z, Kondo A;
DR WPI; 2017-35554A/41.
CC PT Modifying targeted site of double-stranded DNA possessed by bringing
CC PT complex comprising nucleic acid sequence-recognizing module bonded with
CC PT nucleic acid base converting enzyme into contact with double-stranded
CC PT DNA.
CC PS Example; SEQ ID NO 11; 59pp; Japanese.
CC The present invention relates to a method for modifying a targeted site
CC in double-stranded DNA possessed by monocot plant cells. The invention
CC further relates to: (1) a complex in which the nucleic acid sequence-
CC recognizing module that specifically binds with a target nucleotide
CC sequence in a double-stranded DNA possessed by monocot plant cells is
CC bonded with a nucleic acid base converting enzyme; and (2) a nucleic acid
CC encoding the nucleic acid altered enzyme complex. The method enables site
CC -specific modification of a nucleic acid base and introduction of site-
CC specific mutation in the genome of monocotyledonous plants, without
CC double-strand break or cleavage of the DNA. The method is safe, has high
CC mutagenesis efficiency, and avoids chromosomal dislocation due to off-
CC target cleavage. The present sequence represents a vector DNA comprising
CC rice cas9 gene, which is useful for modifying a targeted site in double-
CC stranded DNA possessed by monocot plant cells.
XX
SQ Sequence 18695 BP; 4829 A; 4530 C; 4713 G; 4623 T; 0 U; 0 Other;
Query Match 100.0%; Score 247; Length 18695; Best Local Similarity 100.0%;
Matches 247; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 883 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 824
Qy 61 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 823 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 764
Qy 121 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 763 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 704
Qy 181 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 703 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 644
Qy 241 TGTGTTG 247
|||||||
Db 643 TGTGTTG 637
It would have been an experimental design choice of an ordinarily skilled artisan to use any of the functional equivalent of the OsU6 promoter including the one described by Nishida et al., without negatively affecting the outcome.
Regarding claim 3, Ntui et al. describes using 2x35S CaMV promoter for expression of the Cas protein (page 5, Fig. 2).
Regarding claim 4, Ntui et al. describes using 35S CaMV promoter for expression of the selectable marker gene (hygromycin resistance gene) (page 5, Fig. 2).
Regarding claim 5, Ntui et al. describes using Cas9 protein (page 5, Fig. 2).
Regarding claim 6, Ntui et al. describes using plant codon optimized Cas9 gene encoding the Cas9 protein (page 3, left column, para 3, last 2 lines).
Regarding claim 7, Ntui et al. describes using the selectable marker gene, hygromycin phosphotransferase (HPTII), encoding the hygromycin phosphotransferase (hpt) (page 5, Fig. 2).
Regarding claims 10-12, Ntui et al. describes using the gene editing system in banana and plantain plants (page 1, abstract). Both the plants are monocots (Wikipedia: https://en.wikipedia.org/wiki/Banana), as recited in claim 10. Plantain is an orphan crop (Spec, page 2, para 09), as recited in claims 11-12.
Regarding claims 34-35, Ntui et al. describes a plant and plant cells thereof, as well as tissue culture of the genome edited transgenic explant in embryogenic cell suspension culture after delivering the CRISPR/Cas vector containing the two gRNAs (page 1, abstract; page 5, left column, para 3).
Regarding claims 36-37, Ntui et al. describes regeneration of many viable mutant plants containing the desired change in the genome (page 6, Table 1). It is implied that the plants would produce seeds, and the seeds would be having the same genetic change in its genome. The seeds of the genome edited plants would produce plants.
Claims 15-16, 18-24, 27 and 30-31 are rejected under 35 U.S.C. 103 as being obvious over Lowder et al. (A CRISPR/Cas9 Toolbox for Multiplexed Plant Genome Editing and Transcriptional Regulation, 2015, Plant Physiology, 169:971–985), in view of Barten et al. (US US 2020/0140874 A1).
Claim 15 is drawn to a cloning kit comprising various components including a gRNA scaffold, wherein the gRNA scaffold sequence is a nucleic acid sequence comprising SEQ ID NO: 2, or a sequence at least 98% identical thereto.
Lowder et al. teaches a molecular toolbox for multifaceted CRISPR/Cas9 applications in plants (page 971, abstract). The toolbox is interpreted as a cloning kit as it provides researchers with a protocol and reagents to quickly and efficiently assemble functional CRISPR/Cas9 transfer DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods (page 971, abstract).
Lowder et al. teaches at least two cloning vectors (pYPQ142, pYPQ143, and pYPQ144) containing LacZ gene (page 974, Fig. 2; page 975, left column, para 1, line 17-19; Table 1; and Addgene brochure with a map for pYPQ142, pYPQ143, and pYPQ144). Loweder et al. also teaches cloning vectors (for example, pYPQ131C and pYPQ132C) comprising a gRNA scaffold (page 975, Table 1; and Addgene brochure with a map for pYPQ131C and pYPQ132C). It also teaches Cas9 containing entry vector module comprising eight plasmids, viz. pYPQ150-167 (Table I; Supplemental Fig. S1) which comprises three Cas9 genes, as recited in claim 20. Three (pYPQ150, pYPQ154, and pYPQ167) of the Cas9 genes are plant codon-optimized Cas9 (page 973, right column, para 2), as recited in claim 21.
The cloning vectors contain different selectable markers including tetracycline resistance gene in pYPQ131C and pYPQ132C; and spectinomycin resistance gene in pYPQ143 and pYPQ144 (Addgene brochure with maps for pYPQ131C, pYPQ132C, pYPQ143, and pYPQ144). The modular design of these cloning vectors would enable an ordinarily skilled artisan to assemble a multiplex of CRISPR/Cas9 T-DNA vectors in three steps and requires very basic and well-known molecular biology techniques (page 976, left column, para 2). The assembled vector would be interpreted as a “destination vector”, in line of the instant specification describing “In some embodiments, multiple cassettes comprising said at least two cassettes from (i), said cassette from (ii), and said cassette from (iii) are assembled into a destination vector based on the unique overhangs. In some embodiments, the destination vector comprises the assembled multiple cassettes from (i), (ii), and (iii) vectors.” (Spec, para 10, last 2 lines).
However, Lowder et al. does not explicitly describe any gRNA scaffold sequence comprising more than 98% sequence identity to instant SEQ ID NO: 2.
Barten et al. describes a CRISPR/Cas9 based genome editing system comprising a gRNA scaffold sequence (SEQ ID NO: 27) having more than 98% (100%) sequence identity with instant SEQ ID NO: 2, as discussed above.
Before the effective filing date, it would have been obvious to one ordinarily skilled artisan to develop a cloning kit comprising all the needed components by modifying the system, described by Loweder et al., to specific edit target gene(s) by using a gRNA comprising a gRNA scaffold sequence having more than 99% (as recited in claim 30) or 100% sequence identity to instant SEQ ID NO: 2 (as described by Barten et al.), a vector comprising a nucleotide sequence encoding a suitable Cas protein, selectable marker genes for each of the vectors or expression cassettes used, as described by Lowder et al. Choice of the scaffold sequence would have been depended on the Cas protein used. The Cas protein needs to be Cas9 if the scaffold sequence is 100% identical to instant SEQ ID NO: 2. Developing such a cloning kit would have enabled the artisan to quickly and efficiently assemble functional CRISPR/Cas9 transfer DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods, as discussed by Lowder et al.
Before the effective filing date of the invention, an ordinarily skilled artisan would have been motivated to develop a cloning kit comprising all the needed components to edit target gene(s) by using a gRNA sequence comprising a scaffold sequence having more than 98% or 99%, or 100% sequence identity to instant SEQ ID NO: 2, a vector comprising a nucleotide sequence encoding a suitable Cas protein, selectable marker genes for each of the vectors or expression cassettes used. Developing such a cloning kit would have enabled the artisan to quickly and efficiently assemble functional CRISPR/Cas9 transfer DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods.
Regarding claim 16, all the reagents including primers and premixed buffers for various enzymes and for different reactions are part of standard, well known, and widely practiced protocols and used by Lowder et al. (page 974, Fig. 2). Designing primers including the control primers is also a well-known and widely practiced method.
Regarding claims 18-19, Lowder et al. describes the first set of Golden Gate entry vectors (pYPQ131C and pYPQ132C) each carrying a complete expression cassette for one gRNA under different promoters including the rice OsU3 promoter (page 975, left column, para 1, line 4-8).
Regarding claim 22, Lowder et al. teaches hygromycin selection, which relies on presence of the hygromycin resistant gene HPTII, in the T-DNA vector (page 982, left column, para 4). The Applicant does not describe what the term “first” means in the context of the invention. Moreover, the term “first” does not confer any structural limitations on the product (the cloning kit) or change its property in any way.
Regarding claims 23-24, Lowder et al. describes first set of Golden Gate entry vectors (e.g., pYPQ131C and pYPQ132C) containing BasI and BbsI restriction sites (Addgene brochure for pYPQ131C and pYPQ132C). Both BasI and BbsI are type IIS restriction enzymes (New England Biolab website, FAQ: https://www.neb.com/en-us/faqs/2017/07/17/ which-restriction-enzymes-are-used-in-golden-gate-assembly) and used in cloning in the Golden Gate Assembly vectors.
Enzyme mix and the buffers for BasI and BbsI are well known and commercially available products. Moreover, the toolbox, as described by Lowder et al., includes the protocol and the reagents (page 1, Abstract) which would include required enzyme mixes for BasI and BbsI as well.
Regarding claim 27, Lowder et al. describes using the cloning kit for dicot and monocot plant cells (page 972, right column, para 3, last 3 lines).
Regarding claim 31, Lowder et al. describes a cloning kit containing a plasmid pYPQ131C which contains the OsU6 promoter. The OsU6 promoter sequence (obtained from Addgene website: https://www.addgene.org/69284/sequences/) driving the first gRNA in pYPQ131C has more than 99% (99.4%) sequence identical with instant SEQ ID NO: 24, as shown below.
Title: US-18-182-936-24
Perfect score: 247
Sequence: 1 ggatcatgaaccaacggcct..........gcgcgctgtcgcttgtgttg 247
Searched: 1 seqs, 3506 residues
Database : NASEQ2_06242025_153251.seq:*
RESULT 1
NASEQ2_06242025_153251
Query Match 99.4%; Score 245.4; DB 1; Length 3506; Best Local Similarity 99.6%;
Matches 246; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1819 GGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAA 1878
Qy 61 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1879 AAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGT 1938
Qy 121 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1939 ACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTT 1998
Qy 181 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1999 AGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCT 2058
Qy 241 TGTGTTG 247
||||| |
Db 2059 TGTGTGG 2065
There is only 1 nucleotide different almost at the 3’ end of the OsU6 promoter sequence. Given the well-characterized nature of the OsU6 promoter, a skilled artisan in the art would expect that sequences with >99% identity to SEQ ID NO: 24 would retain the biological activity of the OsU6 promoter.
Moreover, there are several known variants of the OsU6 promoter comprising 100% sequence identity to instant SEQ ID NO: 24, as discussed above. It would have been an experimental design choice of an ordinarily skilled artisan to use any of the functional equivalent of the OsU6 promoter without negatively affecting the outcome.
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Lowder et al. in view of Barten et al. as applied to reject claims 15-16, 18-24, 27 and 30-31 under 35 U.S.C. 103 above, and further in view Püllmann et al. (Golden Mutagenesis: An efficient multi-site-saturation mutagenesis approach by Golden Gate cloning with automated primer design, 2019, Scientific Repot, 9:10932).
Claim 25 depends from claim 15 and is drawn to a second red color selectable marker gene that is designed to be replaced with the assembled multiple cassettes.
Instant specification describes the “red color selectable marker” as “CRed, containing an artificial bacterial operon responsible for canthaxanthin biosynthesis” (Spec, page 5, para 19).
Lowder et al. in view of Barten et al. describes a Golden Gate vector based cloning kit comprising several cloning vectors with specific selection markers (page 974, Fig. 2), as described above.
However, Lowder et al. in view of Barten et al. does not describe any red color selectable marker including CRed.
Püllmann et al. describes optimization of a protocol for the implementation of Golden Gate-based mutagenesis system focusing on rational or random protein engineering. The success of the respective Golden Gate digestion-ligation approach can be directly observed and estimated on the agar plate due to the utilized blue (LacZ; pAGM9121) or orange (CRed; pAGM22082_CRed) selection markers (page 2, para 4; page 3, Fig. 1; page 4, Fig. 2). The screening of colonies containing recombinant constructs without inducing expression of the cloned genes requires a visual selection marker other than the widely spread blue/white LacZ color selection cassette, which requires basal lac promoter regulated expression and an IPTG/lactose induction (page 4, para 1). A novel pET28b based expression vector was therefore constructed, which carries an orange dye forming biosynthesis operon (termed CRed) under the control of a constitutive promotor.
Before the effective filing date, it would have been obvious to one ordinarily skilled artisan to modify the Golden Gate vectors such as pYPQ142, as described by Lowder et al., by replacing the LacZ with CRed, as described by Püllmann et al. Replacing LacZ with CRed would benefit in screening of colonies containing recombinant constructs without inducing expression by applying IPTG/lactose as needed for LacZ.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to replace LacZ coding sequence in a cloning vector like pYPQ142 with CRed with the objective to avoid induction of the LacZ using IPTG/Lactose while being able to detect recombinant constructs.
Claims 28-29 are rejected under 35 U.S.C. 103 as being unpatentable over Lowder et al. in view of Barten et al., as applied to reject claims 15-16, 18-24, 27 and 30-31 under USC 103 above, and further in view of Ntui et al.
Claims 28-29 directly or indirectly depend from claim 15, and are broadly drawn to a cell derived from a group of monocot or dicot orphan plants including plantain.
Lowder et al. in view of Barten et al. describes a cloning kit providing researchers with a protocol and reagents to quickly and efficiently assemble functional CRISPR/Cas9 transfer DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods, as described above.
However, Lowder et al. in view of Barten et al. does not describe any plant cell derived from orphan plants including plantain.
Ntui et al. describes gene editing in plantain (page 1, abstract). Plantain is described by the Applicant as an orphan crop (Spec, page 2, para 09).
Before the effective filing date, it would have been obvious to one ordinarily skilled artisan to use the genome editing cloning kit, as described by Lowder et al. in view of Barten et al., in commercially important orphan crop plantain, as described by Ntui et al.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to use the genome editing cloning kit in commercially important orphan crop plantain.
Claim 32 is rejected under 35 U.S.C. 103 as being unpatentable over Lowder et al. in view of Barten et al. as applied to reject claims 15-16, 18-24, 27 and 30-31 under 35 U.S.C. 103 above, and further in view of and Riesenberg et al.
Claim 32 depends on indirectly depends from claim 15 and is drawn to a third selectable marker gene is GFP or eGFP.
Lowder et al. in view of Barten et al. describes a cloning kit providing researchers with a protocol and reagents to quickly and efficiently assemble functional CRISPR/Cas9 transfer DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods, as described above.
However, Lowder et al. in view of Barten et al. does not describe a GFP or eGFP marker gene.
Riesenberg et al. describes using a Cas9 based gene editing system containing a GFP/eGFP as a selection marker while using the pX458 cloning vector (page 7, left column, para 2; Addgene brochure for pX458). Using GFP/eGFP, as taught by Riesenberg et al., instead of LacZ in pYPQ143, as described by Lowder et al (page 974, Fig. 2), would have enabled an ordinarily skilled artisan to benefit from screening the colonies containing recombinant constructs without inducing expression by applying IPTG/lactose as needed for LacZ.
The applicant does not describe what the term “third” means in the context of the innovation. Moreover, the term “third” does not confer any structural limitations on the product (the cloning kit) or change its property in any way.
Response to Applicants’ arguments: The Applicant argues that, (considering the amendments) “the cited art fails to disclose, teach, or render obvious the specific sequence identity requirement now recited in amended claim 1” (page 5, para 7) (and other claims with the same or similar amendment). The Applicant continue to argue that, “the combination proposed by the Examiner relies on hindsight reconstruction” (page 5, last para).
The Examiner disagrees. New prior art (Barten et al.), as discussed in the above Office action, satisfies the amended claims comprising “at least 98%” (in claims 1 and 15) or “at least 99%” (in claims 13 and 30) identity to instant SEQ ID NO: 2. Moreover, it would have been obvious to an ordinarily skilled artisan to use functional equivalent scaffold sequences without affecting the outcome, given the well-characterized nature of the gRNA scaffold sequences for various Cas proteins including Cas9, as used in this invention, are well-known in the art and also publicly available as part of the commercially CRISPR-Cas gene editing vectors including Golden Gate and Gateway cloning vectors, as described by Lowder et al. (Abstract).
CRISPR-Cas became a well- known and standard technique of gene editing in different organisms including plants. It is routinely used as tool to edit almost any genomic sequence in any crop including economically important crops like banana and plantain, as described by Ntui et al. Many of the components of the CRISPR-Cas based techniques comprising designing gRNA with its scaffold sequence became a routine and standard process in the art1. Designing and using any specific gRNA sequence, depending on the Cas protein being used and the target sequence to be edited, also became a standard technique in the art. An ordinarily skilled artisan has many functional equivalent reagents comprising different Cas proteins, corresponding gRNA (along with specific scaffold sequences optimized for the specific Cas protein used) and other rather common reagents in the CRISPR-Cas toolbox to choose from without negatively affecting the outcome.
Conclusion
No claim is allowed.
However, claims 9, 26 and 34-37 are free of prior art.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
1 Cui et al. (Review of CRISPR/Cas9 sgRNA Design Tools, Interdisciplinary Sciences: Computational Life Sciences, 2018, 10:455-465) provides the evidence that designing gRNA along with its scaffold sequence became a routine and standard process in the art (page 455, bridging paragraph between last para in the left column and first para in the right column).