Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
2. Applicant’s election without traverse of Group I, claims 1-16, in the reply filed on 03 April 2026 is acknowledged.
Claim Rejections - 35 USC § 112
3. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
4. Claims 1-16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A. Claim 1 recites the phrase “…a binding site that captures the target substance.” The underlined phrases constitute functional language in a product claim, and it is unclear whether the claim limitations encompass the chemical sensor generally or specifically the chemical sensor that has actively captured the target substance. Additionally, claim 1 recites the phrase “wherein the nucleic acid probe is a double-stranded nucleic acid,” however the claim limitations, applicant’s specification, and their drawings suggest that the nucleic acid probe only comprises a double-stranded region (e.g., the region of base complementarity between sequence 2 of the first nucleic acid and sequence 4 of the second nucleic acid). It is unclear whether this limitation is intended to indicate a fully double-stranded probe (which falls within the existing limitations of claim 1) or a partially double-stranded probe (as suggested by the specification and the drawings). For these reasons, the claim lacks clarity and is therefore indefinite.
B. Claims 2, 6 and 7 recite the phrases “…when the third base sequence captures the target substance…,” “…forms a higher-order structure by capturing the target substance…,” and “…formed by capturing the target substance…,” respectively. This functional language is unclear for the same reasons described above and therefore this claim is indefinite.
C. Claim 14 recites the phrase “the polycation binds to a base sequence of a part of the second nucleic acid to form a double strand with the second nucleic acid.” This phrase lacks clarity and is not further explained in the claim language nor in the applicant’s specification. Is the “double strand” the ‘PNA strand’ linked to the ‘amino acid peptide/strand’? Is the polycation bound to the second strand which forms a double strand with the first nucleic acid strand? It is unclear how this phrase is intended to limit the claim, and therefore it is indefinite.
D. Any claims not specifically mentioned in this section are rejected for being dependent on a previously rejected claim.
Claim Rejections - 35 USC § 102
5. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
6. Claims 1-9 and 16 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Takoh (United States Patent Application US 20150050645, published 19 February 2015). The rejections of claims 1, 6 and 7 are evidenced by Zhang et al (New insights into a classic aptamer: binding sites, cooperativity and more sensitive adenosine detection, Nucleic Acids Research, 45, 13, 7593-7601, published 27 July 2017).
Regarding claim 1, Takoh teaches a sensor chip used for detecting a target material ([0027]) comprising a nucleic acid complex ([0027] – [0029]). Takoh teaches that the nucleic acid complex is bound to the electrode and the electrode is dipped into a measurement solution (i.e., a liquid film covers the sensor; [0198]), and that the nucleic acid probes comprises an aptamer (i.e., the first nucleic acid) bound to a nucleic acid fragment (i.e., the second nucleic acid; FIG 6 and [0194]). Takoh teaches a first nucleic acid comprising a second base sequence (Sequence 2: 5' – CACTGACCTGGGGGAGTATTGCGGAGGAAGGT – 3'), a first nucleic acid sequence complementary to the first base sequence (Sequence 2: 5' – CACTGACCTGGGGGAGTATTGCGGAGGAAGGT – 3') and a third base sequence having one end bound to the first base sequence and the other end bound to the second base sequence (Sequence 2: 5' – CACTGACCTGGGGGAGTATTGCGGAGGAAGGT – 3'; note, the third base sequence is considered bound to the first and second sequences through the italicized spacer bases). Takoh teaches a second nucleic acid containing a fourth base sequence complementary to a part of the second base sequence (Sequence 3: 3' – TCTCTTGGACCC – 5'). Since there are no explicit structural limitations placed on the first, second, third and fourth sequences within the claims, these selections are considered to read on the instant claim. The third base sequence taught by Takoh constitutes a binding site that captures the target substance (ATP), as evidenced by Zhang (FIG 1A).
Regarding claim 2, Takoh teaches a chemical sensor wherein the third base sequence captures the target substance (ATP), the first strand and the second strand are dissociated, and the first and second sequences base pair to form a new stem structure ([0201] and FIG 6).
Regarding claim 3, as defined above in the rejection of claim 1, the base length of the fourth base sequence is shorter than the base length of the second base sequence (FIG. 15, sequences 2 and 3).
Regarding claims 4 and 5, Takoh teaches a spacer of one base between the binding site of the third base sequence and the second base sequence, and a spacer of one base between the binding site of the third base sequence and the first base sequence (FIG 15, Sequence 2: 5' – CACTGACCTGGGGGAGTATTGCGGAGGAAGGT – 3'; first and second base sequences in bold, third base sequence underlined, and spacer bases italicized).
Regarding claims 6 and 7, Takoh teaches that binding of the first nucleic acid forms a higher order structure by capturing the target substance with the third base sequence (FIG 6). This structure forms a bulge (i.e., a stem with an unpaired base on one arm) as evidenced by Zhang (FIG 1A).
Regarding claim 8, Takoh teaches that the sensor element is SPR ([0098]).
Regarding claim 9, Takoh teaches that the first and second nucleic acids are immobilized on the sensor element (FIG 6 and [0194]). It is noted that the claim language only requires one of the first and second nucleic acids to be immobilized on the surface, but does not exclude both nucleic acids being attached to the surface.
Regarding claim 16, Takoh teaches a method for detecting a target substance using the chemical sensor comprising preparing the chemical sensor according to claim 1, brining the sample into contact with the liquid film of the chemical sensor, and detecting a DNA strand exchange reaction that is caused when the target substance is captured by the nucleic acid probe ([0194] – [0199]).
Claim Rejections - 35 USC § 103
7. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
8. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
9. Claims 10, 11 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over Takoh (United States Patent Application US 20150050645, published 19 February 2015) in view of Wilson et al (Independent control of the thermodynamic and kinetic properties of aptamer switches, Nature Communications, 10, 5079, published 07 November 2019).
Regarding claims 10 and 11, Takoh teaches the chemical sensor according to claim 1 as discussed fully above and incorporated here. Takoh does not teach that the fourth base sequence includes a base sequence mismatched with the second base sequence, nor do they teach that the double stranded region has a bulge structure.
Regarding claim 15, Takoh teaches that the sensor can be utilized for fluorescence sensing with FRET ([0098]), but Takoh does not specifically teach that the donor fluorescent dye and the acceptor fluorescent dye are bound to the same nucleic acid strand.
However, Wilson teaches a class of aptamer switches based on the same ATP aptamer used by Takoh, and teaches that the addition of mismatched bases within stem regions of the aptamer-displacement strand construct (pg. 6 column 2 ¶ 1). The addition of mismatches to this region would inherently introduce a bulge structure where the mismatch is located within the stem region.
Wilson additionally teaches that the conformational change of the aptamer is sensed by increasing the distance between fluorophore and quencher molecules attached to the same nucleic acid strand (FIG 1).
It would have been obvious to one having ordinary skill in the art to have modified the fourth base sequence – second base sequence interface in the aptamer sensor taught by Takoh to have incorporated mismatched bases as taught by Wilson, and further obvious to have used FRET detection as taught by Takoh ([0098]) with the FRET pairs on the same nucleic acid strand as taught by Wilson (FIG 1), to arrive at the instantly claimed invention with a reasonable expectation of success. The ordinary artisan would have been motivated to make these modifications because Wilson specifically teaches that including mismatches would allow them to increase the theoretical resolution of their sensor tuning capabilities by >10-fold (pg. 6 column 2 ¶ 1), and placing the FRET pairs on the same strand would make synthesizing the complex easier and cheaper because one fluorophore adorned strand could be synthesized and tested against many different unlabeled second nucleic acid strands. In addition, one having ordinary skill in the art would have recognized that the known techniques in the cited references could have been combined with predictable results because the known techniques in the cited references predictably result in the design and tuning of aptamer switches, especially those based on the ATP aptamer.
10. Claims 12-14 are rejected under 35 U.S.C. 103 as being unpatentable over Takoh (United States Patent Application US 20150050645, published 19 February 2015) in view of Ryan et al (Impact of Chirality and Position of Lysine Conjugation in Triplex-Forming Peptide Nucleic acids, ACS Omega, 5, 28722-28729, published 28 October 2020).
Regarding claim 12, Takoh teaches that the second nucleic acid is a PNA ([0136]), but Takoh does not teach that the second nucleic acid sequence has an amino acid sequence of a polycation bound to it.
However, Ryan teaches a PNA conjugated to a polylysine peptide (i.e., an amino acid sequence of a polypeptide; abstract and FIG 2).
It would have been obvious to one having ordinary skill in the art to use PNA for the second nucleic acid strand as taught by Takoh and to have added an additional polylysine tail to the PNA as taught by Ryan to arrive at the instantly claimed invention with a reasonable expectation of success. The ordinary artisan would have been motivated to make this modification because Ryan specifically teaches that the addition of polylysine improves the biophysical properties of PNA and that the positive charge of the lysine residue increases its affinity (abstract). In addition, one having ordinary skill in the art would have recognized that the known techniques in the cited references could have been combined with predictable results because the known techniques in the cited references predictably result in the interaction of PNA and DNA molecules.
Regarding claim 13, when using PNA as the second ‘nucleic acid’ strand as taught by Takoh, which is attached to the substrate ([0194]), the liquid film covering the sensor (i.e., the substrate) would inherently contain the PNA containing an amino acid sequence of a polycation.
Regarding claim 14, Takoh in view of Ryan teaches that the amino acid sequence of the polycation is attached to the PNA (Ryan FIG 2) and that the PNA is nucleic acid sequence 2 (Takoh [0136])
Conclusion
11. No claims are allowed.
12. Any inquiry concerning this communication or earlier communications from the examiner should be directed to BRIAN ELLIS YOUNG whose telephone number is (703)756-5397. The examiner can normally be reached M-T 0800 - 1630.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached at (571) 272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN ELLIS YOUNG/Examiner, Art Unit 1684
/JULIET C SWITZER/Primary Examiner, Art Unit 1682