Prosecution Insights
Last updated: April 19, 2026
Application No. 18/184,721

VIRULENCE FACTOR FSPL GENE FROM SUGARCANE POKKAH BOENG DISEASE AND USE THEREOF

Non-Final OA §112§DP
Filed
Mar 16, 2023
Examiner
YU, DELPHINUS DOU YI
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Guangxi University
OA Round
1 (Non-Final)
Grant Probability
Favorable
1-2
OA Rounds
3y 2m
To Grant

Examiner Intelligence

Grants only 0% of cases
0%
Career Allow Rate
0 granted / 0 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
13 currently pending
Career history
13
Total Applications
across all art units

Statute-Specific Performance

§101
8.7%
-31.3% vs TC avg
§103
32.6%
-7.4% vs TC avg
§102
6.5%
-33.5% vs TC avg
§112
50.0%
+10.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 0 resolved cases

Office Action

§112 §DP
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received 12/02/2025. Claims 1-6 are currently pending. Claim 6 was withdrawn from prosecution as being drawn to non-elected subject matter. In addition, claims 2, 5, 6 were amended and applicant argues that the amended claims 2 & 5 should be examined with claims 1, 3, 4 as a single group of invention. The restriction requirement mailed on 10/07/2025 is still deemed proper. Applicant’s elected Group I without traverse in the reply filed on 12/02/2025. Election/Restrictions Applicant's election without traverse of election of Group I (claims 1, 3, and 4, drawn to a virulence factor FsPL gene; classified in C12N 1/20) in the reply filed on 12/02/2025 is acknowledged. Applicant amended claims 2 and 5 and argues that “In view of the amendments submitted with this paper, claims 2 and 5 now each require the nucleic acid of claim 1 (with claim 5 in product-by-process form) and therefore fall within Group I, accordingly applicant believes claims 2 and 5 should be examined together with claims 1, 3, and 4.” Applicant conditionally elects the PVX-FsPL primer pair consisting of sequences with SEQ ID NO: 7 (forward) and SEQ ID NO: 8 (reverse) as the single disclosed species. Claim 1 is directed to an allowable product. Pursuant to the procedures set forth in MPEP § 821.04(B), claim 6, directed to the process of making or using an allowable product, previously withdrawn from consideration as a result of a restriction requirement, is hereby rejoined and fully examined for patentability under 37 CFR 1.104. Because all claims previously withdrawn from consideration under 37 CFR 1.142 have been rejoined, the restriction requirement as set forth in the Office action mailed on 10/07/2026 is hereby withdrawn. In view of the withdrawal of the restriction requirement as to the rejoined inventions, applicant(s) are advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application. Once the restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01. Accordingly, claims 1-6 are examined herein. Information Disclosure Statement The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Acknowledgment is made of applicant's claim for foreign priority based on an application filed in CN202211125577.6 on 09/16/2022. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 3-5 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 3, it is noted that the claim recites “a silencing vector”. This language is considered to be indefinite because there is no definition of this term in the specification despite appearing 6 times by name only in ¶[0012], [0013], [0023], [0050], [0051], [0061]. While the “silencing” nomenclature implies a function associated with “silencing”, there is no indication in the specification as to what is the intended “silencing” target for the claimed vector. The metes and bounds of this term require clarity. Regarding claim 4, it is noted that the claim recites “a silent recombinant bacterium”. This term is not defined in the specification, nor does it yield any non-patent literature published the past 45 years in pubmed.gov. Searching it in STNext as a search term yields no literature (see submitted SNRT Query performed on Jan 21st, 2026). In PE2E (Patents End-to-End), the only search result is the current application. All evidence indicates that this is not an established concept. It is considered to be indefinite because it is not clear what the requirements of the bacterium are. It is not clear how to evaluate whether a given bacterium is a “silent” bacterium or not. Regarding claim 5, the limitations on claim 1 “The virulence factor FsPL nucleic acid of claim 1, obtained by a primer pair…., wherein the primer pair is……” is indefinite because amplicons generated from the process of PCR reactions using the nucleic acid of claim 1 as template and a primer pair, selected from the group consisting of a PVX-FsPL primer pair, a PVX-FsPLΔSP primer pair, a pCAMBIA2300-FsPL primer pair, and a pCAMBIA2300-FsPLΔSP primer pair, do not always encompass a nucleic acid comprising the full sequence set forth in SEQ ID NO: 1 as claimed. Based on primer hybridization mapping on the specified template in the specification, see below, the current wording of claim 5 creates indefiniteness as some of the primer pairs amplify only a fragment of the FsPL gene, not the full polynucleotide with a sequence set forth in SEQ ID NO: 1. ¶[0071] on page 9 states: “Agrobacterium-mediated transient expression of the gene in Nicotiana benthamiana Transient expression of FsPL was performed in tobacco leaves to verify the function of the gene. Different fragments (FsPL-FL, FsPL-ΔSP) of FsPL1 were amplified using the cDNA of the F sacchari wild-type strain as a template and were inserted into the PVX vector at the ClaI and NotI sites, and the vector was transformed into Agrobacterium GV3101.” This confirms that the FsPL gene cDNA full size sequence set forth in SEQ ID NO: 1 is used as the template for PCR amplification. However, claim 5 does not articulate this limitation, creating indefiniteness as to what is being claimed. The following map indicates where the primer pairs hybridize with the polynucleotide with a sequence set forth in SEQ ID NO: 1, and how variable the resultant amplicon sequences and lengths would be. It is clear that only the PVX-FsPL primer pair (SEQ ID NO: 7 and SEQ ID NO: 8) and the pCAMBIA2300-FsPL primer pair (SEQ ID NO: 14 and SEQ ID NO: 15) would generate amplicons that comprise the SEQ ID NO: 1 in claim 1 that claim 5 depends on. The FsPLΔSP primer pairs only generate amplicons that comprise a fragment of SEQ ID NO: 1, not the full length FsPL and fail to yield the claimed nucleic acid comprising SEQ ID NO: 1, as the SP sequence on the 5’ end of SEQ ID NO: 1 (underlined sequence) would be missing due to the hybridization site of the forward primers for both PVX-FsPLΔSP primer pair and pCAMBIA-FsPLΔSP primer pair. Accordingly, the current wording in claim 5 does not clearly set the metes and bounds of what is being claimed as the invention. PNG media_image1.png 1138 1830 media_image1.png Greyscale The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 2 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. In claim 2, since the specified nucleotide sequence SEQ ID NO: 1 in the independent claim 1 translates an amino acid sequence that matches 100% to the claimed polypeptide sequence SEQ ID NO: 2 in claim 2 (see the NCBI ORF Finder results below showing the SEQ ID NO: 1 in the top row and SEQ ID NO: 2 at the bottom row). Claim 2 fails to further limit the subject matter of claim 1 upon which it depends. 1 ATGCACGCCTCCAGCCTTCTCACCCTCCTCACCACCCTCCCCGCC M H A S S L L T L L T T L P A 46 GCAATGGCCTGTCTCGGCTACACCGGCGGCGTCCCCAAAGCTACA A M A C L G Y T G G V P K A T 91 GGCACCAAGTCCCTCAGCGCCCCCCAATACCTCAAGAAGGGCCAA G T K S L S A P Q Y L K K G Q 136 GTCTTCGACGCAAAGTGGGTTCGCTACGACCGCGGCGTCAAGTGC V F D A K W V R Y D R G V K C 181 TCTGGCCAGAGCGAAGGCGGCGAGAAGGACGCTGTGTTCGTTCTC S G Q S E G G E K D A V F V L 226 GAGGACGGCGCTACTCTTCGCAATGTTGTCATCGGTGCGAACCAG E D G A T L R N V V I G A N Q 271 AAGGAGGGCGTGCACTGTCTTGGTGCTTGTAACCTTGAGTTTGTC K E G V H C L G A C N L E F V 316 TGGTTTGAGGATGTTTGTGAGGATGCTATCTCTATCAAGGGTAGT W F E D V C E D A I S I K G S 361 GGAACTGCCAACATTATTGGTGGCGGTGCGTACAAGGCTGCCGAT G T A N I I G G G A Y K A A D 406 AAGGTTATTCAGCACAATGGATGCGGCCACGTCAACATTGTCAAC K V I Q H N G C G H V N I V N 451 TTCTATGCCAACGACTATGGCAAGGTCTACCGCTCCTGCGGTAAC F Y A N D Y G K V Y R S C G N 496 TGCAAGGGTAACTCCAACTGCAAGCGATCAGTCCACATGGAGGGC C K G N S N C K R S V H M E G 541 GTCACTGCTGTCAACGGCGGTGAGCTCATGGGCATCAACACCAAC V T A V N G G E L M G I N T N 586 CTCGGTGACAAGGCTACTTACTCCAACAACTGCTACCCCAAGACT L G D K A T Y S N N C Y P K T 631 CAGTGCCAGGGCTACAACGGCTGCGACAAGTCCAACGGCGAGTGT Q C Q G Y N G C D K S N G E C 676 GAGCCTACCAAGGCTGGCAAGTGCTAG E P T K A G K C * Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112 Enablement The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 6 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below: Nature of the Invention The claimed invention directs to a method of preventing Pokkah Boeng Disease infection caused by the Fusarium spp. Complex of fungal species using a cDNA of a pectate lyase gene isolated from Fusarium Sacchari. Thus, the methods require a reliable implementation of: i) delivering the gene product to the sugarcane plant; ii) preventing, inhibiting or further fungal infection in the plant cells or tissue of a sugarcane plant; iii) evaluating the efficacy of required amount of the gene product; in iv) any sugarcane or any plant susceptible to Fusarium spp. Fungal infection. The Breadth of the Claims The scope of the dependent claim 6 limits the method of treating sugarcane pokkah boeng disease in a plant, the method comprising delivering to plant tissue a recombinant vector comprising the virulence factor FsPL nucleic acid of claim 1, and expressing a polypeptide encoded by the nucleic acid in the plant tissue to elicit pattern-triggered immunity and/or programmed cell death, the result of said method is expected to reduce infection by the Fusarium spp. fungal species that cause sugarcane pokkah boeng disease. While the specification provides descriptive disclosures of steps to prepare the FsPL cDNA in a viral vector and a recombinant bacterial vector to transforming several related plants including tobacco, corn, and cut leaves of a sugarcane cultivar, no working example was offered to support the breadth of the claims. Accordingly, claim 6 is unduly broad. Guidance of the Specification The specification is silent as to how to transform the FsPL gene in live sugarcane plant. There is a notable absence of guidance on how to deliver the FsPL gene products to a live sugarcane plant. ¶[0078] on page 10-11 describes the method of inoculating a laboratory sugarcane cultivar in vitro on leaves cut into pieces, not in a live whole plant: “In-vitro leaf inoculation to sugarcane…. Bacterial cakes of the wild-type strain and knock-out mutant strain … inoculated to the cuts on Zhongzhe1 leaves. After 3 d[ays] of incubation in the dark in a moist environment at 28 oC, the formation of lesion spots on the leaves was observed and photographed.” It seems to require highly specific laboratory conditions to successfully inoculate sugarcanes under unnatural conditions. There is a clear gap between inoculation on cut leaf tissue in petri dishes and inoculation on live plants. Even after such elaborate inoculation procedure, all evidence of PTI and ETI were presented using tobacco leaves or maize leaves, not from sugarcane. The photographs of infected sugarcane leaves were never shown in the included specification. Semi-quantification-based data is presented in histograms. No live sugarcane plant was used to demonstrate any effect involving “infection” or “reducing infection”. The State of the Prior Art While no prior art exists that teaches how to use FsPL gene products to induce Fusarium spp. infection or develop resistance to the pathogen, there are several relevant prior arts published before the effective filing date of the current application (prior to the foreign priority date of 09/16/2022, based on the prior foreign application CN202211125577.6) that teach multiple distinct strategies to use a pectate lyase isolated from a pathogen to enhance resistance against related pathogens: I. Using pectate lyase protein to trigger systemic acquired resistance (SAR) in plants: Yang et al. (A Verticillium dahliae Pectate Lyase Induces Plant Immune Responses and Contributes to Virulence. Front Plant Sci. 2018 Sep 13;9:1271.; Hereinafter, Yang) teaches the biocontrol potential for an unrelated pectate lyase gene, VdPEL1, from the fungal species Verticillium dahlia, a member of the pathogen Verticillium complex that causes verticillium wilt in many plant species, causing leaves to curl, discolor, or death of the entire plant. Yang (2018) teaches that increased non-specific resistance in treated plant is consistent with a widely observed phenomenon called systemic acquired resistance (SAR) in plants. Yang teaches that “Plant immune responses initiate from local tissues located at the site of the infection and subsequently extend to other non-infected tissues by long-distance intercellular communications, generating a systemic acquired resistance (SAR) that is effective against a broad spectrum of pathogens in the whole plant” (Page 1, last 4 lines). II. Use pectate lyase gene from the pathogen to create transgenic strain of plants to enhance resistance to the pathogen derived pectate lyases. Wegener et al. (Pectate lyase in transgenic potatoes confers pre-activation of defence against Erwinia carotovora. Physiological and Molecular Plant Pathology,Volume 49, Issue 6, 1996, Pages 359-376.; Hereinafter, Wegener) teaches a method of genetically engineering a transgenic strain of pathogen-resistant potato strain using a fusion protein of a pathogen-derived pectate lyase gene (Page 359, Abstract). However, this method is distinct from the method of Yang in that a constitutive pathogen pectate lyase gene is stably integrated into the potato genome without an initial inoculation of the pectate lyase products, vectors or proteins, to the potatoes. III. Leveraging the proven homology between the endogenous plant pectate lyase homologs and pathogen-derived pectate lyase, engineering a transgenic plant strain to carry a mutant pectate lyase gene or homolog enhances resistance to pathogens in these transgenic plant strains. Vogel et al. (US6864404B1, issued on 03/08/2005; Hereinafter, Vogel) teaches “A mutant gene coding for pectate lyase and homologs thereof …, which when incorporated in transgenic plants effect an increased level disease resistance in such plants.” (Page 1, Abstract). However, this method targets pectate lyase homologs endogenously expressed in the crop/plant and there is an identifiable homology between the host (plant) pectate lyase and the pathogen pectate lyase. It describes a distinct method from the disclosure of current specification because of specific additional steps as described therein. Given the remarkably different approaches across these prior arts, each comprising distinct additional engineering steps and specific administration strategies tailored for specific plant species and pathogen species, there is no consensus regarding how an isolated pectate lyase-based virulence factor can be used to achieve biocontrol or enhanced resistance to various fungal pathogens in sugarcane. The Level of Predictability in the Art The unpredictability of the claimed method is high because even the skilled inventors themselves in the current application failed the overexpression experiments evaluating the impact of FsPL in model sugarcane cultivar. Most of the working models were obtained using a related plant, maize (corn), and a standard model plant, tobacco. Only FIGs. 13 & 14 were supposedly from sugarcane in in vitro experiments using cut leaves and incubated in darkness for 3 days. In the research article that the current application is based on, Wang et al. (Pectate Lyase from Fusarium sacchari Induces Plant Immune Responses and Contributes to Virulence. Microbiol Spectr. 2023 Jun 15;11(3):e0016523. doi: 10.1128/spectrum.00165-23. Epub 2023 May 4; Hereinafter, Wang) states that “Although we similarly attempted to verify the necrosis-inducing function of FsPL in sugarcane, the natural host of F. sacchari, we were unable to successfully express the necessary genes in the sugarcane leaves using particle bombardment. As an alternative, we used maize, a close relative of sugarcane. Overexpression of FsPL in maize leaves induced cell necrosis; FsPL without the signal peptide also induced cell necrosis in the maize leaves, but to a lesser degree. We therefore hypothesized that FsPL would likely also induce cell necrosis in sugarcane. In future studies, we intend to continue to attempt to overexpress FsPL in sugarcane to experimentally validate this hypothesis.” Despite the fact that Wang (2023) is published after the priority date for the instant application, the lapse of time clearly did not facilitate the inventors to overcome the technical difficulty, highlighting the lack of possession at the time of filing. Thus, the state of art indicates highly unpredictable outcome for the claimed invention without any tangible supporting data or guidance to one with ordinary skill in the art. The Quantity of Experimentation necessarily Needed In light of the high level of unpredictability in the art, and the limited amount of direction provided by the inventor, and the noticeable absence of working examples detailed above, the quantity of experimentation necessarily needed to make or use the invention, especially with respect to reducing Fusarium spp. infection in live sugarcane plant, is considerably high. For example, it would be necessary for one skilled in the art to identify optimal transfection or transformation-based delivery strategies useful for live sugarcane cultivars to develop meaningful immune responses against the FsPL gene product at appropriate timepoints to induce immune responses sufficient to enhance resistance to related pathogens without killing the plant. There would be an unreasonable amount of experimentation required by a person of ordinary skill in the art to emulate the state of art published for other plants and other fungal species or pectate lyases of different origins. Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that an unreasonable amount of undue experimentation would be required to make and use the invention as claimed. Subject Matter Eligibility Analysis Regarding claim 1, it is noted that the claim is a product that recites “A virulence factor FsPL gene from a sugarcane pokkah boeng disease, wherein the virulence factor FsPL gene from the sugarcane pokkah boeng disease has a sequence set forth in SEQ ID NO: 1.”, the gene itself is a naturally occurring gene. However, the claimed product possesses markedly different characteristics as compared to its closest naturally occurring counterpart because the claimed FsPL gene sequence is from cDNA. The preponderance of the evidence outlined below confirms this understanding. The current specification is silent on the origin of the FsPL gene as claimed, nor does it describe how it was discovered. ¶[0071] on page 9 of the specification mentions “Different fragments (FsPL-FL, FsPL-Asp) of FsPL1 were amplified using the cDNA of the F sacchari wild-type strain as a template and were inserted into the PVX vector at the ClaI and Nod sites, and the vector was transformed into Agrobacterium GV3101.”. While this disclosure does not explicitly state that said cDNA comprises the claimed SEQ ID NO: 1, it raises the possibility and requires additional evidence for confirmation. Based on a research article involving the inventors, published after the effective filing date of the current application, Wang (2023) teaches that the claimed “virulence factor FsPL gene from a sugarcane pokkah boeng disease, wherein the virulence factor FsPL gene from the sugarcane pokkah boeng disease has a sequence set forth in SEQ ID NO: 1” is originally discovered as the “Fs04471” candidate secreted effector protein (CSEP) from another research article involving the inventors (Page 2, 4th¶, line 5), published before the effective filing date of the current publication, Huang et al. (Predication of the Effector Proteins Secreted by Fusarium sacchari Using Genomic Analysis and Heterogenous Expression. J Fungi (Basel). 2022 Jan 6;8(1):59. doi: 10.3390/jof8010059.; Hereinafter, Huang). Huang teaches that the “Fs04471” CSEP is identified from 230 genes from the cloned complementary DNA (cDNA) pool generated using the F. sacchari total RNA (Huang, page 3 of 19, under “2.4. Plasmid Construction and Preparation; Page 9 of 19, under “3.3 Certain CSEPs induced PCD for Suppressed BAX-Triggered PCD in N. benthamiana). The cited non-patent literature confirms that the claim SEQ ID NO: 1 is indeed cDNA sequence, rather than genomic DNA sequence. In addition, Nucleotide Blast results using the NCBI tool indicates that the claimed FsPL gene from Fusarium Sacchari is highly similar in sequence to a pactate lyase gene of the genome of another Fusarium spp. family member, Fusarium Oxysporum (GenBank: PP319202.1; Nucleotide Blast result screen capture is shown below), which shows 2 introns within the coding sequence (CDS). See MPEP 2106.04(c)(II)(C)(1) In Myriad, the Supreme Court identified a claimed full-length complementary DNA (cDNA) of the BRCA1 gene as a nature-based product having markedly different characteristics. This claimed cDNA had the same functional characteristics (i.e., it encoded the same protein) as the naturally occurring gene, but had a changed structural characteristic, i.e., a different nucleotide sequence containing only exons, as compared to the naturally occurring sequence containing both exons and introns. The Supreme Court concluded that the "cDNA retains the naturally occurring exons of DNA, but it is distinct from the DNA from which it was derived. As a result, [this] cDNA is not a ‘product of nature’" and is eligible. Myriad, 569 U.S. at 595, 106 USPQ2d at 1981. PNG media_image2.png 666 1075 media_image2.png Greyscale Allowable Subject Matter Claim 1 is allowable. The following is a statement of reasons for the indication of allowable subject matter: The following art is cited below: Daniell, et. al., US10676751B2 June 9th, 2020. A prior art search for SEQ ID NO: 1 did not reveal any applicable prior art. Daniell teaches a method of “Production and use of plant degrading materials”, but the nucleic acid does not have 100% alignment with SEQ ID NO: 1. A NCBI Blast search for SEQ ID NO: 1 failed to reveal any 100% alignments. Therefore, Claim 1 is allowable. Any comments considered necessary by applicant must be submitted no later than the payment of the issue fee and, to avoid processing delays, should preferably accompany the issue fee. Such submissions should be clearly labeled “Comments on Statement of Reasons for Allowance.” Conclusion Claim 1 is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DELPHINUS DOU YI YU/Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Mar 16, 2023
Application Filed
Feb 06, 2026
Non-Final Rejection — §112, §DP (current)

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
Grant Probability
3y 2m
Median Time to Grant
Low
PTA Risk
Based on 0 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month