Prosecution Insights
Last updated: April 19, 2026
Application No. 18/184,965

COMPOSITIONS AND METHODS FOR CONTROLLING BLOOD SUGAR LEVELS USING NANOCAPSULE-BASED DRUG DELIVERY SYSTEM

Final Rejection §103§112
Filed
Mar 16, 2023
Examiner
POPA, ILEANA
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Vl Biotech Inc.
OA Round
2 (Final)
21%
Grant Probability
At Risk
3-4
OA Rounds
4y 8m
To Grant
35%
With Interview

Examiner Intelligence

Grants only 21% of cases
21%
Career Allow Rate
172 granted / 820 resolved
-39.0% vs TC avg
Moderate +14% lift
Without
With
+13.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 8m
Avg Prosecution
61 currently pending
Career history
881
Total Applications
across all art units

Statute-Specific Performance

§101
1.7%
-38.3% vs TC avg
§103
45.2%
+5.2% vs TC avg
§102
9.3%
-30.7% vs TC avg
§112
19.8%
-20.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 820 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 1. Claims 1-14 have been amended. Claims 1-14 are pending and under examination. 2. The objections to claims 1-14 are withdrawn in response to the amendments filed on 11/28/2025. Claim Objections 3. Claim 6 is objected to because of the recitation “capsid proteins of self-assembling” in line 10. Correction to “capsid proteins capable of self-assembling” is required. 4. With respect to claim 11, since SEQ ID NO: 6 is the nucleotide sequence of the first vector, the claims should recite: The method of claim 6, wherein the nucleotide sequence of the first vector is set forth by SEQ ID NO: 6, and the second vector comprises the nucleotide sequence set forth by SEQ ID NO: 3. New Rejections Necessitated by Applicant’s Amendments Although the applicant argues that claims 1 and 5 have been amended according to the examiner’s suggestions, the examiner did not suggest the current amendments to claims 1 and 5, which are the subject to the new rejections set forth below. Claim Rejections - 35 USC § 112(a) 5. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 6. Claims 1-5 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. 37 CFR 1.118 (a) states that "No amendment shall introduce new matter into the disclosure of an application after the filing date of the application". Specifically, the amendment to include the limitation “SEQ ID NO: 1 encoding one or more mRNAs” (claims 1 and 5) and the limitation ”a capsid protein recognition sequence encoding one or more capsid protein tags” (claim 1) introduces new matter. The specification does not provide support for these limitations. There is no teaching in the specification that SEQ ID NO: 1 encodes more than one mRNA. As evidenced by the Sequence Listing and as evidenced by the sequence alignment of record, SEQ ID NO: 1 has a length of 111 nucleotides and only encodes the mRNA encoding the wild-type GLP-1. Furthermore, a capsid protein recognition sequence is not an encoding sequence. The capsid protein recognition sequence (or capsid protein tag) is a nucleic acid sequence capable of binding to the coat proteins to enable packaging of nucleic acid into VLPs. MPEP 2163.06 notes "If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112, first paragraph - written description requirement. In re Rasmussen, 650 F.2d 1212, 211 USPQ 323 (CCPA 1981)." MPEP 2163.02 teaches that "Whenever the issue arises, the fundamental factual inquiry is whether a claim defines an invention that is clearly conveyed to those skilled in the art at the time the application was filed...If a claim is amended to include subject matter, limitations, or terminology not present in the application as filed, involving a departure from, addition to, or deletion from the disclosure of the application as filed, the examiner should conclude that the claimed subject matter is not described in that application. MPEP 2163.06 further notes "When an amendment is filed in reply to an objection or rejection based on 35 U.S.C. 112, first paragraph, a study of the entire application is often necessary to determine whether or not "new matter" is involved. Applicant should therefore specifically point out the support for any amendments made to the disclosure". Claims 2-4 have been included in the rejection for encompassing the embodiments under rejection via their dependency upon the rejected claim 1. Claim Rejections - 35 USC § 112(b) 7. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 8. Claims 1-5 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The term “ SEQ ID NO: 1” in claims 1 and 5 is used by the claim to mean “a nucleic acid encoding more than one mRNA”, while the accepted meaning is “a nucleic acid encoding one mRNA.” As evidenced by the Sequence Listing and by the sequence alignment of record, SEQ ID NO: 1 has a length of 111 nucleotides and only encodes the mRNA encoding the wild-type GLP-1. The term “capsid recognition sequence” in claims 1 and 5 is used by the claim to mean “an encoding sequence”, while the accepted meaning is “a nucleic acid sequence which binds to the coat protein to enable packaging of nucleic acids into VPLs”. The terms are indefinite because the specification does not clearly redefine the terms. Claims 2-4 have been included in the rejection for being depended upon the rejected claim 1 and for failing to further clarify the embodiment under rejection. For prior art purposes and consistent with the specification, the claims are reasonably interpreted as reciting a first vector comprising SEQ ID NO: 1 and a capsid recognition sequence. Maintained Rejections Claim Rejections - 35 USC § 103 9. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 10. Claims 1, 2, 4-8, and 10-14 are rejected under 35 U.S.C. 103 as being unpatentable over Williams et al. (WO 15/038746), in view of all Witherell et al. (Biochemistry, 1989, 28: 71-76), Duan et al. (Diabetes, 2015, 64: 1794-1803), and Shemesh et al. (WO 05/035761). Williams et al. teach a composition for obtaining virus-like particles (VLPs), the composition comprising: (1) a first plasmid encoding a precursor RNA (capable of producing iRNA inhibiting a target gene) and a capsid binding tag (or capsid protein recognition sequence) capable of binding to the bacteriophage Qβ coat protein to enable packaging of the precursor RNA into VLPs; the precursor RNA could have a length of 50 nucleotides to kilo-nucleotides and could be derived from an mRNA; and (2) a second plasmid comprising the nucleic acid set forth by SEQ ID NO: 3, encoding the bacteriophage Qβ coat protein. The composition is used to assemble the VLPs in vivo in a bacterial cell, where the bacteriophage Qβ coat protein self-assembles into VLPs encapsulating the RNA encoded by the first plasmid; the VLPs can be used for the delivery of RNAs in stable form which could be easily taken up by cells, where delivery could be via ingesting the bacterial cells comprising the VLPs (claims 1 and 2) (see Abstract; paragraph bridging p. 1 and 2; paragraph bridging p. 2 and 3; p. 3, line 4 through p. 4, line 3; p. 7, lines 24-29; p. 8, line 21 through p. 9, line 1; p. 11, lines 20-26; p. 12, lines 12-25; p. 13, lines 2-11; p. 13, line 25 through p. 14, line 9; p. 15, lines 11-25). As evidenced by the attached Sequence Alignment, SEQ ID NO: 3 taught by Williams et al. is identical to the claimed SEQ ID NO: 3 (claim 5). Williams et al. teach that the capsid protein tag could be a tag as taught by Witherell et al. (see p. 11, lines 20-26). Witherell et al. teach several synthetic variants of the native tag, among which is GGGAATCACATCAGTAACTGAGTGACTTC (variant 2) having a high Ka (see p. 75). One of skill in the art would have found obvious to use this variant with the reasonable expectation that doing so would result in efficient encapsulation within VLPs. A comparison between the sequence of variant 2 and the claimed SEQ ID NO: 2 revealed that they are identical (claim 2). Williams et al. and Witherell et al. do not teach that the plasmid comprising SEQ ID NO: 1, which encodes the GLP-1-encoding mRNA (claim 1). However, Williams et al. teach that mRNA could be encapsulated into the VLPs and that the VLPs are easily taken up by cells. Duan et al. teach GLP-1 as an anti-diabetic drug, the use of which is limited by its short half-life in vivo. Duan et al. teach increasing insulin secretion and lowering blood glucose level in a diabetic subject by administering to the subject a recombinant Lactobacillus gasserii secreting GLP-1 (1-37), where GLP-1 (1-37) is engineered to comprise a secretion signal (see Abstract; p. 1794-1795; p. 1796, column 2, second paragraph; p. 1797; p. 1801, paragraph bridging columns 1 and 2). One of skill in the art would have found obvious to modify Williams et al. and Witherell et al. by using a plasmid encoding GLP-1 (1-37), obtain VLPs encapsulating GLP-1 (1-37)-mRNA in vivo in Lactobacillus gasserii, and further orally administer the Lactobacillus gasserii comprising the VLPs to a diabetic subject with the reasonable expectation that doing so would increase insulin secretion and lower blood glucose level in the diabetic subject. While Duan et al. do not specifically teach that GLP-1 (1-37) is encoded by SEQ ID NO: 1, Shemesh et al. teach the wild-type GLP-1 (1-37) encoded by SEQ ID NO: 6 (see p. 16, last paragraph). One of skill in the art would have found obvious to use the GLP-1 (1-37) encoded by SEQ ID NO: 6 of Shemesh et al. to achieve the predictable result of obtaining a composition suitable to treat diabetes in subjects. As evidenced by the attached Sequence Alignment, SEQ ID NO: 6 of Shemesh et al. is identical to the claimed SEQ ID NO: 1. By doing so, one of skill in the art would have practiced the method of claims 6-8, 12, and 14. With respect to claims 4 and 10, the recited SEQ ID NO: 5 is the sequence encoding the pig uricase secretion signal (see the attached Sequence Alignment). While the prior art does not teach the pig uricase secretion signal, there is no evidence of record that using this secretion signal provides unexpected results over the secretion signal taught by the prior art. Specifically using the claimed secretion signal is not significant if it does not produce a new feature. With respect to claims 5 and 11, SEQ ID NO: 6 is the nucleic acid sequence of pT7CFEI-NHA (see the specification, paragraph bridging p. 11 and 12), the plasmid vector encoding the uricase secretion signal, the GLP-1 (1-37) set forth by SEQ ID NO: 1, and the capsid tag set forth by SEQ ID NO: 2 (see the attached Sequence Alignments). It is noted that there is no evidence on the record that pT7CFEI-NHA exhibits an unexpected property over the vector taught by the cited prior art. The essential components (i.e., secretion signal, the GLP-1(1-37) set forth by SEQ ID NO: 1, and the capsid tag set forth by SEQ ID NO: 2) and a vector comprising all these essential elements are taught by the prior art. The difference is the vector backbone. The backbone is not significant if it does not provide a novel feature. With respect to claim 13, there is no evidence of record that specifically using Lactobacillus delbrueckii leads to unexpected results as compared to Lactobacillus gasserii. Specifically using Lactobacillus delbrueckii is not significant if it does not produce a new feature. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. 11. Claims 1-14 are rejected under 35 U.S.C. 103 as being unpatentable over Williams et al. taken with all Witherell et al., Duan et al., and Shemesh et al., in further view of Diatta et al. (J. General Virol., 2005, 86: 3126-3136). The teachings of Williams et al., Witherell et al., Duan et al., and Shemesh et al. are applied as above for claims 1, 2, 4-8, and 10-14. Williams et al., Witherell et al., Duan et al., and Shemesh et al. do not teach an IRES in the first vector (claims 3 and 9). However, incorporating an IRES between genes to be packaged into VLPs and capsid attachment sequences was practiced in the prior art, for example by Diata et al. (see p. 3130, column 1, first full paragraph; p. 3131, column 2, last paragraph and Fig. 1). Using an IRES the between SEQ ID NO: 1 and the capsid protein tag would have been obvious to one of skill in the art to art to achieve the predictable result of obtaining VLPs capable of delivering GLP-1. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. Response to Arguments 12. The applicant argues that, since Williams relates to RNA interference and does not teach or suggest encapsulating a peptide-encoding mRNA, one of skill in the art would not have had the motivation or the reasonable expectation of success in replacing iRNA with a peptide-encoding mRNA. This is not found persuasive. While William teaches interference, Williams teaches that the encapsulated RNA could be an mRNA. Based on this teaching alone, one of skill in the art would have reasonably concluded that William’s method could be extrapolated to encapsulate any mRNA of interest into VLPs. Furthermore, replacing William’s mRNA with a GLP-1-encoding mRNA would have been obvious in view of Duan; doing so would have only entailed routine experimentation. MPEP 2141.03 states: "A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 421, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. at 420, 82 USPQ2d 1397. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at 418, 82 USPQ2d at 1396. PNG media_image1.png 18 19 media_image1.png Greyscale The "hypothetical ‘person having ordinary skill in the art’ to which the claimed subject matter pertains would, of necessity have the capability of understanding the scientific and engineering principles applicable to the pertinent art." Ex parte Hiyamizu, 10 USPQ2d 1393, 1394 (Bd. Pat. App. & Inter. 1988). The argument that GLP-1 in Duan and Shemesh is obtained in a way which is different from the claimed invention is not found persuasive because Duan and Shemesh do not have to teach every claim limitation. The argument that Duan and Shemesh teach away from the claimed invention is not found persuasive because neither Duan nor Shemesh discouraged from using William’s method to encapsulate an GLP-1-encoding mRNA into VLPs. The Federal Circuit’s discussion in ICON makes clear that if the reference does not teach that a combination is undesirable, then it cannot be said to teach away. Id. at 1382, 83 USPQ2d at 1752 (see MPEP 2143 I B). PNG media_image1.png 18 19 media_image1.png Greyscale For the reasons set forth above, the following arguments are not found persuasive: (1) from the perspective of one of skill in the art, the mechanism and purpose in Williams are not compatible with those of Duan and Shemesh; and (2) modification would not have been a routine change. The arguments addressing Witherell individually are not found persuasive because Witherell does not have to teach every claim limitation. Conclusion 13. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ILEANA POPA whose telephone number is (571)272-5546. The examiner can normally be reached 8:00 am to 4:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ILEANA POPA/Primary Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

Mar 16, 2023
Application Filed
Sep 02, 2025
Non-Final Rejection — §103, §112
Nov 28, 2025
Response Filed
Feb 05, 2026
Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594295
CFTR MRNA COMPOSITIONS AND RELATED METHODS AND USES
2y 5m to grant Granted Apr 07, 2026
Patent 12527882
IMMOLATIVE CELL-PENETRATING COMPLEXES FOR NUCLEIC ACID DELIVERY
2y 5m to grant Granted Jan 20, 2026
Patent 12522811
ENHANCED BCL11A RNP / CRISPR DELIVERY & EDITING USING A 3XNLS-CAS9
2y 5m to grant Granted Jan 13, 2026
Patent 12514887
ONCOLYTIC TUMOR VIRUSES AND METHODS OF USE
2y 5m to grant Granted Jan 06, 2026
Patent 12514888
Immuno-Oncolytic Therapies
2y 5m to grant Granted Jan 06, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
21%
Grant Probability
35%
With Interview (+13.9%)
4y 8m
Median Time to Grant
Moderate
PTA Risk
Based on 820 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month