DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims Status
Claim 7 is amended, claims 16-20 are cancelled and claims 21-22 are added.
Priority
Applicant’s claim for the benefit of a Provisional Application No 63269975 filed 03/26/2022 is acknowledged.
Election/Restrictions
Applicant elects Group II without traverse. Claims 7-15 and new claims 21 and 22 encompass the subject matter of Group II. Upon further consideration, the restriction between Groups I and II has been withdrawn. Once the restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01.
Applicant's election with traverse of miR-503 in the reply filed on 02/18/2026 is acknowledged. The traversal is on the ground(s) that at least miR-424 and miR-503 are not distinct species because miR-424 and miR-503 are linked in their biological and physiological processes, and the search and examination of miR-424 and miR-503 can be made without serious burden. This is not found persuasive because while miR-424 and miR-503 are members of the same miRNA cluster (H19X) they are structurally different with unique primary sequences and have different biological properties (see MPEP 806.05), a search for an inhibitor specifically complementary to the sequence of miR-503 would not necessarily identify compounds capable of inhibiting miR-424. These microRNAs have divergent biological targets and functions, as such, Connolly et al. (Journal of Cachexia, Sarcopenia and Muscle 2018) teaches that miR-424-5p regulates rRNA synthesis by inhibiting Pol I pre-initiation complex formation. Increased miR-424-5p expression in patients with conditions associated with muscle wasting is likely to contribute to the inhibition of protein synthesis and loss of muscle mass. Miao et al. (BioMed Research International, 2017) teaches that miR-503 was increased in diabetic muscles and in myocardial microvascular endothelial cells. Miao teaches that miR-503 targets Nfr2. Therefore, each species represents a separate composition of matter. The requirement is still deemed proper and is therefore made FINAL.
Claims 2, 4-5, 8, 10-14 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 02/18/2026.
Claims 1-15 and 21-22 are pending.
Claims 1, 3, 6-7, 9, 15, and 21-22 are under consideration.
Improper Markush
Claims 1, 3, 6-7, 9, 15, and 21-22 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of the listed miRNAs is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: these microRNAs have different nucleotide sequences and have different functions.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3, 6-7, 9, 15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1 and 7 requires a provision of a genus of “inhibitors”. The claim encompass any inhibitor such as, low-molecular-weight compound, an antagomir, an antisense molecule, a small hairpin RNA (shRNA) molecule, a small interfering RNA (siRNA) molecule, a seed target LNA (locked nucleic acid) oligonucleotide, a decoy oligonucleotide, an aptamer, a ribozyme, or an antibody. Thus, the claim encompasses the provision of a genus of inhibitors that must function to inhibit the interaction between the microRNAs and their natural target, but it does not define its structure.
To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of a complete or partial structure, physical and/or
chemical properties, functional characteristics, structure/function correlation, and any combination thereof.
The specification envisions methods of preventing or treating a muscle disorder in a subject in need thereof by administering an inhibitor of one or more of miR-424, miR-503, miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b (e.g., paragraph 0005). The specification envisions the inhibitor affects activity of one or more of miR-424, miR-503, miR503HG, miR-542, miR450al, miR-450a2, and miR-450b. The inhibitor can act by reducing interaction between one or more of miR-424, miR-503, miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b and their natural target mRNA. The inhibitor can be a nucleic acid selected from a group consisting of a DNA, an RNA, an antagomir, a siRNA, a shRNA
and an oligonucleotide. Specific antisense-based inhibitors of one or more of miR-424, miR-503, miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b preserve muscle in muscular disorders, such as muscle wasting, cachexia, sarcopenia, and cardiomyopathy (e.g., paragraph 0006). The specification envisions that the agent can include, without any limitations, a low-molecular-weight compound, an antagomir, an antisense molecule, a small hairpin RNA (shRNA) molecule, a small interfering RNA (siRNA) molecule, a seed target LNA (locked nucleic acid) oligonucleotide, a decoy oligonucleotide, an aptamer, a ribozyme, or an antibody that recognizes a DNA:RNA hybrid. The miRNA inhibitor can be an antisense oligonucleotide which can inhibit the activity of miRNA by complementarily binding to all or a part of the precursor and/or mature sequence of the miRNA (e.g., paragraph 0025). The specification envisions methods of preventing or treating a muscle wasting disorder in a subject in need thereof by administering an inhibitor of one or more of miR-424, miR-503,
miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b. The muscle disorders include muscle wasting, cachexia, sarcopenia and heart failure. The term "treatment" as used in the present disclosure means any action to change favorably or improve the symptoms of related diseases by administering the therapeutic agent (e.g., paragraph 0041). The specification envisions that the inhibitor can be a nucleic acid selected from a group consisting of a DNA, an RNA, an antagomir, a siRNA, a shRNA and an oligonucleotide. Specific antisense-based inhibitors of miR-424/miR-503 preserves muscle in wasting conditions. Embodiments of therapeutic agents targeting specific portions of the Hl9X-encoded genes to treat muscle disorders include antagomirs, RNA-sponge, CRISPR-mediated promoter silencing and gene editing, and other agents targeting Hl9X non-coding RNAs (e.g., paragraph 0044). The specification envisions that The inhibitor can be a nucleic acid binding to all or a part of a base sequence of miR-424. In an embodiment, the sequence of miR-424 is derived from a human, and includes not only a mature sequence but also a precursor sequence, provided by SEQ ID NOS. 1, 2, or 13 or a variant thereof. The nucleic acid can be an antisense oligonucleotide containing a sequence partially or completely complementary to the base sequence of miR-424, provided by SEQ ID NOS. 1, 2, or 13 or a variant thereof (e.g., paragraph 0045). The specification envisions that the inhibitor can be a nucleic acid binding to all or a part of a base sequence of miR-503. In an embodiment, the sequence of this miRNA is derived from a human, and includes not only a mature sequence but also a precursor sequence, provided by SEQ ID NOS. 3, 4, or 14 or a variant thereof. The nucleic acid can be an antisense oligonucleotide containing a sequence partially or completely complementary to the base sequence of miR-503, provided by SEQ ID NOS. 3, 4, or 14 or a variant thereof (e.g., paragraph 0046). The specification discloses that among the Hl9X microRNAs, miR-322, miR-503, and miR-542 are most frequently associated with muscle atrophy and cachexia. The miR-322/-503 cluster has been correlated with a broad range of diseases and has higher expression levels than miR-542. Disclosed here are therapeutic agents targeting the role of miR-322/-503 in regulating muscle mass (e.g., paragraph 0054).
The working examples disclose that inhibitors of miR-322/-503 augmented myotube growth and resistance to starvation-induced
atrophy. C2Cl2 myoblasts overexpressing antisense inhibitors of miR-322/-503 (miR-322i/-503i) were differentiated into myotubes and then cultured in regular differentiation media or subjected to starvation in low-serum/low-glucose media for 6 hours. In regular differentiation media, miR-322i/-503i-harboring myotubes had greater diameters, with combined miR-322i and
miR-503i showing the strongest effect. Low-serum/low-glucose media induced a marked decrease in myotube diameter in control cultures. Remarkably, miR-322i/-503i partially rescued atrophy in cultured myotubes, with both inhibitors being most effective. (e.g., paragraph 0069; Fig. 6A-B). Further, amount of eIF4Gl, eIF4B, eIF2B5, and eIF3M proteins was markedly higher in the presence of miR-322i/-503i, either in regular differentiation or starvation culture, or both (e.g., paragraph 0070; Fig. 6C).
The examples described in the specification does disclose that the “inhibitor” is an antisense inhibitor of miR-322/-503 (miR-322i/503i). The specification only provides data for use of antisense inhibitors of miR-322/-503, and it is not representative of a broad inhibitors allowed by the claims.
The state of the art with respect to using inhibitors of microRNA of the prevention or treatment of muscle disorder is under developed and unpredictable. Miao et al. (BioMed Research International, 2017) teaches that miR-503 was increased in diabetic muscles and oppositely correlated with cdc25 protein expression; in addition, miR-503 was also increased in myocardial microvascular endothelial cells from type 2 diabetic Goto-Kakizaki (GK) rats (e.g., paragraph 1st, left column, page 2). The expression of Nrf2 was decreased by miR-503 mimics and increased by inhibitor (e.g., paragraph 2nd, left column, page 4; Fig. 5).
As such, the prior art teaches about the unpredictability of the
inhibitors for targeting microRNAs in muscle disorders.
Therefore, the skilled artisan would have reasonably concluded
applicants were not in possession of the claimed invention for claims 1, 3, 6-7, 9, 15.
The claims listed in the statement of rejection but not otherwise discussed are rejected because they are similarly not limited to particular inhibitor that are considered to be adequately described by the specification.
Claims 1, 3, 6-7, 9, 15, and 21-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for inhibition of interaction of miR-322 and miR-503 with their targets, does not reasonably provide enablement for preventing a or treating a muscle disorder. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to the invention commensurate in scope with these claims.
Factors to be considered in determining whether a disclosure meets the enablement requirement of 35 U.S.C. 112, first paragraph, have been described by the court in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988). Wands states, on page 1404: Factors to be considered in determining whether a disclosure would require undue experimentation have been summarized by the board in Ex part Forman. These include: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and the quantity of experimentation needed to make or use the invention. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below.
Nature of the invention: The instant claim 7 is drawn to a method of preventing or treating a muscle disorder in a subject in need thereof, the method comprising administering an inhibitor of interaction between one or more microRNAs selected from the group consisting of miR-424, miR-503, miR503HG, miR-542, miR450al, miR-450a2, and miR-450b and their natural target. The nature of the claims is complicated, because the claim requires the outcome of preventing or treating a muscle disorder, yet the claim is drawn to administering an inhibitor of interaction of microRNAs miR-424, miR-503, miR503HG, miR-542, miR450al, miR-450a2, and miR-450b and their natural target.
Breadth of the claim: The claims encompass a method for preventing or treating muscle disorder comprising administering to the subject an inhibitor of the interaction between the microRNAs miR-424, miR-503, miR503HG, miR-542, miR450al, miR-450a2, and miR-450b and their natural target and their natural targets. The claims are broad with respect to the prevention or treatment of any muscle disorder including, but not limited to, the diseases recited in dependent claim 15. The claims are broad with regard to the inhibitor administered, the claim encompass any type of inhibitor from low-molecular-weight compound, an antagomir, an antisense molecule, a small hairpin RNA (shRNA) molecule, a small interfering RNA (siRNA) molecule, a seed target LNA (locked nucleic acid) oligonucleotide, a decoy oligonucleotide, an aptamer, a ribozyme, or an antibody. The complex nature of the subject matter of this invention is greatly exacerbated by the breadth of the claims.
Guidance of the specification and existence of working examples: The specification envisions methods of preventing or treating a muscle disorder in a subject in need thereof by administering an inhibitor of one or more of miR-424, miR-503, miR503HG, miR-542, miR450al, miR-450a2, and miR-450b (e.g., paragraph 0005). The specification envisions the inhibitor affects activity of one or more of miR-424, miR-503, miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b. The inhibitor can act by reducing interaction between one or more of miR-424, miR-503, miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b and their natural target mRNA. The inhibitor can be a nucleic acid selected from a group consisting of a DNA, an RNA, an antagomir, a siRNA, a shRNA and an oligonucleotide. Specific anti sense-based inhibitors of one or more of miR-424, miR-503, miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b preserve muscle in muscular disorders, such as muscle wasting, cachexia, sarcopenia, and cardiomyopathy (e.g., paragraph 0006). The specification envisions that the agent can include, without any limitations, a low-molecular-weight compound, an antagomir, an antisense molecule, a small hairpin RNA (shRNA) molecule, a small interfering RNA (siRNA) molecule, a seed target LNA (locked nucleic acid) oligonucleotide, a decoy oligonucleotide, an aptamer, a ribozyme, or an antibody that recognizes a DNA:RNA hybrid. The miRNA inhibitor can be an antisense oligonucleotide which can inhibit the activity of miRNA by complementarily binding to all or a part of the precursor and/or mature sequence of the miRNA (e.g., paragraph 0025). The specification envisions methods of preventing or treating a muscle wasting disorder in a subject in need thereof by administering an inhibitor of one or more of miR-424, miR-503,
miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b. The muscle disorders include muscle wasting, cachexia, sarcopenia and heart failure. The term "treatment" as used in the present disclosure means any action to change favorably or improve the symptoms of related diseases by administering the therapeutic agent (e.g., paragraph 0041). The specification envisions that the inhibitor can be a nucleic acid selected from a group consisting of a DNA, an RNA, an antagomir, a siRNA, a shRNA and an oligonucleotide. Specific antisense-based inhibitors of miR-424/miR-503 preserves muscle in wasting conditions. Embodiments of therapeutic agents targeting specific portions of the Hl9X-encoded genes to treat muscle disorders include antagomirs, RNA-sponge, CRISPR-mediated promoter silencing and gene editing, and other agents targeting Hl9X non-coding RNAs (e.g., paragraph 0044). The specification envisions that The inhibitor can be a nucleic acid binding to all or a part of a base sequence of miR-424. In an embodiment, the sequence of miR-424 is derived from a human, and includes not only a mature sequence but also a precursor sequence, provided by SEQ ID NOS. 1, 2, or 13 or a variant thereof. The nucleic acid can be an antisense oligonucleotide containing a sequence partially or completely complementary to the base sequence of miR-424, provided by SEQ ID NOS. 1, 2, or 13 or a variant thereof (e.g., paragraph 0045). The specification envisions that the inhibitor can be a nucleic acid binding to all or a part of a base sequence of miR-503. In an embodiment, the sequence of this miRNA is derived from a human, and includes not only a mature sequence but also a precursor sequence, provided by SEQ ID NOS. 3, 4, or 14 or a variant thereof. The nucleic acid can be an antisense oligonucleotide containing a sequence partially or completely complementary to the base sequence of miR-503, provided by SEQ ID NOS. 3, 4, or 14 or a variant thereof (e.g., paragraph 0046). The delivery of the therapeutic agents targeting one or more of these miRNAs of interest-miR-424, miR-503, miR503HG, miR-542, miR450al, miR-450a2, and miR-450b can be based on viral or non-viral systems. Non-viral delivery systems include one or more cationic lipids and cationic polymers that form cationic liposomes. Viral delivery systems include without limitation adeno-associated viral systems and retroviral systems (e.g., paragraph 0053). The specification discloses that among the Hl9X microRNAs, miR-322, miR-503, and miR-542 are most frequently associated with muscle atrophy and cachexia. The miR-322/-503 cluster has been correlated with a broad range of diseases and has higher expression levels than miR-542. Disclosed here are therapeutic agents targeting the role of miR-322/-503 in regulating muscle mass (e.g., paragraph 0054).
The working example, does not teach prevention or treatment of muscle disease, the working examples disclose (1) that transgenic mouse strain in which the expression of miR-322/-503 is driven by the MCK promoter showed lower body masses, lower body weight, reduced grip strength than of wild-type mice. These results suggest that overexpression of miR-322/-503 is sufficient to impede skeletal muscle growth in vivo. (e.g., paragraphs 0055-57; Fig. 1). (2) Furthermore, H19X-LacZ mice (mutant mice) which has defective H19X in transcribing H19X microRNAs, showed reduced expression of miR-322, miR-503, and miR-542 in skeletal muscles. Mutant mice showed overgrowth starting from 4 weeks of age (not shown), the bodyweight of mutant mice was significantly higher compared to age-matched wild-type mice (31.88 ± 1.0 g vs. 39.5 ± 1.9 g, wt vs. mt). The expression levels of eIFs showed that eIF3M was significantly higher in mutant mice, whereas increases in eIF4E, eIF4G 1, eIF4B, and eIF2B5 were not significant (e.g., paragraphs 0058-61; Fig. 2). (3) In addition, the role of increased miR-322/503 levels in cardiomyopathy were evaluated using an inducible heart-specific transgenic mice where ectopic miR-322/-503 is triggered by doxycycline diet. Transgenic mice overexpressing miR-322/503 showed enlarged left and right ventricles, and thinning of the ventricular walls; dilation of ventricles and thinning of ventricular walls, cardiomyocytes were disarrayed; Masson's Trichrome staining showed widespread fibrosis as compared to wild type mice. These results strongly suggest that cardiac specific induction of the expression of miR-322/503 caused dilated cardiomyopathy. Ectopic miR-322/503 induced fibrosis and misaligned cardiomyocytes. Hl9X non-coding RNAs are responsible for skeletal muscle wasting and heart failure. Embodiments include compositions and methods of targeting these non-coding RNAs in treating these diseases (e.g., paragraphs 0066-68; Fig. 5). (4) Studies were performed with C2Cl2 myoblasts overexpressing antisense inhibitors of miR-322/-503 (miR-322i/-503i) and differentiated into myotubes and then cultured in regular differentiation media or subjected to starvation in low-serum/low-glucose media for 6 hours. In regular differentiation media, miR-322i/-503i-harboring myotubes had greater diameters, with combined miR-322i and miR-503i showing the strongest effect. Low-serum/low-glucose media induced a marked decrease in myotube diameter in control cultures. miR-322i/-503i partially rescued atrophy in cultured myotubes, with both inhibitors being most effective. These results suggest that miR-322i/-503i promotes growth and attenuates starvation-induced myotube atrophy. The miR-322/-503 is a negative regulator of muscle mass. Inhibitors against miR-322 and miR-503 can preserve muscles in wasting conditions (e.g., paragraph 0070; Fig. 6). (5) To understand the potential role of Hl9X-encoded miRNAs in regulating muscle mass, their levels are investigated in animal models of muscle hypertrophy. As a model of muscle hypertrophy, the animals were exercised on a rodent treadmill for 4 weeks, which resulted in a significant increase in soleus, TA, and gastrocnemius muscle mass. Treadmill training resulted in downregulation of miR-322, miR-503, and miR-542 in TA muscles e.g., paragraph 0071; Fig. 7).
Predictability and state of the art: The state of the art with respect to using inhibitors of microRNAs for prevention or treatment of muscle disorders is under developed and unpredictable. Dong et al. (Toxicology Research, 2021) teaches that myotonic dystrophy (DM) is a multisystem disorder caused by RNA toxicity and is also the most common muscular dystrophy in adults, characterized by myotonia and muscle dystrophy. DM1, also called Steinert’s disease, is caused by the CUG triplet repeat expansion in the 3_-untranslated region (UTR) of the disease gene myotonic dystrophy protein kinase (DMPK). As a result, RNA-binding proteins, including CUGBP Elav-like family member 1 (Celf1), which bind to the CUG repeats are dysregulated. Celf1 regulates post-transcriptional gene expression by modulating RNA metabolism including premRNA alternative splicing, deadenylation, and mRNA decay. It has crucial roles in embryonic development, neuronal transmission, and heart and skeletal muscle function. Dong et al, shows that overexpression of miR-322/miR-503 mimics restored the differentiation while inhibitors further suppressed. Mechanistically, Dong. et al. showed that miR-322/miR-503 directly targeted Celf1 and negatively regulated its expression. Overexpression of miR-322/miR-503 mimics recovered the impairment of differentiation in CUG expansion or Celf1 overexpression myocytes by inhibiting MEK/ERK signaling. This study reveals a new mechanism underlying the defective myocyte differentiation caused by CUG expansion or Celf1 hyperfunction and demonstrates that miR-322/miR-503 play a key role in DM1. Targeting this pathway could be an avenue for the development of future therapy (e.g., paragraph 4th; Figs. 1-3). On the contrary, He et al. (Oxidative Medicine and Cellular Longevity, 2022) teaches that Acute myocardial infarction (MI) is a leading cause of death worldwide. Prompt restoration of coronary blood flow with either thrombolytic therapy or primary percutaneous coronary intervention (PPCI) is the most effective way of reducing myocardial infarction size and improving the prognosis (e.g., paragraph 1st, page 1). He et. al. teaches that agomir-503 treatment exacerbated hypoxia/reoxygenation (H/R) induced injuries manifested as decreased cell viability, increased lactate dehydrogenase activity, and cell apoptosis. Agomir-503 treatment reduced cell viability under normoxia as well and reduced both PI3K p85 and Bcl-2 protein levels under either normoxia or H/R condition. It reduced phosphorylation of Stat3 (p-Stat3-Y705) and Akt (T450) in cells subjected to H/R. In contrast, Antagomir-503 treatment attenuated H/R injury and increased p-Stat3 (Y705) under normoxia and increased p-Akt (T450) under either normoxia or H/R condition. It is concluded that miR-503 exacerbated I/R injury via inactivation of PI3K/Akt and STAT3 pathways and may become a therapeutic target in preventing myocardial I/R injury (e.g., abstract; Figs. 2-7).
Thus, the teachings of the post-filing art are consistent with the prior art demonstrating the underdeveloped and unpredictable nature of the invention.
Amount of experimentation necessary: Muscle diseases are highly complex and different etiologies and gene-based therapies are still in developmental stages. It would require a large amount of experimentation to make use of inhibitor of microRNAs for the prevention or treatment of muscle disorder. For a specific gene therapy to be efficacious, it would require to address: (1) the specific means of inhibitors of micro RNAs for prevention or treatment of muscle disorder delivery, expression, activity, (2) to define the specific dosage of therapeutic molecules delivered to the cells or to the subjects in time course, (3) the potential deleterious effect of continuous expression of the inhibitors on normal cells and tissues.
In view as well as the unpredictability of the art, the skilled artisan would have required an undue amount of experimentation to make and/or use the claimed invention. Therefore, claims 7, 9, 15 and 21-22 are not considered to be fully enabled by the instant disclosure.
In view of the breadth of the claims, the lack of guidance provided by the specification, the lack of the predictability of the art to which the invention pertains, undue amount of experimentation would be required to make and use the claimed invention to prevent or treat muscle disorder in a subject, with a reasonable expectation of success. Because the specification does not contain a detailed description of how to make and use the method based on administration of inhibitors of microRNAs, according to the invention, and absent working examples that provide evidence that is reasonably predictive of the ability of preventing a muscle disorder in a subject, the claim is not enabled commensurate in scope with the claimed invention.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 3, 6-7, 9, 15, and 21-22 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Miao et al. (“Miao”, BioMed Research International, 2017).
Claim interpretation regarding claim 1: while claim 1 recites in the preamble “a method of preventing or treating a muscle disorder in a subject in need thereof”, this is not considered a limitation, it is merely an intended use because the act of step of the body of the claim “administering an inhibitor of expression of one or more of miR-424, miR-503, miR503HG, miR-542, miR450al, miR-450a2, and miR-450b” stand alone.
Regarding claims 1, 6, Miao teaches that miR-503 was increased in diabetic muscles and oppositely correlated with cdc25 protein expression; in addition, miR-503 was also increased in myocardial microvascular endothelial cells from type 2 diabetic Goto-Kakizaki (GK) rats (e.g., paragraph 1st, left column, page 2). Miao teaches that synthetic miR-503 mimic and inhibitor had the ability of upregulation and downregulation of miR-503 (e.g., paragraph 2nd, left column, page 4; Fig. 5 [see below]). The synthetic 503 mimic and inhibitor were transfected into myocardial cells to induce upregulation and downregulation of miR-503 in the myocardial cells (e.g., paragraph 7th, left column, page 3).
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Claim interpretation regarding claim 7: while claim 7 recites in the preamble “a method of preventing or treating a muscle disorder in a subject in need thereof”, this is not considered a limitation, it is merely an intended use because the act of step of the body of the claim “administering an inhibitor of interaction between one or more microRNAs selected from the group consisting of miR-424, miR-503, miR503HG, miR-542, miR450a1, miR-450a2, and miR-450b and their natural target” stand alone.
Regarding claims 7, 15, Miao teaches that miR-503 was increased in diabetic muscles and oppositely correlated with cdc25 protein expression; in addition, miR-503 was also increased in myocardial microvascular endothelial cells from type 2 diabetic Goto-Kakizaki (GK) rats (e.g., paragraph 1st, left column, page 2). Miao teaches that synthetic miR-503 mimic and inhibitor had the ability of upregulation and downregulation of miR-503.The mimic and inhibitor were transfected into myocardial cells to induce upregulation and downregulation of miR-503 in the myocardial cells (e. g., paragraph 6th, left column, page 3). Miao teaches that Nrf2 is the target of miR-503 (e.g., paragraph 1st, column left, page 4; Fig. 4). Miao teaches that miR-503 regulates the expression of Nrf2 in myocardial cells, compared with control, the intracellular miR-503 was increased by miR-503 mimics and decreased by miR-503 inhibitor. The expression of Nrf2 was decreased by miR-503 mimics and increased by inhibitor (e.g., paragraph 2nd, left column, page 4; Fig. 5 [see above]).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 3, 9, 21-22 are rejected under 35 U.S.C. 103 as being unpatentable over Miao et al. (“Miao”, BioMed Research International, 2017) as applied to claims 1, 6, 7, 15 above, and further in view of Cao et al. (“Cao”, Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy, 2020).
The teachings of Miao et al are described above and applied as before.
Miao does not teach that the inhibitor contains a nucleic acid binding part of base sequence of miR-503, as required by claims 3 and 9. Miao does not teach that the inhibitor is an antisense oligonucleotide, as required by claims 21-22. However, this is cured by Cao.
Cao teaches miR-503-5p mimics: sense, UAGCAGCGGGA ACAGUUCUGCAG, antisense, GCAGAACUGUUCCCGCUGCUAUU and the miR-503-5p inhibitor: CUGCAGAACUGUUCCCGCUGCUA (e.g., paragraph 1st, left column, page 4509) (miR-503 inhibitor is an antisense oligonucleotide of miR-503 sense sequence). Cao teaches that expression levels of miR-503 were significantly lower in HK-2 cells transfected with miR-503-5p inhibitor in the high glucose (HG) group (e.g., paragraph 2nd, right column, page 5; Fig. 3B-C).
PNG
media_image2.png
3167
5815
media_image2.png
Greyscale
Based on these teachings, it would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to substitute the miR-503 inhibitor taught by Miao with the miR-503-5p antisense oligonucleotide that reduce the levels of miR-503 taught by Cao; for someone skilled in the art would have been obvious to use these teachings to achieve the predictable result of reducing the expression levels of miR-503 in diabetic cardiomyopathy with the antisense oligonucleotide miR-503 inhibitor.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to use an inhibitor antisense oligonucleotide miR-503 inhibitor to reduce the levels of miR-503 in diabetic cardiomyopathy.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JULIO GOMEZ RODRIGUEZ whose telephone number is (571)270-0991. The examiner can normally be reached Monday - Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 5712722916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JULIO WASHINGTON GOMEZ RODRIGUEZ/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637