Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Nucleotide and/or Amino Acid Sequence Disclosures
This application contains sequence disclosures that are encompassed by the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 through 1.825 because there are sequences in claims 39 and 40 that do not contain a SEQ ID NO.
A complete response to this office action must correct the defects cited above regarding compliance with the sequence rules and a response to the action on the merits which follows.
The aforementioned instance of failure to comply is not intended as an exhaustive list of all such potential failures to comply in the instant application. Applicants are encouraged to thoroughly review the application to ensure that the entire application is in full compliance with all sequence rules. This requirement will not be held in abeyance.
Improper Markush Rejection
Claims 67, 8, 13, 18, 19, 26, 27, 35, 38-40, 56-58, 62, 63, 65, 67-69, and 86 are rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons: The claims have been amended to be directed to siRNAs that have a first strand having at least 14 contiguous nucleotides of any one of SEQ ID NOs: 11-20, resulting in a large genus of possible siRNAs shifted across each of the instantly recited sequences. Each of the siRNAs have a different sequence and different activity. One cannot be substituted for another with expectation of identical activity.
In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or grouping of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims(s) in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 U.S.C. 134 and 37 CFR 41.31(a)(1).
When the Markush grouping is for alternatives of chemical compounds, they shall be regarded as being of a similar nature where the following criteria are fulfilled:
(A) All alternatives have a common property or activity; and
(B) (1) A common structure is present, i.e., a significant structural element is shared by all of the alternatives; or
(B) (2) In cases where the common structure cannot be the unifying criteria, all alternatives belong to a recognized class of chemical compounds in the art to which the invention pertains.
In paragraph (B)(1), above, the words “significant structural element is shared by all of the alternatives” refer to cases where the compounds share a common chemical structure which occupies a large portion of their structures, or in case the compounds have in common only a small portion of their structures, the commonly shared structure constitutes a structurally distinctive portion in view of existing prior art, and the common structure is essential to the common property or activity. The structural element may be a single component or a combination of individual components linked together.
In paragraph (B)(2), above, the words “recognized class of chemical compounds” mean that there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention. In other words, each member could be substituted one for the other, with the expectation that the same intended result would be achieved.
In order for the members of the Markush group to belong to “recognized class of chemical compounds” there must be an expectation that the members of the class will behave in the same way in the context of the claimed invention. In other words, each member of the class could be substituted one for the other with the expectation that the same intended result would be achieved. In the instant case, activity of any specific siRNA is dependent upon the specific sequence of nucleotides. There is no expectation that any one of the nucleotide sequences as claimed can be substituted for any of the other with a completely different sequence with the expectation of the same activity.
As set forth in MPEP2117, “Note that where a Markush group includes only materials from a recognized scientific class of equivalent materials or from an art-recognized class, "the mere existence of such a group in an application tend[s] to prove the equivalence of its members and when one of them [is] anticipated the group [is] therefore rendered unpatentable, in the absence of some convincing evidence of some degree of non-equivalency of one or more of the remaining members." In re Ruff, 256 F.2d 590, 598-99, 118 USPQ 340, 348 (CCPA 1958)("[A]ctual equivalence is not enough to justify refusal of a patent on one member of a group when another member is in the prior art. The equivalence must be disclosed in the prior art or be obvious within the terms of Section 103." Id. at 599, 118 USPQ at 348).”
In the instant case, art against any one siRNA would not be evidence against any of the remaining members that have completely different sequences and do not have identical activity. The first recited sequence, SEQ ID NO: 11, has been examined.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 7, 8, 13, 18, 19, 26, 27, 35, 38-40, 56-58, 62, 63, 65, 67-69, and 86 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Instant claim 7 has been amended to require for the first modified oligonucleotide to comprise at least 14 contiguous nucleobases of any of SEQ ID NOs: 11-20 and for the compound to be a siRNA. However, the sequences of SEQ ID NOs: 11-20 are DNA sequences rather than RNA sequences. Claims 38-40 recite specific RNA sequences that cannot meet the limitation of the recited DNA sequences. Therefore, the claims are not definite.
Additionally, the claims do not define what U, f, *, or m stand for.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 7, 8, 13, 18, 19, 26, 27, 35, 38-40, 56-58, 62, 63, 65, 67-69, and 86 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Instant claim 67 recites that the individual has RAAS or any possible disease, disorder, condition, or symptom thereof. The specification does not adequately describe this genus of diseases, disorders, conditions, or symptoms with any possible relationship to the renin-angiotensin-aldosterone system (RAAS).
The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated:
"A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing.
Thus, having analyzed the claims with regard to the Written Description guidelines, it is clear that the specification does not disclose a representative number of species for diseases, disorders, conditions, or symptoms with any possible relationship to the renin-angiotensin-aldosterone system (RAAS). Thus, one skilled in the art would be led to conclude that Applicant was not in possession of the claimed invention at the time the application was filed.
Response to Arguments
Applicant argues that the claim has been amended to require for the individual to have the recited diseases, disorders, or conditions; but this does not negate that the specification does not adequately describe the genus in a manner that one or ordinary skill in the art would be able to envision which diseases, disorders, conditions, or symptoms thereof that have any relation to RAAS are included in the genus.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 7, 8, 13, 18, 19, 26, 27, 35, 38-40, 56-58, 62, 63, 67-69, and 86 is/are rejected under 35 U.S.C. 103 as being unpatentable over Foster et al. (WO 2019/222166 A1), in view of Wu et al. (PLoS ONE, 2011, Volume 6, Issue 12, e28580, 1-9).
Foster et al. teach a siRNA wherein the first strand differs from the RNA form of instant SEQ ID NO: 11 by 3 nucleotides and comprises a contiguous stretch of 13 nucleobases of instant SEQ ID NO: 11.
See the PE2E search file “us-18-194-203-11.szlim30.rng” as follows:
RESULT 18
BGZ68589
ID BGZ68589 standard; mRNA; 23 BP.
AC BGZ68589;
DT 09-JAN-2020 (first entry)
DE Human AGT mRNA sequence (AD-84708 dsRNA target), SEQ 761.
KW AGT gene; ANHU; Angiotensin I; Angiotensin II; Angiotensinogen ligand;
KW SERPINA8; Serpin A8; Serpin peptidase inhibitor, clade A, member 8;
KW alpha-1 antiproteinase; angina; anorectic; antianginal;
KW antiarteriosclerotic; antidiabetic; antiinflammatory; antilipemic;
KW antiproteinase angiotensinogen; antitrypsin; arteriosclerosis;
KW atherosclerosis; cardiac failure; cardiant; cerebroprotective;
KW cysteine proteinase inhibitor; dermatological; diabetic hypertension;
KW diabetic nephropathy; diabetic retinopathy; fatty liver disease;
KW fetal growth restriction; gastrointestinal-gen.; gene silencing;
KW glaucoma; glucose intolerance; growth-disorder-gen.; gynecological;
KW heart disease; hepatotropic; hypertension; hypotensive;
KW metabolic syndrome x; metabolic-gen.; musculoskeletal-gen.;
KW myocardial infarction; nephrotropic; non alcoholic fatty liver disease;
KW non-alcoholic steatohepatitis; non-insulin dependent diabetes;
KW nutrition-disorder-gen.; obesity; ocular hypertension; ophthalmological;
KW portal hypertension; pre-angiotensinogen 2; prophylactic to disease;
KW pulmonary hypertension; renal disease; renal failure;
KW renovascular hypertension; resistant hypertension; rna interference;
KW scleroderma; serine proteinase inhibitor; ss; stroke; therapeutic;
KW vascular disease; vasotropic.
OS Homo sapiens.
CC PN WO2019222166-A1.
CC PD 21-NOV-2019.
CC PF 14-MAY-2019; 2019WO-US032150.
PR 14-MAY-2018; 2018US-0671094P.
PR 05-SEP-2018; 2018US-0727141P.
PR 12-MAR-2019; 2019US-0816996P.
CC PA (ALNY ) ALNYLAM PHARM INC.
CC PI Foster D, Hinkle G, Schlegel MK;
DR WPI; 2019-98234B/93.
CC PT Double stranded ribonucleic acid agent for inhibiting expression of
CC PT angiotensinogen (AGT) comprises sense strand and antisense strand forming
CC PT double stranded region, where sense strand comprises 19 contiguous
CC PT nucleotides.
CC PS Example 1; SEQ ID NO 761; 183pp; English.
CC The present invention relates to a novel double stranded ribonucleic acid
CC (dsRNA) agent which is used for preventing and treating an
CC angiotensinogen (AGT)-associated disorder in a subject. The dsRNA
CC inhibits the expression of human AGT mRNA of SEQ ID NO: 1-2 (see BGZ67829
CC -BGZ67830) and SEQ ID NO: 757-940 (see BGZ68585-BGZ68768), where the
CC dsRNA comprises a sense strand selected from SEQ ID NO: 21-204 (see
CC BGZ67849-BGZ68032), SEQ ID NO: 389-572 (see BGZ68217-BGZ68400) and SEQ ID
CC NO: 941-950 (see BGZ68769-BGZ68778) and an antisense strand selected from
CC SEQ ID NO: 205-388 (see BGZ68033-BGZ68216), SEQ ID NO: 573-756 (see
CC BGZ68401-BGZ68584) and SEQ ID NO: 951-960 (see BGZ68779-BGZ68788) forming
CC a double stranded region. The invention further relates to: (1) a cell
CC containing the dsRNA agent; (2) a pharmaceutical composition for
CC inhibiting the expression of a gene encoding the AGT, where the
CC composition comprises the dsRNA agent; (3) a method for inhibiting the
CC expression of the AGT gene in a cell by contacting the cell with the
CC dsRNA agent or the pharmaceutical composition; and (4) a method for
CC treating an AGT-associated disorder in a subject by administering the
CC dsRNA agent or the pharmaceutical composition to the subject. The dsRNA
CC agent is used for preventing and treating high blood pressure,
CC hypertension, borderline hypertension, primary hypertension, secondary
CC hypertension isolated systolic or diastolic hypertension, pregnancy-
CC associated hypertension, diabetic hypertension, resistant hypertension,
CC refractory hypertension, paroxysmal hypertension, renovascular
CC hypertension, hypertensive nephropathy, hypertension associated with low
CC plasma renin activity or plasma renin concentration, ocular hypertension,
CC glaucoma, goldblatt hypertension, pulmonary hypertension, portal
CC hypertension, systemic venous hypertension, systolic hypertension, labile
CC hypertension, hypertensive heart disease, atherosclerosis,
CC arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic
CC retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac
CC myopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurism,
CC ventricular fibrosis, heart failure, myocardial infarction, angina,
CC stroke, renal disease, renal failure, systemic sclerosis, intrauterine
CC growth restriction (IUGR), fetal growth restriction, obesity, liver
CC steatosis/fatty liver, non-alcoholic steatohepatitis (NASH), non-
CC alcoholic fatty liver disease (NAFLD), glucose intolerance, type 2
CC diabetes and metabolic syndrome in the subject.
SQ Sequence 23 BP; 4 A; 4 C; 5 G; 0 T; 10 U; 0 Other;
Query Match 88.7%; Score 20.4; Length 23;
Best Local Similarity 95.5%;
Matches 21; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 TGATCATACACAGTAAACAGGA 22
||||||||||||| ||||||||
Db 22 TGATCATACACAGCAAACAGGA 1
It would have been obvious to incorporate a single mismatch into the antisense strand of Foster et al. as a matter of design choice because Foster et al. teaches incorporation of mismatches and Wu et al. teach: In this study, we find that siRNA functionality can be improved if conventional siRNA is changed to have a miRNA duplex-like structure by increasing the length to 22 nt and introducing mismatches into the duplex (page 1). Introducing 2 or 3 mismatches increased the functionality further (page 2).
Therefore, one would have reasonably expected the benefits taught by Wu et al. upon incorporation of a mismatch at the single mismatched position 15 between the sequence of Foster et al. and instant SEQ ID NO: 11 (instant claims 7, 8, 13, 38); and to shift the sequence by a single nucleotide given that the siRNA of Foster et al. is directed to a region that overlaps the instant target region other than shifted by a single nucleotide (instant claim 8).
The instantly recited modification patterns are obvious in view of the modification patterns taught by Foster et al. (pages 50-64), which teach the same types of modifications at varying positions (instant claims 39 and 40).
Foster et al. teach incorporation of an N-acetylgalactosamine (GalNAc) ligand at the 3’ end of the sense strand. Foster et al. teach that the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g., the 5’end of the sense strand of a dsRNA agent, or the 5’ end of one or both sense strands of a dual targeting RNAi agent as described herein (instant claim 1); and teaches attachment to the 2’ or 3’ position of the ribosyl ring of the 5’ nucleoside of the second strand (instant claim 86).
Foster et al. teaches incorporation of phosphorothioate linkages (instant claim 18) and teaches incorporation at the terminal ends of each strand (instant claim 19).
Foster et al. teaches incorporation of 2’ F modifications (see page 34) (instant claims 26 and 27).
Foster et al. teach: alternating motif in the sense strand may start with “ABABAB” from 5’to 3’ of the strand and the alternating motif in the antisense strand may start with “BAB ABA” from 5’ to 3’of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with “AABBAABB” from 5’ to 3’ of the strand and the alternating motif in the antisense strand may start with “BBAABBAA” from 5’ to 3’ of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.
Foster et al. teach: In an aspect, the invention provides a pharmaceutical composition for inhibiting expression of a gene encoding AGT comprising the dsRNA agent of the invention. In certain embodiments, the pharmaceutical composition comprises the dsRNA agent and a lipid formulation (instant claims 62 and 63).
Foster et al. teach a method of treating a disease associated with RAAS via delivery of the siRNA (instant claims 65, 67, and 68) and direct delivery to liver cells (instant claim 69).
Foster et al. teach ligand structures identical to the instantly recited structures (see pages 4, 5, and 75-82) (instant claims 35, 56, and 58).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 7, 8, 13, 18, 19, 26, 27, 35, 38-40, 56-58, 62, 63, 67-69, and 86 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 7-85 of copending Application No. 18/852,676 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of application ‘676 recite double stranded oligonucleotides comprising the same sequences as instantly claimed including the same modification patterns as instantly claimed. Application ‘676 recites IA1103 and IS1382, which is identical to the sequences of instant claims 39 and 40. Both claim sets recite the same modifications, lengths, structures for ligands, linkages, and methods. The claims are obvious variations of each other.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636