DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Request for Continue Examination
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 02 October 2025 has been entered.
Claim Interpretation
Attention is directed to MPEP 904.01 [R-08.2012].
The breadth of the claims in the application should always be carefully noted; that is, the examiner should be fully aware of what the claims do not call for, as well as what they do require. During patent examination, the claims are given the broadest reasonable interpretation consistent with the specification. See In re Morris, 127 F.3d 1048, 44 USPQ2d 1023 (Fed. Cir. 1997). See MPEP § 2111 - § 2116.01 for case law pertinent to claim analysis.
It is noted with particularity that narrowing limitations found in the specification cannot be inferred in the claims where the elements not set forth in the claims are linchpin of patentability. In re Philips Industries v. State Stove & Mfg. Co, Inc., 186 USPQ 458 (CA6 1975). While the claims are to be interpreted in light of the specification, it does not follow that limitations from the specification may be read into the claims. On the contrary, claims must be interpreted as broadly as their terms reasonably allow. See Ex parte Oetiker, 23 USPQ2d 1641 (BPAI, 1992). In added support of this position, attention is directed to MPEP 2111 [R-11.2013], where, citing In re Prater, 415 F.2d 1393, 1404-05, 162 USPQ 541, 550-51 (CCPA 1969), is stated:
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.
Additionally, attention is directed to MPEP 2111.01 [R-01.2024], wherein is stated:
II. IT IS IMPROPER TO IMPORT CLAIM LIMITATIONS FROM THE SPECIFICATION
“Though understanding the claim language may be aided by explanations contained in the written description, it is important not to import into a claim limitations that are not part of the claim. For example, a particular embodiment appearing in the written description may not be read into a claim when the claim language is broader than the embodiment.” Superguide Corp. v. DirecTV Enterprises, Inc., 358 F.3d 870, 875, 69 USPQ2d 1865, 1868 (Fed. Cir. 2004).
Attention is also directed to MPEP 2111.02 II [R-07.2022]. As stated herein:
II. PREAMBLE STATEMENTS RECITING PURPOSE OR INTENDED USE
PNG
media_image1.png
18
19
media_image1.png
Greyscale
The claim preamble must be read in the context of the entire claim. The determination of whether preamble recitations are structural limitations or mere statements of purpose or use "can be resolved only on review of the entirety of the [record] to gain an understanding of what the inventors actually invented and intended to encompass by the claim" as drafted without importing "'extraneous' limitations from the specification." Corning Glass Works, 868 F.2d at 1257, 9 USPQ2d at 1966. If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention’s limitations, then the preamble is not considered a limitation and is of no significance to claim construction. Shoes by Firebug LLC v. Stride Rite Children’s Grp., LLC, 962 F.3d 1362, 2020 USPQ2d 10701 (Fed. Cir. 2020) (The court found that the preamble in one patent’s claim is limiting but is not in a related patent); Pitney Bowes, Inc. v. Hewlett-Packard Co., 182 F.3d 1298, 1305, 51 USPQ2d 1161, 1165 (Fed. Cir. 1999). See also Rowe v. Dror, 112 F.3d 473, 478, 42 USPQ2d 1550, 1553 (Fed. Cir. 1997) ("where a patentee defines a structurally complete invention in the claim body and uses the preamble only to state a purpose or intended use for the invention, the preamble is not a claim limitation")… (Emphasis added)
Attention is directed to MPEP 2111 [R-10.2019]. As stated therein:
During patent examination, the pending claims must be "given their broadest reasonable interpretation consistent with the specification." The Federal Circuit’s en banc decision in Phillips v. AWH Corp., 415 F.3d 1303, 1316, 75 USPQ2d 1321, 1329 (Fed. Cir. 2005) expressly recognized that the USPTO employs the "broadest reasonable interpretation" standard:
The Patent and Trademark Office ("PTO") determines the scope of claims in patent applications not solely on the basis of the claim language, but upon giving claims their broadest reasonable construction "in light of the specification as it would be interpreted by one of ordinary skill in the art." In re Am. Acad. of Sci. Tech. Ctr., 367 F.3d 1359, 1364[, 70 USPQ2d 1827, 1830] (Fed. Cir. 2004). Indeed, the rules of the PTO require that application claims must "conform to the invention as set forth in the remainder of the specification and the terms and phrases used in the claims must find clear support or antecedent basis in the description so that the meaning of the terms in the claims may be ascertainable by reference to the description." 37 CFR 1.75(d)(1). (Emphasis added).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Standard for Obviousness.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Attention is directed to In re Jung, 98 USPQ2d 1174, 1178 (Fed. Cir. 2011) wherein is stated:
There has never been a requirement for an examiner to make an on-the-record claim construction of every term in every rejected claim and to explain every possible difference between the prior art and the claimed invention in order to make out a prima facie rejection. This court declines to create such a burdensome and unnecessary requirement. “[Section 132] does not mandate that in order to establish prima facie anticipation, the PTO must explicitly preempt every possible response to a section 102 rejection. Section 132 merely ensures that an applicant at least be informed of the broad statutory basis for the rejection of his claims, so that he may determine what the issues are on which he can or should produce evidence.” Chester, 906 F.2d at 1578 (internal citation omitted). As discussed above, all that is required of the office to meet its prima facie burden of production is to set forth the statutory basis of the rejection and the reference or references relied upon in a sufficiently articulate and informative manner as to meet the notice requirement of § 132. As the statute itself instructs, the examiner must “notify the applicant,” “stating the reasons for such rejection,” “together with such information and references as may be useful in judging the propriety of continuing prosecution of his application.” 35 U.S.C. § 132.
Attention is directed to the decision in KSR International Co. v. Teleflex Inc., 82 USPQ2d 1385 (U.S. 2007):
When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill in the art has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense.
It is further noted that prior art is not limited to the four corners of the documentary prior art being applied. Prior art includes both the specialized understanding of one of ordinary skill in the art, and the common understanding of the layman. It includes “background knowledge possessed by a person having ordinary skill in the art. . . [A] court can take account of the inferences and creative steps that a person of ordinary skill in the art would employ.” KSR at 1396.
Suggestion, teaching or motivation does not have to be explicit and “may be found in any number of sources, including common knowledge, the prior art as a whole or the nature of the problem itself’” Pfizer, Inc. v. Apotex, Inc. 480 F.3d 1348, 82 USPQ2d 1321 (Fed. Cir. 2007) citing Dystar Textilfarben GMBH v. C. H. Patrick Co., 464 F.3d 1356 (Fed. Cir. 2006).
Holding and Rationale
Claims 1-5 and 8-11 are rejected under 35 U.S.C. 103 as being unpatentable over 2012/0264638 A1 (Brase et al.) in view of WO 2015/058159 (Klinger et al.), US 2015/0211070 A1 (Seligson et al.), US 2015/0374721 A1 (Njar et al.), US 2005/0214844 A1 (Moore et al.) and US 2015/0252426 A1 (Joseph et al.).
Brase et al., in paragraph [0140], teach detection of prostate cancer via cell-free serum. As disclosed therein:
[0140] In order to screen for circulating miRNAs associated with prostate cancer progression, 21 serum samples were analyzed. RNA was purified, and 667 miRNAs were measured with low density Taq-Man arrays. One sample (IGPS-20) was discarded as an outlier due to the large number of undetermined values (610 out of 768). The overall abundances of circulating miRNAs revealed a significantly higher level of cell-free miRNAs in serum samples taken from patients with metastasized tumors when compared to those with primary prostate cancer (p=0.02, Wilcoxon test). (Emphasis added)
The above showing is deemed to fairly suggest limitations of claims 1, 2, 5, 6, and 7.
While Brase et al., teach of detecting prostate cancer, they have not been found to teach assaying for the AR-V or AR gene using cell-free DNA and RNA. They have also not been found to teach that the version of prostate cancer is “castration resistant” version, nor teach “barcoding said cell-free DNA molecules and said cell-free RNA molecules or derivatives hereof, to generate barcoded nucleic acids, and performing an assay on said barcoded nucleic acids”.
Klinger et al., at paragraph [0032], teach:
[0032] A sample for use with the invention can include DNA (e.g., genomic DNA) or RNA (e.g., messenger RNA). The nucleic acid can be cell-free DNA or RNA, e.g. extracted from the circulatory system, Vlassov et al, Curr. Mol. Med., 10: 142-165 (2010); Swamp et al, FEBS Lett., 581: 795-799 (2007). (Emphasis added)
Klinger et al., at paragraph [0035], teach:
[0035] Cell-free DNA may also be extracted from peripheral blood samples using conventional techniques, e.g. Lo et al, U.S. patent 6,258,540; Huang et al, Methods Mol. Biol., 444: 203-208 (2008); and the like, which are incorporated herein by reference.
The above showing is deemed to fairly suggest limitations of claims 1, 2, and 5.
Klinger et al., has not been found to teach adding a barcode to the nucleic acids prior to performing the assay.
Seligson et al., at paragraph [0149], provides a listing of cancers that are recognized as producing circulating nucleic acids that are associated with tumor. As stated therein:
[0149] Examples of tumor-associated circulating nucleic acids include, but are not limited to, those derived from prostate, breast, ovarian, uterine, cervical, lung, colon, uterine, pancreatic, bladder, brain, liver, kidney, and skin cancer. The disclosure further provides methods for monitoring response to radiation treatment and/or chemotherapeutic drugs, and monitoring cancer remission and recurrence. (Emphasis added)
Seligson et al., at paragraph [0348], teach adding a barcode to RNA and DNA samples. As stated therein:
[0348] A serum sample from a subject suffering from a breast cancer is analyzed for cancer cell-derived RNA. The nucleic acids in the sample are mixed with a plurality of unique barcodes to produce barcoded-RNA molecules. The barcoded-RNA molecules are reverse transcribed to produce barcoded-DNA molecules. The barcoded-DNA molecules are sequenced and the quantity of the nucleic acids is determined by counting the number of unique barcodes for each sequence. (Emphasis added)
Njar et al., at paragraph [0077], teach:
[0077] In a clinical study of castrate resistant prostate cancer (Antonarakis E, Lu C, Wang H, et al. Androgen Receptor Splice Variant-7 Predicts Resistance to Enzalutamide in Patients with Castration Resistant Prostate Cancer. 2014 AACR Annual Meeting. Abstract 2910. Presented Apr. 7, 2014), 39% of patients expressed AR-V7 mRNA in circulating tumor cells. This subset of patients had a worse prognosis and worse response to anti-androgen treatment.
Njar et al., in paragraph [0211, teach methods of detecting mutated AR. As disclosed therein:
Example 6
Detection of Mutated AR by Amplification
[0211] Mutated AR in patient samples may be detected by PCR. Quantitative real-time PCR methods are known in the literature, specifically as described in Luo et al., US2011/0110926. As described Cancer Research 2009, 69:16-22, for RT-PCR analyses, total RNA was isolated and reverse transcribed to form cDNA and was used in a RT-PCR analysis. PCR primers were designed as described to specifically amplify transcript sequences that are known in the NH2 terminal (5′ primers) (for example primer P6/P7/P9) and within the mutated forms (truncated, for example P7) of the AR protein (i.e. specific to AR-V7) mRNA and can be readily detected within about 30 (specifically 28) PCR amplification cycles. Using methods as described it would be possible to detect expression levels of truncated AR in samples from patients with prostate cancer. In this analysis, and due to variable expression levels in patient samples, the gene SF3A3, was used as a reference gene for normalization. (Emphasis added)
Moore, in paragraph [0092], teach of a variety of bodily fluids that can be used as the source of the DNA and RNA that is analyzed. As disclosed therein:
Therefore, polynucleotides and polypeptides of the invention are useful as reagents for differential identification of the tissue(s) or cell type(s) present in a biological sample and for diagnosis of diseases and conditions which include, but are not limited to, prostate cancer and cardiovascular disorders. Similarly, polypeptides and antibodies directed to these polypeptides are useful in providing immunological probes for differential identification of the tissue(s) or cell type(s). For a number of disorders of the above tissues or cells, particularly of the prostate and cardiovascular system, expression of this gene at significantly higher or lower levels may be routinely detected in certain tissues or cell types (e.g., prostate, cardiovascular, cancerous and wounded tissues) or bodily fluids (e.g., lymph, serum, plasma, urine, synovial fluid and spinal fluid) or another tissue or cell sample taken from an individual having such a disorder, relative to the standard gene expression level, i.e., the expression level in healthy tissue or bodily fluid from an individual not having the disorder. The tissue distribution in prostate indicates that the protein product of this gene is useful for the treatment and diagnosis of prostate cancer and reproductive disorders. (Emphasis added)
Neither Brase et al., Njar et al., nor Moore et al., have been found to teach detection of AR-F876L.
Joseph et al., in paragraph [0278], teach:
[0278] As shown above, expression of AR-F876L was sufficient to confer enzalutamide and ARN-509 resistance in transient reporter based assays. In this example, the effects of F876L on endogenous AR target genes and proliferation in prostate cancer cells stably expressing the mutant was examined. (Emphasis added)
The above showing is deemed to fairly suggest limitations of claim 11.
In view of the above showing, it would have been obvious to one of ordinary skill in the art at the time of the invention to have modified the method of detection of prostate cancer of Brase et al., so to enable the detection of castration-resistant prostate cancer via detection of AR mutations, including AR-V7, in a variety of bodily fluids as disclosed by Moore et al. It would have also been obvious to said ordinary artisan to have modified the method such that any of a variety of bodily fluids were used as a source of the nucleic acids to be analyzed, wherein the nucleic acids include obtaining cell-free RNA and producing a complementary DNA (cDNA), which, as seen in Njar et al., can also be analyzed via RT-PCR.
In view of the above showing and in the absence of convincing evidence to the contrary, claims 1-5 and 8-11 are rejected under 35 U.S.C. 103 as being unpatentable over 2012/0264638 A1 (Brase et al.) in view of WO 2015/058159 (Klinger et al.), US 2015/0211070 A1 (Seligson et al.), US 2015/0374721 A1 (Njar et al.), US 2005/0214844 A1 (Moore et al.) and US 2015/0252426 A1 (Joseph et al.).
Claims 12-16 are rejected under 35 U.S.C. 103 as being unpatentable over US 2012/0264638 A1 (Brase et al.) in view of WO 2015/058159 A1 (Klinger et al.), US 2015/0211070 A1 (Seligson et al.), US 2015/0374721 A1 (Njar et al.), US 2005/0214844 A1 (Moore et al.) and US 2015/0252426 A1 (Joseph et al.) as applied to claims 1-11 above, and further in view of US 6,300,060 B1 (Kantoff et al.) and US 2012/0283120 A1 (Watanabe et al.).
See above for the basis of the rejection as it relates to the teachings of Brase, Klinger et al., Seligson et al., Njar et al., Moore et al., and Joseph et al.
Kantoff et al., disclose “Method for Predicting the Risk of Prostate Cancer Morbidity and Mortality”. Kantoff et al., at column 4, last paragraph, teach:
Either DNA or RNA can be used in the present method. The DNA which can be used in the method can be cDNA or genomic DNA, preferably genomic DNA. The source of DNA can be from any cell or cells removed from the individual and can include cultured progeny thereof. Since the invention does not rely upon the identification of somatic mutation in the tumor, but is preferably analyzing germline DNA, the DNA can be isolated from non-cancerous cells, such as somatic tissue or a blood sample. Also because the DNA which is preferably analyzed is germline DNA, the prognostic method can be carried out prior to onset of disease. This significant advantage can be used to establish a cancer screening schedule prior to onset of prostate cancer and treatment protocol upon onset due to the risk factor assigned by the described method. (Emphasis added)
Kantoff et al., at column 8, second paragraph, teach:
Since the AR gene is X-linked, only one copy of the gene exists in men. The CAG microsatellite region resides in the coding region of the gene within the first exon. A system to rapidly analyze the CAG repeat sequence length in a large number of samples was established. Five hundred microliters of whole blood was thawed from cases and controls and DNA was extracted utilizing the Qiagen QIAamp Blood Kit. A set of oligonucleotide primers that span the CAG repeat (5'TCCAGAATCTGTTCCAGAGCGTGC3' (SEQ ID NO:1) and 5'GCTGTGAAGGTTGCTGTTCCTCAT3' (SEQ ID NO:2)) were constructed. The DNA was amplified using these primers by polymerase chain reaction (PCR) to produce fragments of the N-terminal domain of the AR. (Emphasis added)
The above showing is deemed to fairly suggest limitations of claims 12-15.
Kantoff et al., has not been found to teach using an array of nucleic acids to detect prostate cancer.
Watanabe et al., in paragraph [0233], teach:
[0233] Using Tissue Scan.TM. Real-Time, Prostate Cancer Array II (Origene) as cDNA of clinical prostate cancer, the expression levels of AR, ARaiv1 and .beta.-actin were measured by quantitative RT-PCR. The quantitative RT-PCR was carried out using ABI PRISM7700 (Applied Biosystems), QuantiTect Probe RT-PCR kit (Qiagen) and gene specific primers and probes. (Emphasis added)
In view of the above presentation, it would have been obvious to one of ordinary skill in the art at the time of the invention tot have devised and used an array of sequences to analyze complementary DNA (cDNA) for AR gene mutations disclosed by Njar et al., and Joseph et al. In view of the significance of the AR and AR-V mutants in the diagnosis of castration resistant prostate cancer, said ordinary artisan would have been amply motivated, and in view of the well-developed state of the art, said ordinary artisan would have had a most reasonable expectation of success.
In view of the above analysis and in the absence of convincing evidence to the contrary, claims 12-16 are rejected under 35 U.S.C. 103 as being unpatentable over US 2012/0264638 A1 (Brase et al.) in view of WO 2015/058159 A1 (Klinger et al.), US 2015/0211070 A1 (Seligson et al.), US 2015/0374721 A1 (Njar et al.), US 2005/0214844 A1 (Moore et al.) and US 2015/0252426 A1 (Joseph et al.) as applied to claims 1-11 above, and further in view of US 6,300,060 B1 (Kantoff et al.) and US 2012/0283120 A1 (Watanabe et al.).
Response to argument
Applicant’s representative, at pages 5-7 of the response of 02 October 2025, hereinafter the response, asserts that by having amended claims so to reflect that barcodes have been added to cell-free RNA and DNA, the claimed method is no longer obvious. This argument has been considered and has not been found persuasive for as presented above, the aspect of adding a barcode to cell free RNA and to DNA was known in the art (Seligson et al.), as was the use of such modified nucleic acids in assays for cancer diagnosis.
In view of the above presentation and in the absence of convincing evidence to the contrary, the rejections are maintained.
Claim Rejections - 35 USC § 101, Judicial Exception
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Effective December 16, 2014, subject matter eligibility determinations under 35 U.S.C. § 101 follow the procedure explained in the Federal Register notice titled 2014 Interim Guidance on Patent Subject Matter Eligibility (79 FR 74618), which is found at: http://www.gpo.gov/fdsys/pkg/FR-2014-12-16/pdf/2014-29414.pdf. These guidelines were updated May 2, 2016, in the Federal Register notice titled May 2016 Subject Matter Eligibility Update, (81 FR 27381), which can be found at: https://www.gpo.gov/fdsys/pkg/FR-2016-05-06/pdf/2016-10724.pdf, and were further updated in the Federal Register notice titled 2019 Revised Patent Subject Matter Eligibility Guidance, (Federal Register, Vol. 84, No. 4, pp. 50-57), which can be found at: https://www.govinfo.gov/content/pkg/FR-2019-01-07/pdf/2018-28282.pdf. In a
Additionally, attention is directed to Gottschalk, Comr. Pats. v. Benson, et al. (US, 1972) 175 USPQ 673, 675:
The Court stated in MacKay Co. v. Radio Corp., 306 U.S. 86, 94, 40 USPQ 199, 202, that “While a scientific truth, or the mathematical expression of it, is not a patentable invention, a novel and useful structure created with the aid of knowledge of scientific truth may be.” That statement followed the long-standing rule that “An idea of itself is not patentable.” Rubber-Tip Pencil Co. v. Howard, 20 Wall. 498, 507. “A principle, in the abstract, is a fundamental truth; an original cause; a motive; and these cannot be patented, as no one can claim in either of them an exclusive right.” LeRoy v. Tatham, 14 How. 156, 175. Phenomena of nature, though just discovered, mental processes, abstract intellectual concepts are not patentable, as they are the basic tools of scientific and technological work. As we stated in Funk Bros. Seed Co. v. Kalo Co., 333 U.S. 127, 130, 76 USPQ 280, 281, “He who discovers a hitherto unknown phenomenon of nature has no claim to a monopoly of it which the law recognizes. If there is to be invention from such a discovery, it must come from the application of the law of nature to a new and useful end.” We dealt there with a “product” claim, while the present case deals only with a “process” claim. But we think the same principle applies. (Emphasis added)
Here the “process” claim is so abstract and sweeping as to cover both known and unknown uses of the BCD to pure-binary conversion. The end use may (1) vary from the operation of a train to verification of drivers’ licenses to researching the law books for precedents and (2) be performed through any existing machinery or future-devised machinery or without any apparatus. (Emphasis added)
Attention is also directed to the precedential decision in Ariosa Diagnostics, Inc., et al. v. Sequenom, Inc., et al. 115 USPQ2d 1152 (Fed. Cir. 2015):
In Mayo Collaborative Services v. Prometheus Laboratories, Inc., 566 U.S. ___, 132 S. Ct. 1289 (2012), the Supreme Court set forth a framework for distinguishing patents that claim laws of nature, natural phenomena, and abstract ideas from those that claim patent-eligible applications of those concepts. First, we determine whether the claims at issue are directed to a patent-ineligible concept. Id. at 1297. If the answer is yes, then we next consider the elements of each claim both individually and “as an ordered combination” to determine whether additional elements “transform the nature of the claim” into a patent-eligible application. Id. at 1298.
***
Mayo made clear that transformation into a patent-eligible application requires “more than simply stat[ing] the law of nature while adding the words ‘apply it.’” Id. At 1294. A claim that recites an abstract idea, law of nature, or natural phenomenon must include “additional features” to ensure “that the [claim] is more than a drafting effort designed to monopolize the [abstract idea, law of nature, or natural phenomenon].” Id. at 1297. For process claims that encompass natural phenomenon, the process steps are the additional features that must be new and useful. See Parker v. Flook, 437 U.S. 584, 591 (1978) (“The process itself, not merely the mathematical algorithm, must be new and useful.”). (Emphasis added)
***
Thus, in this case, appending routine, conventional steps to a natural phenomenon, specified at a high level of generality, is not enough to supply an inventive concept.
***
Sequenom and amici encourage us to draw distinctions among natural phenomena based on whether or not they will interfere significantly with innovation in other fields now or in the future. The Supreme Court cases, however, have not distinguished among different laws of nature or natural phenomenon according to whether or not the principles they embody are sufficiently narrow. See, e.g., Parker v. Flook, 437 U.S. 584 (1978) (holding narrow mathematical formula unpatentable). In Parker v. Flook, the Supreme Court stated the issue in the case as follows: “The question in this case is whether the identification of a limited category of useful, though conventional, post-solution applications of such a formula makes respondent’s method eligible for patent protection.” Id. at 585. The answer to that question was “no” because granting exclusive rights to the mathematical formula would be exempting it from any future use.
Claims 1-5 and 8-16 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
As noted in Sequenom:
First, we determine whether the claims at issue are directed to a patent-ineligible concept. Id. at 1297.
As seen in the Interim Guidelines, one asks the question
Is the claim to a process, machine, manufacture or composition of matter?
In the present case, the claims are drawn to a process. More specifically, the claims are drawn to “a method of detecting castration resistant prostate cancer in a subject”.
Next, in applying Step 2A, Prong 1, of the 2019 Revised Patent Subject Matter Eligibility Guidance (2019 PEG):
Does the claim recite an abstract idea, law of nature, or natural phenomenon?
In the present case, the claim(s) is/are directed to a natural phenomenon. As set forth in claim 1, the only independent claim pending, the claimed method is based on “a biofluid sample obtained or derived from the subject to determine a presence of an androgen receptor gene splice variant (AR-V) or AR gene mutation in the biofluid sample, wherein said biofluid sample comprises cell-free DNA molecules and cell-free RNA molecules”.
In applying Step 2A, Prong 2, of the 2019 PEG:
Does the claim recite additional elements that integrate the judicial exception into a practical application?
As noted above in Sequenom,
For process claims that encompass natural phenomenon, the process steps are the additional features that must be new and useful. See Parker v. Flook, 437 U.S. 584, 591 (1978) (“The process itself, not merely the mathematical algorithm, must be new and useful.”). (Emphasis added)
In the present case, the claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because step (a) of claim 1 and additional steps recited in dependent claims are well-known, routine and conventional (as demonstrated in the 103 rejection) and therefore do not add significantly more to the judicial exception.
In view of the above analysis and in the absence of convincing evidence to the contrary, claims 1-5 and 8-16 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-5 and 8-16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 6-9, 14, 15, 18-21, 24, 26, and 28 of U.S. Patent No. 11,174,503 B2 (Wang et al.) in view of US 2002/0119463 A1 (Faris et al.).
Claims 1-3, 6-9, 14, 15, 18-21, 24, 26, and 28 of Wang et al.:
1. A method for detecting a presence or an absence of a genetic alteration from a biofluid, the method comprising: (a) obtaining a mixture of nucleic acids comprising a single-stranded ribonucleic acid (ssRNA) and a double-stranded deoxyribonucleic acid (ds-DNA) from the biofluid; (b) reverse transcribing the ssRNA in the mixture, wherein the reverse transcribing comprises labeling the ssRNA with a first molecular barcode to produce a barcoded double-stranded complementary DNA (ds-cDNA), thereby obtaining a DNA mixture comprising the ds-DNA and the barcoded ds-cDNA; (c) labeling the DNA mixture comprising the ds-DNA and the barcoded ds-cDNA with a second molecular barcode; (d) sequencing the ds-DNA and the barcoded ds-cDNA or derivatives thereof to produce a plurality of sequence reads, wherein each of the plurality of sequence reads is associated with at least one of a first molecular barcode and a second molecular barcode; and (e) detecting the presence or the absence of the genetic alteration based at least in part on an analysis of the plurality of sequence reads and associated molecular barcodes.
2. The method of claim 1, wherein (b) further comprises annealing the ssRNA to an oligonucleotide comprising an RNA-specific tag and a molecular barcode from a set of molecular barcodes; reverse transcribing the ssRNA into a single-stranded cDNA; and converting the single-stranded cDNA into a ds-cDNA.
3. The method of claim 2, wherein converting the single-stranded cDNA into the ds-cDNA further comprises annealing with a second oligonucleotide comprising a second molecular barcode from a set of molecular barcodes.
4. The method of claim 1, wherein (d) further comprises sequencing the DNA mixture by Next Generation Sequencing.
5. The method of claim 1, wherein the genetic alteration is selected from the group consisting of a single nucleotide variant (SNV), a gene splice variant, a mutation, an insertion or deletion (indel), a long deletion, a copy number change, a fusion, and a combination thereof.
6. The method of claim 1, wherein the biofluid is selected from the group consisting of blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural fluid, nipple aspirates, lymph fluid, respiratory tract fluid, intestinal tract fluid, genitourinary tract fluid, tear fluid, saliva, breast milk, semen, intra-organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid, and a combination thereof.
7. The method of claim 1, wherein the biofluid is obtained or derived from a subject, and wherein the detected presence or absence of the genetic alteration is indicative of a presence or an absence of a disease of the subject.
8. The method of claim 7, wherein the disease comprises a cancer.
9. The method of claim 8, wherein the genetic alteration occurs in a cancer-associated gene.
14. The method of claim 1, wherein the biofluid is a cell-free sample.
15. The method of claim 1, wherein the labeling in (c) further comprises ligating the DNA mixture with adaptors comprising the second molecular barcode.
18. The method of claim 9, wherein the disease comprises prostate cancer, wherein the cancer-associated gene is associated with prostate cancer.
19. The method of claim 13, further comprising detecting a presence or an absence of an RNA genetic alteration from the plurality of RNA-derived sequence reads and a presence or an absence of a DNA genetic alteration from the plurality of DNA-derived sequence reads.
20. The method of claim 19, wherein the RNA genetic alteration comprises an androgen receptor gene RNA splice variant (AR-V).
21. The method of claim 1, further comprising amplifying the ds-DNA and the barcoded ds-cDNA or derivatives thereof.
22. The method of claim 1, further comprising enriching the ds-DNA and the barcoded ds-cDNA or derivatives thereof for a target gene.
24. The method of claim 6, wherein the biofluid comprises the plasma.
26. The method of claim 14, wherein the cell-free sample comprises cell-free DNA and cell-free RNA.
27. The method of claim 17, wherein analyzing the plurality of mapped sequence reads to produce the set of consensus sequences is based at least in part on mapping locations of the plurality of mapped sequence reads.
28. The method of claim 17, wherein analyzing the plurality of mapped sequence reads to produce the set of consensus sequences comprises suppressing errors derived from sequencing or polymerase chain reaction (PCR).
Wang et al., in column 9, “Example 6”, teach:
This example partly illustrates one embodiment of the disclosed method of detecting AR-V7 and AR-FL in castration-resistant prostate cancer patients.
Wang et al., has not been found to claim analyzing the “complementary DNA” (cDNA) via array-based technology.
Faris et al., in paragraph [0058], teach:
[0058] The cDNAs may be used for a variety of purposes. For example, the composition of the invention may be used on an array. The array, in turn, can be used in high-throughput methods for detecting a related polynucleotide in a sample, screening a plurality of molecules or compounds to identify a ligand, diagnosing prostate cancer, or inhibiting or inactivating a therapeutically relevant gene related to the cDNA. (Emphasis added)
In view of the above showing and in the absence of convincing evidence to the contrary, claims 1-5 and 8-16 are deemed to be obvious over claims 1-3, 6-9, 14, 15, 18-21, 24, 26, and 28 of U.S. Patent No. 11,174,503 B2 (Wang et al.) in view of US 2002/0119463 A1 (Faris et al.).
Claims 1-5 and 8-16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11,702,702 B2 (Jia et al.). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘702 patent fairly encompass the detection of castration resistant prostate cancer. In support of this position, claims 1-20 are reproduced below.
1. A method for detecting a presence or an absence of a genetic alteration from a biofluid sample from a subject, the method comprising: (a) obtaining nucleic acids from the biofluid sample; (b) separating the nucleic acids into at least a first portion comprising single-stranded ribonucleic acid (ssRNA) molecules and a second portion comprising double-stranded deoxyribonucleic acid (dsDNA) molecules; (c) barcoding the ssRNA molecules with a molecular barcode that is unique to each single ssRNA molecule of the ssRNA molecules; (d) converting the barcoded ssRNA molecules to barcoded dsDNA molecules; (e) mixing the barcoded dsDNA molecules and the dsDNA molecules to produce a nucleic acid mixture; (f) sequencing the nucleic acid mixture or derivatives thereof to produce a plurality of sequence reads comprising cell-free RNA (cfRNA)-derived sequence reads from the barcoded dsDNA molecules and cell-free DNA (cfDNA)-derived sequence reads from the dsDNA molecules, wherein each of the cfRNA-derived sequence reads is associated with a molecular barcode; (g) aligning the plurality of sequence reads to a reference genome to produce a plurality of aligned sequence reads comprising cfRNA-derived aligned sequence reads and cfDNA-derived aligned sequence reads; and (h) detecting the presence or the absence of the genetic alteration based at least in part on an analysis of the plurality of aligned sequence reads and associated molecular barcodes, wherein the detecting comprises using molecular barcodes to distinguish between cfRNA-derived aligned sequence reads and cfDNA-derived aligned sequence reads.
2. The method of claim 1, wherein the barcoded ssRNA molecules are converted to the barcoded dsDNA molecules at least in part by reverse transcribing the barcoded ssRNA molecules to dsDNA after the barcoded ssRNA molecules are ligated to one or more oligonucleotides.
3. The method of claim 1, wherein the genetic alteration is selected from the group consisting of a gene splice variant, a mutation, an insertion or deletion (indel), a copy number change, a fusion, and a combination thereof.
4. The method of claim 1, wherein the biofluid sample is selected from the group consisting of a blood sample, a plasma sample, a serum sample, a urine sample, a sputum sample, a spinal fluid sample, a cerebrospinal fluid sample, a pleural fluid sample, a nipple aspirate sample, a lymph fluid sample, a fluid sample of the respiratory, intestinal, or genitourinary tracts, a tear sample, a saliva sample, a breast milk sample, a fluid sample from a lymphatic system, a semen sample, an intra-organ system fluid sample, an ascitic fluid sample, a tumor cyst fluid sample, an amniotic fluid sample, and a combination thereof.
5. The method of claim 4, wherein the biofluid sample is the plasma sample.
6. The method of claim 4, wherein the biofluid sample is the plasma sample or the urine sample.
7. The method of claim 6, wherein the biofluid sample is the plasma sample.
8. The method of claim 6, wherein the biofluid sample is the urine sample.
9. The method of claim 1, further comprising detecting a presence or an absence of a disease in the subject, based at least in part on the detected presence or absence of the genetic alteration.
10. The method of claim 1, wherein the disease is cancer.
11. The method of claim 10, wherein the cancer is prostate cancer.
12. The method of claim 11, wherein the prostate cancer is castration resistant prostate cancer.
13. The method of claim 1, wherein the genetic alteration occurs in an androgen receptor gene.
14. The method of claim 13, wherein the genetic alteration is an androgen receptor gene splice variant (AR-V) or an androgen receptor (AR) gene mutation.
15. The method of claim 14, wherein the genetic alteration is the AR-V.
16. The method of claim 15, wherein the AR-V is selected from the group consisting of AR-V1, AR-V2, AR-V7, AR-V9, and AR-V567es.
17. The method of claim 14, wherein the genetic alteration is the AR gene mutation.
18. The method of claim 17, wherein the AR gene mutation is selected from the group consisting of AR-FL, AR-T878A, and AR-F876L.
19. The method of claim 1, wherein the converting further comprises extracting RNA molecules from the first portion, and reverse transcribing the extracted RNA molecules to produce complementary DNA molecules.
20. The method of claim 1, wherein obtaining the nucleic acids further comprises extracting both DNA molecules and RNA molecules from the biofluid sample simultaneously, and reverse transcribing the extracted RNA molecules to produce complementary DNA molecules.
As evidenced above, claims 1-20 of the ‘702 patent are fairly directed to the detection of a vairy of cancers, including prostate cancer where there is a mutation in the AR-V or AR gene.
In view of the above presentation and in the absence of convincing evidence to the contrary, claims 1-5 and 8-16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11,702,702 B2 (Jia et al.).
Conclusion
Objections and/or rejections which appeared in the prior Office action and which have not been repeated hereinabove have been withdrawn.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Bradley L. Sisson whose telephone number is (571)272-0751. The examiner can normally be reached Monday to Thursday, from 6:30 AM to 5 PM..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Shen can be reached at 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Bradley L. Sisson/Primary Examiner, Art Unit 1682