Prosecution Insights
Last updated: April 19, 2026
Application No. 18/220,070

PREVENTION OR TREATMENT OF WASTING SYNDROME

Non-Final OA §103§112
Filed
Jul 10, 2023
Examiner
GROOMS, TIFFANY NICOLE
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
City Of Hope
OA Round
1 (Non-Final)
58%
Grant Probability
Moderate
1-2
OA Rounds
3y 2m
To Grant
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allow Rate
100 granted / 171 resolved
-1.5% vs TC avg
Strong +46% interview lift
Without
With
+45.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
41 currently pending
Career history
212
Total Applications
across all art units

Statute-Specific Performance

§101
3.7%
-36.3% vs TC avg
§103
38.1%
-1.9% vs TC avg
§102
12.5%
-27.5% vs TC avg
§112
26.4%
-13.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 171 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of the species Short-hairpin RNA of SEQ ID NO:8 as the KIAA0930 inhibitor, cancer cachexia as the wasting syndrome and pancreatic cancer as the cancer in the reply filed on 15 December 2025 is acknowledged. Claims 4-7, 10-11, and 18-19 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. The search and examination has extended to species of an antisense oligonucleotide. Claims 1-3, 8-9, 12-17 and 20 are under examination on the merits. Priority The application claims priority to application 63/388,147 filed 07/11/2022. Specification The disclosure is objected to because of the following informalities: Paragraph 0009 recites GapmeR 1-2 in line 2 for Figs. 2A-2J; however, there is a previous recitation of GapmeR 1-3 and Figs. 2A-2J show the use of 3 GapmeRs. Appropriate correction is required. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code in 0244. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the terms American Type Culture Collection, Japanese Collection of Research Bioresources Cell Bank, ScienCell, Thermo Fisher Scientific, ATCC, MP Biomedicals, Irvine Scientific, Horizon Discovery, QIAGEN, IDT Integrated DNA Technologies, Lipofectamine 3000, Biosettia, Addgene, Applied Biological Materials, Inc., Direct-zol, Zymo Research, PrimeScript RT, TaKaRa Bio Inc, Bio-Rad, CFX96 real-time PCR Detection System, Cell Signaling Technology, EMD Millipore, Immobilon-FL, Odyssey blocking buffer, LI-COR, ChemiDoc MP, Novus Biologicals, Alexa Fluor 647, Abcam, R&D Systems, Zeiss Observer Z1, ZEISS, ZEN Imaging Software, Image Pro Premier, and Media Cybernetics, to name a few, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. A cursory review of the specification has revealed these trade names or marks. It would be remedial to identify and amend all trade names or marks in the specification upon amendment. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-3, 8-9, 12-15are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”. For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. “Satisfactory disclosure of a "representative number" depends on whether one of skill in the art would recognize that the inventor was in possession of the necessary common attributes or features possessed by the members of the genus in view of the species disclosed. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are "representative of the full variety or scope of the genus," or by the establishment of "a reasonable structure-function correlation." Such correlations may be established "by the inventor as described in the specification," or they may be "known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014).” Claim 1 is directed to a “method of preventing or treating a wasting syndrome in a subject in need thereof, the method comprising administering to the subject an effective amount of a KIAA0930 inhibitor”. Possession of these claims requires the possession of any wasting syndrome capable being prevented or treating with a KIAA0930 inhibitors. Additionally, possession of these claims require the possession of all KIAA0930 inhibitors capable of preventing or treating a wasting syndrome. The current specification, as filed, discloses that the wasting syndrome is associated with cancer cachexia and wasting syndromes include, but are not limited to, weight loss, fat loss, muscle atrophy, anorexia, asthenia, and anemia [0004]. The specification does not disclose any other type of wasting syndrome. The current specification, as filed, discloses that the KIAA0930 inhibitor can be a short-hairpin RNA (shRNA), a small interference RNA (siRNA), a piwi-interacting RNA (piRNA), a microRNA (miRNA), an antisense oligonucleotide such as a GapmeR or a morpholinooligonucleotide, a CRISPR Cas guide RNA (gRNA), or a small molecule compound [0005]. The specification does not disclose any other structure that is capable of functioning as a KIAA0930 inhibitor or any other KIAA0930 inhibitor that is capable of preventing or treating a wasting syndrome. Furthermore, the specification only teaches that an siRNA against KIAA0930 ameliorate muscular atrophy [0018, 0256; Figs. 10-11]. Regarding wasting syndromes, Burckart (Burckart et al. Curr Opin Clin Nutr Metab Care. 2010 July ; 13(4): 410–416) teaches that muscle atrophy occurs when the balance shifts to an increase in muscle protein breakdown, a decrease in muscle protein synthesis, or both; whereas cancer cachexia likely involves both sides of the metabolic equation [pg. 3, para 2], thereby teaching where muscle atrophy is a component of cachexia, but not all atrophy is cachectic. Wohlwend (US 2024/0335505 A1. PCT filed 2/10/2022) teaches that Cachexia, also known as "wasting syndrome" is a complex syndrome associated with an underlying illness that causes ongoing muscle loss that is not entirely reversed with nutritional supplementation; numerous diseases can cause cachexia, including cancer, congestive heart failure (CHF), chronic obstructive pulmonary disease (COPD), chronic kidney disease and AIDS; and in some embodiments, cachexia is cancer cachexia, CHF cachexia, COPD cachexia, chronic kidney disease cachexia or AIDS cachexia [0201]. Regarding genetic inhibitors of protein expression, Smith (Smith et al. PLoS Biol. 2017 Nov 30;15(11):e200321) analyses types of genetic perturbations, RNAi and CRISPR, in which both are used to generate loss-of-function [author summary]. Smith teaches that the off-target effects of RNAi are much greater than typically appreciated, whereas CRISPR technology has negligible off-target activity [author summary]. Smith further teaches that that the RNAi machinery includes the use of either siRNAs or shRNAs [pg. 2, para 3]. Sibley (Sibley et al. www.moleculartherapy.org vol. 18 no. 3, 466–476. 2010) teaches exogenous gene-silencing strategies (RNAi) [pg. 468-469] and new generation of RNA-based silencing approaches [Table 1]. Sibley teaches off-target effects, toxicity due to saturation of the endogenous RNAi functions, limited duration of silencing, and effective targeted delivery are still concerns as it relates to RNAi technology [abstract]. Lavorgna (Lavorgna et al. Pharmacological Research 110 (2016) 131–138) teaches strategies for targeting long ncRNAs which includes the use of RNAi (siRNA) technology, antisense oligonucleotides (AONs) [pg. 134, 3], zinc finger nuclease (ZFN), transcription activation-like element nuclease (TALEN) and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system [pg. 135, 3.3]. Segara (US 2006/0269921 A1) teaches that ribozymes can also be used to inhibit transcription of nucleic acid sequences [0627]. Furthermore, inhibitors of KIAA0930 were likely not taught in the art in view of Yamakawa (Yamakawa et al. Oncotarget, 2023, Vol. 14, pp: 723-737) and Ji (Ji, Xuemei, et al. Nature communications 11.1 (2020): 2220) teaching that KIAA0930 gene transcript was uncharacterized [abstracts]. Therefore considering the large variation of wasting syndromes and gene inhibitors that lead to protein loss of function; the failure of the specification to describe all wasting syndromes and all possible KIAA0930 inhibitors or a common structure of the inhibitors; the failure of the specification to describe or provide predictability for preventing or treating all wasting syndromes using each KIAA0930 inhibitor; and the lack of predictability provided by the art for the full scope of the claimed genus, it is reasonable to conclude that Applicant did not possess the invention as claimed at the time of filing. The additional dependent claims do not further limit the genus of syndromes or inhibitor so as to resolve the issues above, and are therefore not sufficiently described for at least the reasons above. Claims 1-3, 8-9, 12-14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method treating a muscle atrophy in a subject in need thereof, the method comprising administering to the subject an effective amount of a KIAA0930 inhibitor, wherein the KIAA0930 inhibitor is a small interference RNA, does not reasonably provide enablement for a method of preventing or treating any wasting syndrome in a subject in need thereof, the method comprising administering to the subject an effective amount of any KIAA0930 inhibitor. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. • Nature of the Invention The claims are directed to “a method of preventing or treating a wasting syndrome in a subject in need thereof, the method comprising administering to the subject an effective amount of a KIAA0930 inhibitor”. Enablement of the claims turns on whether one of ordinary skill in the art could prevent or treat any wasting syndrome using any KIAA0930 inhibitors without undue experimentation. • State of the Art Regarding wasting syndromes, Burckart (Burckart et al. Curr Opin Clin Nutr Metab Care. 2010 July ; 13(4): 410–416) teaches that muscle atrophy occurs when the balance shifts to an increase in muscle protein breakdown, a decrease in muscle protein synthesis, or both; whereas cancer cachexia likely involves both sides of the metabolic equation [pg. 3, para 2], thereby teaching where muscle atrophy is a component of cachexia, but not all atrophy is cachectic. Wohlwend (US 2024/0335505 A1. PCT filed 2/10/2022) teaches that Cachexia, also known as "wasting syndrome" is a complex syndrome associated with an underlying illness that causes ongoing muscle loss that is not entirely reversed with nutritional supplementation; numerous diseases can cause cachexia, including cancer, congestive heart failure (CHF), chronic obstructive pulmonary disease (COPD), chronic kidney disease and AIDS; and in some embodiments, cachexia is cancer cachexia, CHF cachexia, COPD cachexia, chronic kidney disease cachexia or AIDS cachexia [0201]. Regarding genetic inhibitors of protein expression, Smith (Smith et al. PLoS Biol. 2017 Nov 30;15(11):e200321) analyses types of genetic perturbations, RNAi and CRISPR, in which both are used to generate loss-of-function [author summary]. Smith teaches that the off-target effects of RNAi are much greater than typically appreciated, whereas CRISPR technology has negligible off-target activity [author summary]. Smith further teaches that that the RNAi machinery includes the use of either siRNAs or shRNAs [pg. 2, para 3]. Sibley (Sibley et al. www.moleculartherapy.org vol. 18 no. 3, 466–476. 2010) teaches exogenous gene-silencing strategies (RNAi) [pg. 468-469] and new generation of RNA-based silencing approaches [Table 1]. Sibley teaches off-target effects, toxicity due to saturation of the endogenous RNAi functions, limited duration of silencing, and effective targeted delivery are still concerns as it relates to RNAi technology [abstract]. Lavorgna (Lavorgna et al. Pharmacological Research 110 (2016) 131–138) teaches strategies for targeting long ncRNAs which includes the use of RNAi (siRNA) technology, antisense oligonucleotides (AONs) [pg. 134, 3], zinc finger nuclease (ZFN), transcription activation-like element nuclease (TALEN) and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system [pg. 135, 3.3]. Segara (US 2006/0269921 A1) teaches that ribozymes can also be used to inhibit transcription of nucleic acid sequences [0627]. • Breadth of the claims The claims of the instant specification recite “A method of preventing or treating a wasting syndrome in a subject in need thereof, the method comprising administering to the subject an effective amount of a KIAA0930 inhibitor”. This recitation broadly encompass any wasting syndrome and any KIAA0930. • Guidance of the Specification The specification discloses that the wasting syndrome is associated with cancer cachexia and wasting syndromes include, but are not limited to, weight loss, fat loss, muscle atrophy, anorexia, asthenia, and anemia [0004]. The specification does not disclose any other type of wasting syndrome. The specification discloses that the KIAA0930 inhibitor is a short-hairpin RNA (shRNA), a small interference RNA (siRNA), a piwi-interacting RNA (piRNA), a microRNA (miRNA), an antisense oligonucleotide such as a GapmeR or a morpholinooligonucleotide, a CRISPR Cas guide RNA (gRNA), or a small molecule compound [0005]. The specification does not disclose any other structure that is capable of functioning as a KIAA0930 inhibitor or any other KIAA0930 inhibitor that is capable of preventing or treating a wasting syndrome. Furthermore, the specification only teaches that an siRNA against KIAA0930 prevented the reduction of muscular atrophy [0256; Fig. 11]. • Experimentation Required In order to practice the claimed invention, an immense amount of experimentation would be required. To practice the invention as broadly claimed, it would be necessary for one of ordinary skill in the art to systematically test every inhibitor and nucleotide against every wasting syndrome known to determine if each inhibitor or nucleotide is capable of preventing all wasting syndromes. However, such experimentation would be highly unpredictable in view of the prior art which teaches gene targeting strategies could pose potential issues. Accordingly, practicing the invention as broadly claimed would require a massive amount of highly unpredictable experimentation. Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that an undue experimentation would be required to make and use the invention as claimed. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.\ Claims 15-16 are rejected under 35 U.S.C. 103 as being unpatentable over Segara (US 2006/0269921 A1). Segara teach novel genes and proteins for diagnosing pancreatic cancer [abstract]. Segara teaches that KIAA0930 is a protein that is upregulated in pancreatic cancer [Table 3]. Segara teach that the pancreatic cancer-associated proteins can be down-regulated, or entirely inhibited, by the use of antisense polynucleotides, i.e., a nucleic acid complementary to, and which can preferably hybridize specifically to, a coding mRNA nucleic acid sequence, e.g., a pancreatic cancer-associated protein mRNA, or a subsequence thereof [0623]. Segara teach that binding of the antisense polynucleotide to the mRNA reduces the translation and/or stability of the mRNA [0623]. Segara teaches a method of inhibiting pancreatic cancer cell division comprises administration of a pancreatic cancer inhibitor where the pancreatic cancer inhibitor is an antisense molecule [0666-0667]. Segara teaches that therapeutic reagents, such as proteins or nucleic acids, of the invention are administered to patients, therapeutically and such compositions are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition (which are for human or animal use) [0679]. It would have been obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to formulate an antisense oligonucleotide against KIAA0930 into a pharmaceutical composition comprising a pharmaceutically acceptable carrier for the advantage of using it in a method of inhibiting pancreatic cancer cell division. One of ordinary skill would be motivated to try this formulation given Segara’s disclosure that KIAA0930 is a protein that is upregulated in pancreatic cancer. Claims 17 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Segara (US 2006/0269921 A1), as applied to claims 15-16 and further in view of Smith (Smith et al. PLoS Biol. 2017 Nov 30;15(11):e200321), Wang (Wang and Wang; Mouldy Sioud (ed.), RNA Interference: Challenges and Therapeutic Opportunities, Methods in Molecular Biology, vol. 1218, DOI 10.1007/978-1-4939-1538-5_3; 2015], and GenBank: LT739240.1 (Human ORFeome Gateway entry vector pENTR223-KIAA0930, complete sequence; 2017). The teaching of Segara are discussed above as applied to claims 15-16 and similarly apply to claims 17 and 20. Segarra do not teach where the KIAA0930 inhibitor is a short-hairpin RNA having at least 90% sequence identity to a nucleic acid sequence of comprising SEQ ID NO:8. Smith (Smith et al. PLoS Biol. 2017 Nov 30;15(11):e200321) analyses types of genetic perturbations, RNAi and CRISPR, in which both are used to generate protein loss-of-function [author summary]. Smith teaches that that the RNAi machinery includes the use of either siRNAs or shRNAs [pg. 2, para 3]. Wang teaches a cost-effective method for shRNA design and expression which uses a carefully selected shRNA loop sequence and an antisense-loop-sense stem structure [abstract; Fig. 1]. Wang teaches that a shRNA can be designed with the loop sequence “TTGGATCCAA” and have a sense-loop-antisense shRNA structure [pg. 40, see Notes #2]. GenBank: LT739240.1 teaches that GACATTCACATCCATAAGAAG and CTTCTTATGGATGTGAATGTC are sense and antisense sequences ,respectively, of the human KIAA0930 sequence from nucleotides 770-790. It would have been obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to use a shRNA as the KIAA0930 inhibitor instead of an antisense oligonucleotide against KIAA0930. This modification would amount to a simple substitution of one known gene silencing molecule for another. Additionally, it would have been obvious to use the teaching of Wand and GenBank: LT739240.1 to generate the shRNA of SEQ ID NO: 8 since Wang lays out the framework for shRNA design to include selective criteria and GenBank: LT739240.1 teaches the sequenced of the KIAA0930 from which the shRNA design should be based upon. One of ordinary skill would be motivated to use these teachings as they teach the sense-loop-antisense sequences needed for shRNA generation of a KIAA0930 inhibitor. Allowable Subject Matter The following is a statement of reasons for the indication of allowable subject matter: The closest prior art is Segara as discussed above. Segara nor the prior art provides a reasonable rationale to use a KIAA0930 inhibitor in a method of preventing or treating a wasting syndrome. Moreover, Ji (Ji et al. Nature Communications; (2020) 11:2220; https://doi.org/10.1038/s41467-020-15905-6) teaches that KIAA0930 is an uncharacterized protein and its function has not been fully investigated [pg. 10, col. 1, para 1]. Ji does teach that the KIAA0930 gene is expressed in normal lung; KIAA0930 expression is significantly upregulated in lung cancer and other carcinomas developing from epithelial cells, suggesting KIAA0930 might play a role in the development of those carcinomas; and KIAA0930 expression significantly affects survival in patients with carcinomas such as liver, renal or endometrial cancer [pg. 10, col. 1, para 1]. However, neither of these teachings links KIAA0930 to a wasting syndrome. Conclusion No claims allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIFFANY N GROOMS whose telephone number is (571)272-3771. The examiner can normally be reached M-F 830-530. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TIFFANY NICOLE GROOMS/Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Jul 10, 2023
Application Filed
Feb 07, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12577574
ULTRASPECIFIC RIBOREGULATORS HAVING ROBUST SINGLE-NUCLEOTIDE SPECIFICITY AND IN VITRO AND IN VIVO USES THEREOF
2y 5m to grant Granted Mar 17, 2026
Patent 12570966
MUTATED PIGGYBAC TRANSPOSASE
2y 5m to grant Granted Mar 10, 2026
Patent 12565666
METHODS AND COMPOSITIONS FOR MODULATING A GENOME
2y 5m to grant Granted Mar 03, 2026
Patent 12553038
DELIVERY OF THERAPEUTICS IN VIVO VIA A CRISPR-BASED CASCADE SYSTEM
2y 5m to grant Granted Feb 17, 2026
Patent 12544458
PAH-MODULATING COMPOSITIONS AND METHODS
2y 5m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+45.8%)
3y 2m
Median Time to Grant
Low
PTA Risk
Based on 171 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month