DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s election without traverse of the species Short-hairpin RNA of SEQ ID NO:8 as the KIAA0930 inhibitor, cancer cachexia as the wasting syndrome and pancreatic cancer as the cancer in the reply filed on 15 December 2025 is acknowledged.
Claims 1-20 are cancelled. Claims 21-40 are newly added.
Claim 21 is allowable. The restriction requirement of between species of inhibitors, as set forth in the Office action mailed on 10/20/2026, has been reconsidered in view of the allowability of claims to the elected invention pursuant to MPEP § 821.04(a). The restriction requirement is hereby withdrawn as to any claim that requires all the limitations of an allowable claim. Specifically, the restriction requirement of 10/20/2025 is partially withdrawn. Claim 24-26 and 30, directed to a method for treating cancer cachexia or muscle atrophy in a subject is no longer withdrawn from consideration because the claim(s) requires all the limitations of an allowable claim. However, claim 33-33 and 38-40, directed to pharmaceutical composition comprising a KIAA0930 inhibitor is withdrawn from consideration because they do not all require all the limitations of an allowable claim.
In view of the above noted withdrawal of the restriction requirement, applicant is advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application.
Once a restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01.
Claims 33-36 and 39-40 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected [ 2 ], there being no allowable generic or linking claim. Claims 21-32, and 37-38 are under examination on the merits.
Any rejection or objection not reiterated herein has been overcome by applicant’s claim amendments.
Priority
The application claims priority to application 63/388,147 filed 07/11/2022.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.\
Claims 32, 37-38 are rejected under 35 U.S.C. 103 as being unpatentable over Segara (US 2006/0269921 A1), as applied to claims 15-16 and further in view of Smith (Smith et al. PLoS Biol. 2017 Nov 30;15(11):e200321), Wang (Wang and Wang; Mouldy Sioud (ed.), RNA Interference: Challenges and Therapeutic Opportunities, Methods in Molecular Biology, vol. 1218, DOI 10.1007/978-1-4939-1538-5_3; 2015], and GenBank: LT739240.1 (Human ORFeome Gateway entry vector pENTR223-KIAA0930, complete sequence; 2017). This is a new rejection necessitated by applicants claim amendments.
Segara teach novel genes and proteins for diagnosing pancreatic cancer [abstract]. Segara teaches that KIAA0930 is a protein that is upregulated in pancreatic cancer [Table 3]. Segara teach that the pancreatic cancer-associated proteins can be down-regulated, or entirely inhibited, by the use of antisense polynucleotides, i.e., a nucleic acid complementary to, and which can preferably hybridize specifically to, a coding mRNA nucleic acid sequence, e.g., a pancreatic cancer-associated protein mRNA, or a subsequence thereof [0623]. Segara teach that binding of the antisense polynucleotide to the mRNA reduces the translation and/or stability of the mRNA [0623]. Segara teaches a method of inhibiting pancreatic cancer cell division comprises administration of a pancreatic cancer inhibitor where the pancreatic cancer inhibitor is an antisense molecule [0666-0667]. Segara teaches that therapeutic reagents, such as proteins or nucleic acids, of the invention are administered to patients, therapeutically and such compositions are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition (which are for human or animal use) [0679].
Segarra do not teach where the KIAA0930 inhibitor is a short-hairpin RNA having a nucleic acid sequence of comprising SEQ ID NO:8.
Smith (Smith et al. PLoS Biol. 2017 Nov 30;15(11):e200321) analyses types of genetic perturbations, RNAi and CRISPR, in which both are used to generate protein loss-of-function [author summary]. Smith teaches that that the RNAi machinery includes the use of either siRNAs or shRNAs [pg. 2, para 3].
Wang teaches a cost-effective method for shRNA design and expression which uses a carefully selected shRNA loop sequence and an antisense-loop-sense stem structure [abstract; Fig. 1]. Wang teaches that a shRNA can be designed with the loop sequence “TTGGATCCAA” and have a sense-loop-antisense shRNA structure [pg. 40, see Notes #2].
GenBank: LT739240.1 teaches that GACATTCACATCCATAAGAAG and CTTCTTATGGATGTGAATGTC are sense and antisense sequences ,respectively, of the human KIAA0930 sequence from nucleotides 770-790.
It would have been obvious to one ordinary skilled in the art before the effective filing date of the claimed invention to use a shRNA as the KIAA0930 inhibitor instead of an antisense oligonucleotide against KIAA0930. One of ordinary skill would recognize shRNA as an alternative, well established sequence-specific inhibitory modality. Additionally, it would have been obvious to use the teaching of Wand and GenBank: LT739240.1 to generate the shRNA of SEQ ID NO: 8 since Smith and Wang lay out the framework for shRNA design to include selective criteria, and its use for conventional and predictable approach for suppression expression of selected genes; and GenBank: LT739240.1 teaches the sequenced of the KIAA0930 from which the shRNA design should be based upon. One of ordinary skill would be motivated to use these teachings as they teach the sense-loop-antisense sequences needed for shRNA generation of a KIAA0930 inhibitor.
Response to Arguments
Applicant's arguments filed 05/18/2026 have been fully considered but they are not persuasive.
Applicant argues that Segara merely provides a list of approximately 375 genes exhibiting altered expression in pancreatic cancer and does not teach or suggest that pancreatic cancer could be treated by downregulating KIAA0930.
Segara does not merely disclose a list of differentially expressed genes. Rather, Segara expressly teaches that the identified pancreatic cancer-associated genes are useful in diagnostic, prognostic, and therapeutic applications and further teaches methods of therapy in which the activity of proteins encoded by the identified genes is modulated. Segara additionally teaches inhibition of expression of pancreatic cancer-associated genes using sequence-specific nucleic acid inhibitors, including antisense polynucleotides directed to the target mRNA, and teaches pharmaceutical compositions suitable for therapeutic administration.
Applicant’s argument that KIAA0930 exhibits only a 3.3-fold increase in expression compared with genes exhibiting higher fold-changes is likewise unpersuasive. Obviousness does not require that the prior art identify the claimed target as the most highly expressed or preferred gene. Segara specifically identifies KIAA0930 as one of the pancreatic cancer-associated genes discovered by its expression profiling analysis. The disclosure of additional differentially expressed genes does not diminish the express disclosure of KIAA0930 or remove it from the teachings of the reference. The question under 35 U.S.C. §103 is not whether KIAA0930 was the most highly upregulated gene, but whether one of ordinary skill in the art would have found it obvious to employ a known gene-silencing technology to inhibit expression of a specifically disclosed cancer-associated gene.
Applicant further argues that there would have been no reason to prepare a pharmaceutical composition comprising a short-hairpin RNA directed against KIAA0930. However, Smith teaches that RNA interference, including short-hairpin RNA, was a conventional and predictable technology for generating gene-specific loss-of-function of selected mammalian genes, while Wang teaches established methods for designing effective shRNA molecules against selected target transcripts. GenBank accession LT739240.1 provides the nucleotide sequence of human KIAA0930 from which an shRNA target sequence may be selected. Accordingly, once KIAA0930 was identified by Segara as a pancreatic cancer-associated gene appropriate for therapeutic modulation, one of ordinary skill in the art would have found it obvious to employ the well-established shRNA design methodologies taught by Smith and Wang using the published KIAA0930 nucleotide sequence provided by GenBank to prepare an shRNA directed against KIAA0930.
Applicant’s hindsight argument is also not persuasive. The rejection does not rely upon Applicant’s discovery that inhibition of KIAA0930 treats cancer cachexia or muscle atrophy. Rather, the rejection is directed to claims reciting a pharmaceutical composition comprising a KIAA0930 inhibitor, and is based upon Segara’s identification of KIAA0930 as a pancreatic cancer-associated gene appropriate for therapeutic modulation together with the well-known and predictable use of shRNA technology for producing gene-specific loss-of-function reagents. The combination therefore represents the application of known gene-silencing techniques to a specifically identified cancer-associated gene using routine methods known in the art.
Allowable Subject Matter
The following is a statement of reasons for the indication of allowable subject matter: The closest prior art is Segara as discussed above. Segara nor the prior art provides a reasonable rationale to use a KIAA0930 inhibitor in a method of treating cancer cachexia or muscle atrophy.
Conclusion
Claims 21-31 are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIFFANY N GROOMS whose telephone number is (571)272-3771. The examiner can normally be reached M-F 830-530.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIFFANY NICOLE GROOMS/Examiner, Art Unit 1637
Prosecution Insights