Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
1. Applicant’s submission of declaration under 37 CFR § 1.132 in the reply filed on 9/22/2025 is acknowledged.
Claims 16-20 and 23 are withdrawn for being drawn to non-elected invention.
Claims 1-11, 13-15 and 22 are examined on the merits.
2. The rejections and objections not recited in this action are withdrawn.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
3. Claim(s) 1-11, 13-15 and 22 remain rejected under 35 U.S.C. 103 as being unpatentable over Maltzahn et al. (US Patent Application Publication No. 2015/0020239) further in view of Amiet-Charpentier et al. (1998 Journal of Microencapsulation 15:639-659).
Claim 1-11, 13-15 and 22 are drawn to a seed or seedling having disposed on an exterior surface of the seed or seedling a formulation comprising microencapsulated particles comprising an endophytic bacterial population consisting essentially of an endophytic bacterium comprising a 16S rRNA nucleotide sequence at least 99% identical to SEQ ID NO: 7 wherein the exogenous endophytic bacterial population is disposed on an exterior surface in an amount effective to colonize the plant; or wherein the formulation further comprises a agriculturally compatible carrier; or wherein the exogenous endophytic bacterial population is disposed on an exterior surface in an amount effective to be detected within leaf tissue of the mature agricultural plant; or wherein at least about 100 CFU per gram fresh weight of the target tissue/ exterior surface/mature agricultural plant; or wherein the plant is a monocot or dicot or corn plan; or wherein the endophytic bacteria population is applied in an amount effective to increase fruit or grain biomass of yield of a resulting by 10% compared with a reference agricultural plant grown; or wherein the endophytic bacteria population is applied in an amount effective to increase rate of seed germination compared with a reference agricultural plant; or wherein the endophytic bacteria population is applied in an amount effective to induce production of auxin compared with a reference agricultural plant; or wherein the seed is corn seed and formulation further comprises at least about 10000 CFU of the exogenous endophytic bacteria population consisting essentially of an endophytic bacterium comprising a 16S rRNA at least 99% identical to SEQ ID NO:7 disposed on the exterior surface and the formulation comprising a microbial stabilizer.
Maltzahn et al. teach endophyte Bacillus simplex (Table 1, page 20, with accession No. HQ432812). Maltzahn et al. teach endophyte listed in Table 2 can be used for seed or seedling treatment (paragraph [0046]). Maltzahn et al. teach a method for preparing an agricultural seed preparation comprising contacting the surface of cereal agricultural plant seed with a formulation about 100 CFU/g, the seed bacterial endophyte exhibiting the ability to induce auxin production; and wherein the seed bacterial endophyte is able to provide benefit to the plant seed or the resulting plant and packaging further seeds in a container (paragraph [0291])). Maltzahn et al. teach that endophyte is disposed on seed or seedling in an effective amount to be detectable within a target tissue such as seed or leaf, in amount of at least about 100CFU (paragraph [0211]). Maltzahn et al. seed treatment was performed using maize seed [paragraph [0062]. Maltzahn et al. teach agricultural plant can be dicot or monocot plant (paragragh [0074]). Maltzahn et al. teach overall biomass or grain biomass increased by at least 10% (paragragh [0254]). Maltzahn et al. teach endophyte is disposed on the surface or within the seed in an amount effective to increase the rate of seed germination (paragragh [0202]). Maltzahn et al. teach formulation contain at least 10,000 CFU (paragraph [0291]). Maltzahn et al. teach population is packaged in a container containing a label; or the container comprises at least 1000 of said seed or seedling (paragraph [0292]).
Claims 1-11, 3-15 and 22 require limitation(s) that which has/have a property or characteristic of that an endophytic bacterium comprises a 16S rRNA nucleotide sequence at least 99% identical to SEQ ID NO: 7. Maltzahn et al teach limitations endophyte Bacillus simplex (Table 1, page 20, with accession No. HQ432812) but does not mention the characteristic or property of 16S rRNA nucleotide sequence being at least 99% identical to SEQ ID NO: 7 as claimed since accession No. HQ432812 teaches partially sequence of 16S rRNA. The examiner is unable to determine whether the prior art disclosure possesses the unrecited characteristics or property. However, as shown in sequence alignment below, HQ432812 only contains 2 mismatches with instant SEQ ID NO:7. See In re Best 195 USPQ 430, 433 (CCPA 1977). The examiner is not in a position to make a conclusion of “inherency/anticipation” or “obviousness” since the record does not allow one to determine if and how the claimed subject matter differ from the prior art given that full length sequence of 16S rRNA sequence of Bacillus simplex of Maltzahn et al is not available for alignment. Furthermore, Table 1 in Appendix A of the declaration filed by Sarah Seaton on 10/18/2024 shows that endophyte Bacillus simplex share 99.2% sequence identity to instant SEQ ID NO:7. Accordingly, the burden shifts to the Applicant to provide evidence that the prior art neither anticipates nor renders obvious the claimed invention.
Alignment of partial sequence of 16S rRNA of endophyte Bacillus simplex with accession No. HQ432812 with instant SEQ ID NO:7
Query 36 ATGCAAGTCGAGCGAATCGATGGGAGCTTGCTCCCTGAGATTAGCGGCGGACGGGTGAGT 95
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 ATGC-AGTCGAGCGAATCGATGGGAGCTTGCTCCCTGAGATTAGCGGCGGACGGGTGAGT 59
Query 96 AACACGTGGGCAACCTGCCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCG 155
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 60 AACACGTGGGCAACCTGCCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCG 119
Query 156 GATACGTTCTTTTCTCGCATGAGAGAAGATGGAAAGACGGTTTACGCTGTCACTTATAGA 215
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 120 GATACGTTCTTTTCTCGCATGAGAGAAGATGGAAAGACGGTTTACGCTGTCACTTATAGA 179
Query 216 TGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATGCGTA 275
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 180 TGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATGCGTA 239
Query 276 GCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGG 335
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 240 GCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGG 299
Query 336 AGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAA 395
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 300 AGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAA 359
Query 396 CGAAGAAGGCCTTCGGGTCGTAAAGTTCTGTTGTTAGGGAAGAACAAGTACCAGAGTAAC 455
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 360 CGAAGAAGGCCTTCGGGTCGTAAAGTTCTGTTGTTAGGGAAGAACAAGTACCAGAGTAAC 419
Query 456 TGCTGGTACC-TGACGGTACCTAACC 480
|||||||||| |||||||||||||||
Sbjct 420 TGCTGGTACCTTGACGGTACCTAACC 445
Maltzahn et al. do not teach microencapsulated endophyte.
Amiet-Charpentier et al. teach microencapsulation of rhizobacteria (Pseudomonas fluorescens-putida), which act as a plant growth stimulator.
Given that Pseudomonas fluorescens and Pseudomonas putida are both well-known plant endophytes, it would have been obvious for skilled in the art to using perform microencapsulation of the endophyte of Maltzahn et al. according to the teaching of Amiet-Charpentier et al. resulting in instant invention with reasonable expectation for success. One would have been motivated to do so given that microencapsulation of rhizobacteria can achieve long term survival (Figure 3).
Applicants traverse in the paper filed 9/22/2025. Applicants’ arguments have been fully considered but were not found persuasive.
Applicants argue that the Office has not provided any reasoning or evidence within the cited references that would lead the skilled artisan to arrive at the formulation described in the claims (response, pages 7-8).
The Office contends that the reasoning was provided in the rejection discussed above. Particularly, one would have been motivated to combined the teaching given that microencapsulation of rhizobacteria can achieve long term survival (Figure 3) as taught by Amiet-Charpentier et al..
Applicants further argue that Pseudomonas fluorescens-putida of Amiet-Charpentier et al. is Gram-type negative and non-spore-forming bacteria whereas instant Bacillus is Gram-type positive and endospore-forming bacteria. Applicants further argue that Gram-type positive and Gram-type negative exhibit differences in stability due to their cell wall structures (response, pages 8-9).
The Office contends that Applicants’ argument is irrelevant to instant rejection as the differences between Gram-type negative and non-spore-forming bacteria does not prevent skilled in the art from applying microencapsulation technology to a Gram-type positive bacteria.
Applicants further argue that non-encapsulated Bacillus or Peribacillus endospores have been shown to be stable and viable for a period of time that significant exceeds any improved stability demonstrated by the encapsulation methods of Amiet-Charpentier et al. (response, pages 9-10).
The Office contends that the fact that non-encapsulated Bacillus or Peribacillus endospores have been shown to be stable and viable for a period of time that significant exceeds any improved stability demonstrated by the encapsulation methods of Amiet-Charpentier et al. does not prevent skilled in the art from applying the encapsulation method to further enhance the stability of the non-encapsulated Bacillus or Peribacillus.
Conclusion
No claim is allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LI ZHENG whose telephone number is (571)272-8031. The examiner can normally be reached Monday-Friday (9-5).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/LI ZHENG/Primary Examiner, Art Unit 1662