DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-20 are examined on the merits.
Priority
This application is a continuation application, of International Patent Application No. PCT/IL2022/050075, filed 01/18/2022, which claims priority from U.S. Provisional Application 63138555, filed 01/18/2021 is acknowledged.
Claim Objections
Claims 17-19 are objected to because the claims are missing sequence identifiers.
MPEP 2412.04: (c) Where the description or claims of a patent application discuss a sequence that is set forth in the “Sequence Listing XML” in accordance with paragraph (a) of this section, reference must be made to the sequence by use of the sequence identifier, preceded by “SEQ ID NO:” or the like in the text of the description or claims, even if the sequence is also embedded in the text of the description or claims of the patent application.
Claim 20 is objected to because it recites “disorder or a a cancerous”. It should recite “disorder or a cancerous”.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 20 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for treating a mood disorder, a depression, an anxiety, a stress, an impaired cognitive function, a panic attach, a compulsive behavior, an addiction, a social phobia, a sleep disorder and a food related disorder and bipolar disorder, comprising administering to the subject a therapeutically effective amount of a synthetic miR-135 molecule comprising the sequence of SEQ ID NOs: 10, 41-42 and a complementary strand comprising the sequence of SEQ ID NOs: 13, 47, does not reasonably provide enablement for treating any other CNS-related condition, depression-related disorder, or the cancerous disease, or for using synthetic miR-135 molecules comprising only “a sequence” of the recited sequence identifiers. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to the invention commensurate in scope with these claims.
Factors to be considered in determining whether a disclosure meets the enablement requirement of 35 U.S.C. 112, first paragraph, have been described by the court in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988). Wands states, on page 1404: Factors to be considered in determining whether a disclosure would require undue experimentation have been summarized by the board in Ex part Forman. These include: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and the quantity of experimentation needed to make or use the invention. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below.
Nature of the invention: The instant claim 20 is drawn to a method of treating a central nervous system (CNS)-related condition, a depression-related disorder or a cancerous disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the composition of matter of claim 1, thereby treating the CNS-related condition, the depression-related disorder or the cancerous disease. The nature of the claims is complicated, because the claim requires the outcome of treating central nervous system (CNS)-related condition, or a cancerous disease, yet the claim is drawn to administering a synthetic miR-135. The synthetic miR-135 is only required to comprise “a nucleic acid sequence of a miR-135b as set forth in SEQ ID NO: 37, and a complementary strand as set forth in SEQ ID NO: 40.” The phrase “a sequence” is reasonably interpreted as two or more consecutive nucleotides of the recited sequence identifiers. The nature of the invention is complex in that the encompassed molecules must be capable of treating any CNS-related condition, depression-related disorder or cancerous disease.
Breadth of the claim: The claims encompass a method for treating a central nervous system (CNS)-related condition, a depression-related disorder or a cancerous disease comprising administering to the subject a therapeutically effective amount of a synthetic miR-135. The claim is broad with respect to the treatment of a central nervous system (CNS)-related condition, depression-related disorder or a cancerous disease. Any disease related to the CNS and any disease related to, but not limited to depression, is encompassed. The claims broadly encompass the administration of a synthetic miR-135 to treat a vast number of a central nervous system (CNS)-related conditions, depression-related disorders, or a cancerous disease. The complex nature of the subject matter of this invention is greatly exacerbated by the breadth of the claim.
Guidance of the specification and existence of working examples: The specification envisions a composition of matter comprising a synthetic miR-135 molecule comprising a nucleic acid sequence of a miR-135b as set forth in SEQ ID NO: 37, and a complementary strand as set forth in SEQ ID NO: 40. According to an aspect of some embodiments of the present invention there is provided a composition of matter comprising a synthetic miR-135 molecule comprising a nucleic acid sequence of a miR-135b as set forth in any one of SEQ ID NOs: 10, 16 or 41-46, and a complementary strand as set forth in any one of SEQ ID NOs: 13 or 47. (e.g., line 13, page 3). The specification envisions a broader genus: provided a therapeutically effective amount of the composition of matter of some embodiments of the invention, or the conjugate of some embodiments of the invention, for use in treating a CNS-related condition in a subject in need thereof. According to an aspect of some embodiments of the present invention there is provided a therapeutically effective amount of the composition of matter of some embodiments of the invention, or the conjugate of some embodiments of the invention, for use in treating a depression-related disorder in a subject in need thereof. According to an aspect of some embodiments of the present invention there is provided a
therapeutically effective amount of the composition of matter of some embodiments of the invention, or the conjugate of some embodiments of the invention, for use in treating a cancerous disease in a subject in need thereof (e.g., lines 19-25, page 4). The specification envisions the sugar modification is selected from the group consisting of a 2'-O-methyl (2'-O-Me), a 2'-O-methoxyethyl (2'-O-MOE), a 2'-fluoro (2'-F), a locked nucleic acid (LNA), and a 2'-Fluoroarabinooligonucleotides (FANA). According to some embodiments of the invention, the sugar modification in the miR-135b is in at least one nucleotide at the 3' end of the nucleic acid sequence. According to some embodiments of the invention, the sugar modification in the miR-135b is in at least one nucleotide at the 5' end of the nucleic acid sequence. According to some embodiments of the invention, the sugar modification in the complementary strand comprises a modification in the last nucleotide at the 3' end of the nucleic acid sequence. According to some embodiments of the invention, the sugar modification in the complementary strand comprises a modification in the first two nucleotides at the 5' end of the nucleic acid sequence (e.g., line 17, page 5). The specification envisions the cell-targeting moiety is conjugated to a 5' end of the nucleic acid sequence of the complementary strand. According to some embodiments of the invention, the cell-targeting moiety is conjugated to a 5' end of the nucleic acid sequence of the miR-135b. According to some embodiments of the invention, the cell-targeting moiety is conjugated to a 3' end of the nucleic acid sequence of the complementary strand (e.g., line 15, page 7). The specification envisions the cell-targeting moiety binds specifically to a neurotransmitter transporter.
According to some embodiments of the invention, the cell-targeting moiety is selected from the group consisting of a serotonin reuptake inhibitor (SRI), a selective serotonin reuptake inhibitor (SSRI), a serotonin-norepinephrine reuptake inhibitor (SNRI), a noradrenergic and specific serotoninergic antidepressant (NASSA), a noradrenaline reuptake inhibitor (NRI), a dopamine reuptake inhibitor (DRI), an endocannabinoid reuptake inhibitor (eCBRI), an adenosine reuptake inhibitor (AdoRI), an excitatory Amino Acid Reuptake Inhibitor (EAARI), a glutamate reuptake inhibitor (GluRI), a GABA Reuptake Inhibitor (GRI), a glycine Reuptake Inhibitor (GlyRI) and a
Norepinephrine-Dopamine Reuptake Inhibitor (NDRI). According to some embodiments of the invention, the selective serotonin reuptake inhibitor (SSRI) is selected from the group consisting of sertraline, a sertraline- structural analog, fluoxetine, fluvoxamine, paroxetine, indapline, zimelidine, citalopram, dapoxetine, escitalopram, and mixtures thereof. (e.g., bridge line 32-12, pages 7-8). The specification envisions the cell-targeting moiety binds specifically to a tumor-associated antigen. According to some embodiments of the invention, the cell-targeting moiety binds specifically to a molecule expressed or presented on bone cells, muscle cells or gastrointestinal cells. According to some embodiments of the invention, the composition of matter or conjugate of some embodiments of the invention further comprises at least one of a cell-penetrating moiety or a moiety for transport across the blood brain barrier (BBB). According to some embodiments of the invention, the composition of matter or conjugate of
some embodiments of the invention further comprises a linker between the cell-penetrating moiety or the moiety for transport across the BBB and the synthetic miR-135 molecule. According to some embodiments of the invention, the cell-penetrating moiety or the moiety for transport across the BBB is attached to the miR-135b and/or to the complementary strand and/or to the cell-targeting moiety. According to some embodiments of the invention, the administering is effected by a mode of administration selected from the group consisting of an intranasal, an intracerebroventricular, an intrathecal, an oral, a local injection, and an intravenous mode of administration. According to some embodiments of the invention, the composition is for intranasal, intracerebroventricular, intrathecal, oral, local injection, or intravenous administration (e.g., line 5, page 9).
The specification envisions the CNS-related condition is a psychiatric disorder. According to some embodiments of the invention, the CNS-related condition is selected from the group consisting of a depression, an anxiety, an autism spectrum disorder, a schizophrenia, a bipolar disease, a stress, a fatigue, an impaired cognitive function, a panic attack, a compulsive behavior, an addiction, a social phobia, a sleep disorder, an eating disorder, a memory disorder, a cognition disorder, a growth disorder and a reproduction disorder. According to some embodiments of the invention, the depression-related disorder is selected from the group consisting of a major depression, an obsessive-compulsive disorder (OCD), a pervasive developmental disorder (PDD), a post-traumatic stress disorder (PTSD), an anxiety disorder, a bipolar disorder, an eating disorder and a chronic pain. According to some embodiments of the invention, the cancerous disease is selected from the group consisting of ovarian cancer, colorectal cancer, and prostate cancer (e.g., line 1, page 10).
Example 1 teaches the design and in vitro screening of double-stranded miR-135 mimetics using a luciferase assay in HEK293T cells. Table 1 shows the tested double stranded duplexes, each of which comprises the guide strand sequence of instant SEQ ID NO: 37, and the passenger strand sequence of SEQ ID NO: 40 with different modifications. The results for duplexes 1, 11, 16 and 17 are shown in Figs. 3A and 3B with regard to the fold change in SLC6a4 and HTR1a expression, respectively. Only duplex 11 provided a significant fold change in expression of both genes. At page 105, lines 9-10, the specification states, “Duplex 11 was found to be the most potent miR-135 mimetic oligo, affecting significantly both 5HTR1A and SLC6a4 levels (using 3’UTR luciferase constructs; Figures 3A-B). This specific mimetic was used for in vivo experiments (e.g., page 105, lines 16-17). The design of duplex 11 mimetic of miR-135 was as follows:
Guide strand - 5Ph/UAUGGCUUUUCAUUCCUAUGUGa (SEQ ID NO: 10)
Passenger strand - ucACAUAGGAAUGAAAAGCCAUa (SEQ ID NO: 13) (e.g., line 30, page 105-106; Table 1; Figs. 3A-B).
Example 2 demonstrates that the use of stereotactic surgery to deliver duplex 11 directly to the dorsal raphe nucleus (DRN) of wild type mice was able to block an expected hypothermic response to treatment with the selective 5-HT1AR agonist, 8-OH-DPAT.
Example 3 teaches the conjugation of duplex 11 (a.k.a. miCURE-135-1) to non-functional sertraline for intranasal delivery to achieve non-invasive delivery to the DRN of mice. Delivery of 100 μg of the conjugated duplex was capable of blocking the hypothermia response following 8-OH-DPAT administration, where the response lasted up to 7 days (e.g., Figs. 5A-D).
Example 4 teaches antidepressive like responses in mice treated with miCure-135-1 (30 ug dose). The results revealed that mice treated with miCure-135-1 showed a significant reduction in immobility time compered to control group which indicates the antidepressive like effect of sertraline-conjugated miR-135. This, coincides with the behavioral results, mPFC 5-HT levels of the treated mice were significantly higher, suggesting a better coping mechanism of sertraline-conjugated miR-135 treated mice (e.g., Fig. 6A-E).
Example 5, teaches that intranasal delivery of miCure-1 at a dose of 166 ug to mice, silence 5HT1a and have anti-depressive like effect by decreased immobility time at the tail suspension in miCure-135-1-treated mice compared to controls and anxiolytic effect as treated mice spent more time in the lit compartment of the dark/light transfer test compared to controls (e.g., Fig. 7A-C).
Example 6, teaches additional miR-135 mimetics (oligos) were designed based on the endogenous miR-135, but comprised advanced chemical modifications aimed to improve stability and reduce innate immune toxicity without leading to reduced potency. MiCure-135-1, miCure-135-2, miCure-135-3, miCure-135-9, miCure-135-10 and miCure-
135-11 were found to be the most potent miR-135 mimetic oligos, affecting significantly both SHTRlA and SLC6a4 levels (e.g., Fig. 9A-B; Table 6).
Predictability and state of the art: The state of the art with respect to using synthetic miR-135 for treatment of depression-related disorder and cancer disease is unpredictable and under developed. Ortega et al. (Biomedicines, 2021) teaches that the pathophysiology of Major Depressive Disorder (MDD) is quite complex. Traditionally, monoamine hypothesis was considered the most plausible cause of MDD. This theory consists of the altered functioning of the monoamines in the brain: Serotonin (5-HT), dopamine (DA) and norepinephrine (NE), which are considered major therapeutic targets of many antidepressants. However, despite the involvement of these components in the pathogenesis of MDD, this explanation is not far enough to address some critical issues such as why antidepressants may have a delayed or partial response and in some cases an absence of response (e.g., paragraph 3rd, page 4). A wide variety of cell signaling pathways are disrupted in the different brain areas of patients with MDD such as PI3K/Akt/mTOR, MAP kinases (MAPK), Wnt/βcatenin and many others (e.g., paragraph bridge 3rd, 1st, pages 4-5). Ortega teaches that miRNAs might be critical regulators of many of the targets and factors implicated in the pathogenesis of MDD, having been related among others to neuroinflammation, altered neurogenesis, neuroplasticity, stress response or circadian rhythms, as proven in different animal models (e.g., paragraph 2nd, page 5; Fig. 1). In patients with MDD, miR-135 is prominently downregulated in the blood and in the raphe nuclei of suicide depressed patients in comparison to healthy controls, what could have negative consequences both at the antidepressant efficacy and the serotoninergic activity (e.g., paragraph 1st, page 6). Simultaneously, miR-135a, an important miRNA dysregulated in MDD may also mediate anti-inflammatory actions through targeting IL-1β, IL-6 and TNF-α as well as TLR4, a major hallmark of the neuroinflammatory process that may be related to stress and MDD (e.g., paragraph 1st, page 10). Abnormal expression of other miRNAs as putative epigenetic signatures of MDD include downregulation of miR-16, upregulation of miR-124-3p, miR-132, directly related to self-rating depression scale and HAM-D scale and downregulated miR-135 (e.g., paragraph 5th, page 12). Issler et al. (Neuron, 2014, cited as reference 154, filed on IDS 07/23/2023) teaches the potential role for miR135 as an endogenous antidepressant and provide a venue for potential treatment and insights into the onset, susceptibility, and heterogeneity of stress-related psychopathologies (e.g., abstract).
The role of treating cancer by administering miR-135 is ambiguous, because miR-135 can act as either a tumor suppressor or an oncogene depending of the tissue type. Yamada et al. (Cancer Science, 2013) teaches that miRNA expression signatures from renal cell carcinoma (RCC) revealed that expression of microRNA-135a (miR-135a) was significantly reduced in cancerous tissues and that administering microRNA-135a inhibits cancer cell proliferation by targeting c-Myc oncogene in renal cell carcinoma (e.g., abstract). Lulli et al. (Oncotarget, 2015), teaches that restoration of miR-135b in glioblastoma multiforme (GSC) significantly decreased proliferation, migration and clonogenic abilities. More importantly, miR-135b restoration was able to significantly reduce brain infiltration in mouse models of GBM obtained by intracerebral injection of GSC lines. We identified ADAM12 and confirmed SMAD5 and GSK3β as miR-135b targets and potential mediators of its effects (e.g., abstract). On the contrary, Khatri et al. (Frontiers in Oncology, 2013) teaches that miR-135b levels are elevated in a variety of cancers including breast, non-small cell lung cancer (NSCLC), prostate, and colon (e.g., paragraph 2nd, left column, page 1). Khatri teaches that direct blockade of miR-135b may itself serve as a therapeutic intervention against a network of events driving oncogenesis and even target the self-renewing cancer stem cells (e.g., paragraph 2nd, right column, page 3).
Thus, the teachings of the post-filing art are consistent with the prior art demonstrating the underdeveloped and the unpredictable nature of the invention. Therefore, one of skill in the art would have recognized the unpredictability in providing more miR-135 for the treatment.
Amount of experimentation necessary: Central nervous system-related condition, or a cancerous diseases are highly complex and different etiologies and gene-based therapies are still in developmental stages. It would require a large amount of experimentation to make use of synthetic miR-135 molecule for treatment of central nervous system-related condition, or a cancerous disease. The term “central nervous system-related condition” is a broad genus encompassing a large number of distinct pathologies with different etiologies. The specification only discloses the effect of synthetic miR-135 in a depression model. However, there is no evidence of how miR-135 plays a role in other CNS-related disorders. Furthermore, the claim encompasses the term “cancerous disease” which includes a large number of solid and liquid tumors, the role of miR-135 is ambiguous, because miR-135 can act as either a tumor suppressor or an oncogene.
For a specific gene therapy to be efficacious, it would require to address: (1) the specific means of synthetic miR-135 for treatment of other central nervous system-related condition, or a cancerous disease delivery, expression, activity, (2) to define the specific dosage of therapeutic molecules delivered to the cells or to the subjects in time course, (3) the potential deleterious effect of continuous administration of synthetic miR-135 on normal cells and tissues.
In view of the breadth of the claims, the lack of guidance provided by the specification, the lack of the predictability of the art to which the invention pertains, undue amount of experimentation would be required to make and use the full scope of the claimed invention. Therefore, claim 20 are not considered to be fully enabled.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-2 and 10 are rejected under 35 U.S.C. 101 because the claimed inventions are directed to a nature-based product without significant more. The claims recite a composition of matter comprising a miR-135b molecule and a complementary strand.
Claim 1 recites “A composition of matter comprising a synthetic miR- 135 molecule comprising a nucleic acid sequence of a miR-135b as set forth in SEQ ID NO: 37, and a complementary strand as set forth in SEQ ID NO: 40”. The sequence of SEQ ID NO 37 contains the naturally occurring hsa-miR-135b (GeneBank NR_029893.1, available December, 2020). The naturally occurring SEQ ID NO 37 is taught by Chen et al. (WO 2015/118537 A2, cited as reference 42, filed on IDS 07/23/2023) as SEQ ID NO 2 (see alignment below). The SEQ ID NO 40 corresponds to the natural complementary strand. SEQ ID NO 40 is taught by Califano (US 8,586,726 B2) as SEQ ID NO 3378 (see alignment below). Ha et al. (Molecular Cell. Biol. 2014) teaches that during miRNA biogenesis from a pre-miRNA after Dicer cut what it remains is a duplex RNA, therefore in the instant claims, the resulting duplex consist of the “guide” miR-135b (SEQ ID NO 37) and the “passenger” strand (SEQ ID NO 40). Thus, the synthetic miR-135 of the specification has not been engineered to have a different sequence than the miR-135b found in nature. The term synthetic is not sufficient to distinguish the claimed double strand from the hsa-mir-135b duplex that exists naturally within human cells.
Dependent claim 2 encompasses the composition of claim 1, which is from a naturally occurring miR-135b.
Dependent claim 10 encompasses the composition of matter of claim which is the naturally occurring miR-135b.
For the reasons given above, the claimed product is not markedly different from it naturally occurring counterpart. This judicial exception is not integrated into a practical application because the claims do not contain any limitation(s) directed to additional element(s). The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claims do not contain any element(s) in addition to the judicial exception.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2, 4-7, 10-13, 20 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Chen et al. (“Chen”, WO 2015/118537 A2, cited as reference 42, filed on IDS 07/23/2023).
Regarding claims 1, 10, 20, Chen teaches a method comprising administering to the subject a therapeutically effective amount of a miR-135, a precursor thereof or a nucleic acid molecule encoding said miR-135 or said precursor thereof, thereby treating the bipolar disorder (e.g., line 26, page 2). Chen teaches that medical condition is selected from the group consisting of a bipolar disorder, a depression, a major depression, an anxiety, a stress, a fatigue, an impaired cognitive function, a panic attack, a compulsive behavior, an addiction, a social phobia, a schizophrenia, a sleep disorder, an eating disorder, a growth disorder and a reproduction disorder (e.g., line 17, page 8). Chen teaches the miR-135 is selected from the group consisting of miR-135a or miR-135b (e.g., line 17, page 10). Chen teaches SEQ ID NO 2 (miR-135b) that has 100% identity with SEQ ID NO 37 of the instant claims (e.g., Table 8, page 141), see alignment below:
PNG
media_image1.png
224
608
media_image1.png
Greyscale
Chen teaches administering to the subject a microRNA (e.g. miR-135) or an effector thereof or expressing in a cell of the subject an exogenous nucleic acid molecule (i.e. polynucleotide) encoding the microRNA (e.g. miR-135) or the precursor thereof. The term "polynucleotide" refers to a single-stranded or double-stranded oligomer or polymer of ribonucleic acid (RNA), deoxyribonucleic acid (DNA) or mimetics thereof. This term includes polynucleotides and/or oligonucleotides derived from naturally occurring nucleic acids molecules (e.g., RNA or DNA), synthetic polynucleotide and/or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions (It reads that if miR-135b was administered in a synthetic double stranded oligomer or in a vector, therefore, the prior art was in possession of the sequence complementary to SEQ ID NO 2) (e.g., paragraph 2nd, page 35).
Regarding claim 2, Chen teaches length of the polynucleotide of the present invention is optionally 50 nucleotides or less, optionally 40 nucleotides or less, optionally 30 nucleotides or less, e.g., 29 nucleotides, 28 nucleotides, 27 nucleotides, 26 nucleotides, 25 nucleotides, 24 nucleotides, 23 nucleotides, 22 nucleotides, 21 nucleotides, 20 nucleotides, 19 nucleotides, 18 nucleotides, 17 nucleotides, 16 nucleotides, 15 nucleotides, optionally 25 between 12 and 24 nucleotides, optionally between 5-15, optionally, between 5-25, most
preferably, about 20-25 nucleotides (e.g., line 18, page 35).
Regarding claim 4, Chen teaches the miR-135 is selected from
the group consisting of miR-135a or miR-135b (e.g., line 17, page 10). Chen teaches that the term "polynucleotide" refers to a single-stranded or double-stranded oligomer or polymer of ribonucleic acid (RNA), deoxyribonucleic acid (DNA) or mimetics thereof. This term includes polynucleotides and/or oligonucleotides derived from naturally occurring nucleic acids molecules (e.g., RNA or DNA), synthetic polynucleotide and/or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions, which function similarly to respective naturally occurring portions (e.g., line 4, page 35).
Regarding claims 5-6, Chen teaches an isolated polynucleotide comprising a miR-135 wherein the miR-135 comprises a modification selected from the group consisting of a locked nucleic acid (LNA) and a 2'-Fluoroarabinooligonucleotides (FANA) (e.g., line29, page 3). Chen teaches the polynucleotide comprises a modification corresponding to position 2 of the ribose. According to one embodiment, the modified polynucleotide comprises at least one 2'-modified nucleotide, e.g., a 2'-deoxy, 2'-fluoro, 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-0-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-Fluoroarabinooligonucleotides (FANA), or 2'-O--N-methylacetamido (2'-O-NMA) (e.g., line 5, page 38).
Regarding claim 7, Chen teaches the polynucleotide comprises a phosphorus-modified internucleotide linkage at the 5' or 3' end of the nucleotide sequence. Preferred modified oligonucleotide or polynucleotide backbones include, for example: phosphorothioates; chiral phosphorothioates; phosphorodithioates; phosphotriesters; aminoalkyl phosphotriesters; methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates; phosphinates;
phosphoramidates, including 3'-amino phosphoramidate and
aminoalkylphosphoramidates; thionophosphoramidates; thionoalkylphosphonates; thionoalkylphosphotriesters; boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; and boron phosphonate (e.g., line 12, page 37).
Regarding claim 11, Chen teaches that the modification can improve stability, hybridization thermodynamics with a target nucleic acid, targeting to a particular tissue or cell-type, or cell permeability, e.g., by an endocytosis-dependent or -independent mechanism. Modifications can also increase sequence specificity, and consequently decrease off-site targeting (e.g., line 18, page 36). Chen teaches the polynucleotide includes a modification that improves targeting, e.g. a targeting modification described herein. Examples of modifications that target single-stranded oligonucleotide agents to particular cell types include carbohydrate sugars such as galactose, N-acetylgalactosamine, mannose; vitamins such
as folates; other ligands such as RGDs and RGD mimics; and small molecules including naproxen, ibuprofen or other known protein-binding molecules (e.g., line 14, page 41).
Regarding claim 12-13, Chen teaches modified polynucleotide is further modified so as to be attached to a ligand that is selected to improve stability, distribution or cellular uptake of the agent, e.g., cholesterol.
Thus, the polynucleotide may be modified to include a non-nucleotide moiety, e.g., a cholesterol moiety. The non-nucleotide moiety (e.g. cholesterol moiety) can be attached, e.g., to the 3' or 5' end of the polynucleotide (e.g., line 21, page 42).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 3, 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al. (“Chen”, WO 2015/118537 A2, cited as reference 42, filed on IDS 07/23/2023) as applied to claims 1-2, 4-7, 10-13 above, and further in view of Kelnar et al. (“Kelnar”, WO 2012/106586 A1) and Califano et al. (“Califano”, US 8,586,726 B2).
Regarding claim 8, Chen teaches OLG-135-001 with Phosphate at 5’ end, and 2’O-Methyl at the 3’ end, that corresponds to SEQ ID NO 10 of the instant claims (e.g., Fig. 44, see below).
PNG
media_image2.png
200
400
media_image2.png
Greyscale
Chen does not teach a double stranded synthetic miRNA comprising the sequence of SEQ ID NO: 37 and the sequence of SEQ ID NO: 40, as required by the instant claims. Chen does not teach SEQ ID NO 40, 13, 41 and 42, as required by the instant claims. However, this is cured by Kelnar and Califano.
Kelnar teaches that therapeutic microRNAs should be stable, active, and specifically hybridize with the correct mRNA target. Embodiments concern miR-124 mimics that have maintained and/or enhanced resistance to nuclease digestion, hybridization capability with the correct target mRNAs, and/or functionality (e.g., paragraph 0007). Kelnar teaches different RNA molecules containing the sequence of a mature miR-124. RNA molecules may be double-stranded and/or blunt-ended, which means the molecule is double-stranded throughout the molecule and/or blunt-ended on both ends. Moreover, embodiments concern chemical modifications of such RNA molecules to yield miR-124 mimics with improved or enhanced properties (e.g., paragraph 008). Kelnar teaches that because a 2'OH is required for ribonucleases to cleave RNA molecules, incorporating 2' -modified nucleotides into RNA molecules can make them more resistant to nuclease digestion (e.g., paragraph 00419). Kelnar teaches miR-124 mimics were prepared by hybridizing complementary oligonucleotides having 2'O-Me-modified nucleotides at various positions and incubating the hybrids with 720 U of RNase A at 37°C for 30 min (e.g., paragraph 0420; Table 4). Kelnar teaches that it is contemplated that an RNA molecule may contain an active strand that is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical, or any range derivable therein, to SEQ ID NO:1
(UAAGGCACGCGGUGAAUGCC) (e.g., paragraph 0097). Kelnar teaches that in some embodiments, it is contemplated that an active strand having a sequence that is at least 95% identical to SEQ ID NO: 1 has a modification of a nucleotide at one or more of the following positions: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 with respect to either the 5' or 3' end of the strand (e.g., paragraph 0119). Kelnar teaches that in some embodiments, an active strand is at least 95% identical to SEQ ID NO:2
(UUAAGGCACGCGGUGAAUGCCA), which is 2 bases longer than SEQ ID NO: 1 (Indicated in bold at 5’ and 3’ ends) (e.g., paragraph 00120).
Califano teaches isolated nucleic acid sequences of newly discovered microRNAs that have been identified to exist in normal Human B cells and/or in tumor-related Human B cells (e.g., abstract). Califano teaches SEQ ID NO 3378 that has 100% homology with SEQ ID NO 40 of the instant claims (see alignment below).
PNG
media_image3.png
223
649
media_image3.png
Greyscale
SEQ ID NO 40 has the same nucleotide sequence of SEQ ID NO 13 in the instant claims:
PNG
media_image4.png
199
617
media_image4.png
Greyscale
Regarding claim 3:
Based on these teachings, it would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to combine the teachings of Chen - a method of treating depression with miR-135 that, with the teachings of Califano the SEQ ID NO 3378 corresponding to the complementary strand of miR-135b and the teachings of Kelnar -the therapeutic use of modified mimetic double stranded miR-124, that has enhanced resistance to nuclease digestion, and functionality; for someone skilled in the art would have been obvious to use these teachings of Kelnar and develop a synthetic modified double stranded miR-135 with the sequences taught by Chen and Califano, to achieve the predictable result of developing a doble-stranded miR-135.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to try to develop a synthetic modified doubled-stranded miR-135 for the treatment of depression.
Regarding claims 8-9:
It would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to apply the teachings of Chen and Kelnar adding modifications comprising 5’ phosphate, 2’-O- Methyl, 2'-O-methoxyethyl (2'-O-MOE), phosphorothioate internucleoside linkages) to modify the SEQ ID NO 40 taught by Califano, to arrive to the SEQ ID NO: 13 (5’= Phosphate and 3’= 2’O-Methyl) and use the teachings of Kelnar -adding “U” and/or “A” to the 5’ and/or 3’ end of miRNA active and passenger sequences and modify SEQ ID NO 37 to obtain SEQ ID NO 41 (adding “U” at the 5’ end of SEQ ID NO 37) and modify SEQ ID NO 37 to obtain SEQ ID NO 42 (adding “U” at the 5’ end and two “A” to the 3’ end of SEQ ID NO 37). A person of ordinary skill in the art would be faced with a limited number of positions for modifications, specifically at the 5’ and 3’ ends, and internal pyrimidine/purine sites. The selection of specific positions represents a routine optimization of RNA to achieve a predictable increase in stability and resistance to nucleases as taught by Chen and Kelnar.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to try to generate a modified double-stranded miR-135 with reasonable expectation of success in arriving at the claimed modifications.
Claims 14-19 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al. (“Chen”, WO 2015/118537 A2, cited as reference 42, filed on IDS 07/23/2023), Kelnar et al. (“Kelnar”, WO 2012/106586 A1) and Califano et al. (“Califano”, US 8,586, 726 B2) as applied to claims 1-13, 20 above, and further in view of Montefeltro et al. (“Montefeltro”, WO 2011/131693 A2, cited as reference 37, filed on IDS 07/23/2023).
Chen, Kelnar, and Califano do not teach the miR-135 link to serotonin reuptake inhibitor consisting of sertraline as required by the instant claims. However, this is cured by Montefeltro.
Regarding 14-16, Montefeltro teaches nucleic acid constructs which contain a nucleic acid specific for given target gene and a selective inhibitor of a neurotransmitter transporter (e.g., line 31, page 8). Montefeltro teaches the administration of a construction comprising a siRNA specific for the serotonin 5-HT1A receptor and a specific serotonin-transporter inhibitor (sertraline) results in reduction of the 5-HTIA receptor mRNA and a lack of hypothermia response in response to 8-OH-DPAT (a measure of serotoninergic signaling) which is much higher than that obtained with the non-conjugated siRNA (e.g., line 9, line 10, page 81 [see structure below indicating the linking group between the oligonucleotide and sertraline]). Montefeltro teaches a conjugate comprising (i) the selectivity agent is selected from the group of a selective serotonin reuptake inhibitor (SSRI), and (ii) the oligonucleotide is capable of specifically binding to a target molecule selected from the group of the mRNA encoding the serotonin receptor type IA (5-HT1A) or the mRNA encoding the serotonin transporter (5-HHT transporter or SERT) or mRNA encoding the serotonin receptor type IB (5-HTrn) or the mRNA encoding the TREK-I potassium channel or the Gir-K potassium channel, for use in the treatment or prevention of a depression-related disorder. (e.g., line 29, page 9).
PNG
media_image5.png
167
502
media_image5.png
Greyscale
Based on these teachings, it would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to modify the teachings of Montefeltro –a conjugate comprising a siRNA specific for the serotonin 5-HT1A receptor linked to a specific serotonin-transporter inhibitor sertraline and substitute the siRNA with the modified double-stranded miR-135 taught by Chen, Kelnar and Califano; for someone skilled in the art would have been obvious to use these teachings to achieve the predictable result of developing a modified double-stranded miR-135 linked to sertraline for inhibition of serotonin uptake receptor.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to try to develop a modified doubled-stranded miR-135 linked to sertraline for the treatment of depression-related disorder.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-20 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-10 of U.S. Patent No. 12,016,876 (“876”) in view of Kelnar et al. (“Kelnar”, WO 2012/106586 A1), Califano et al. (“Califano”, US 8,586,726 B2) and Montefeltro et al. (“Montefeltro”, WO 2011/131693 A2, cited as reference 37, filed on IDS 07/23/2023).
The following rejection is in view of the decision of the Court of Appeals for the Federal Circuit on Sun Pharmaceutical Industries, Ltd. v. Eli Lilly & Co., No. 10-1105 (Fed. Cir. July 28, 2010) in which the court indicated that obviousness-type double patenting encompasses any use for a compound where that use is disclosed in the specification of an earlier patent claiming the compound and is later claimed as a method of using that compound.
Although the claims at issue are not identical, they are not patentably distinct from each other because both claim sets are drawn to the miR-135. The difference is that “876” claims are directed to method of using the modified miR-135, whereas the instant claims are directed to the double-stranded miR-135 product and to a method of using the product. However, one of the ordinary skill in the art would recognize that if he/she knew how to make the instantly claimed product of producing the modified double-stranded miR-135, then it is obvious that the instant method of producing double-stranded miR-135 was known at the time of the filing.
Regarding claims 1-6, 20, “876” teaches method of treating a medical condition selected from the group consisting of a mood disorder, a depression, an anxiety, a stress, an impaired cognitive function, a panic
attach, a compulsive behavior, an addiction, a social phobia, a sleep disorder and a food related disorder in a subject in need thereof, the method comprising administering to said subject a modified miR-13 5, wherein said modified miR-135 comprises a backbone modification selected from the group consisting of a phosphorothioate, a 2'-0-methoxyethyl, and a 2'-0-methyl, thereby treating the medical condition (claim 1). The method of claim 1, wherein said backbone modification
comprises a phosphorothioate, a 2'-0-methoxyethyl, and a 2'-0-methyl modification (claim 3). The method of claim 1, wherein said miR-135 is as set forth in SEQ ID NO: 58-62 (claim 8).
SEQ ID NO 37 of the instant claims has 100% match with SEQ ID NO 62 of “876”, see alignment below.
PNG
media_image6.png
221
618
media_image6.png
Greyscale
Regarding claim 7, “876” teaches the method of claim 1, wherein said backbone modification further comprises a modification selected from the group consisting of a chiral phosphorothioate, a phosphorodithioate,
a phosphotriester, an aminoalkyl phosphotriester, a methyl phosphonate, an alkyl phosphonate, a chiral phosphonate, a phosphinate, a phosphoramidate, an amino alkylphosphoramidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a boranophosphate, a phosphodiester, a peptide nucleic acid (PNA), and a 2'-fluoro (claim 4).
Regarding claim 8-9, “876” teaches the method of claim 1, wherein said modified miR-135 comprises a base modification (claim 5). The method of claim 5, wherein said base modification is to a Uracil base (claim 6). The method of claim 5, wherein said base modification comprises a 5'-methyl modification (claim 7). The method of claim 1, wherein said backbone modification comprises at least 2 of phosphorothioate, a 2'-0-methoxyethyl, and a 2'-0-methyl (claim 10).
“876” does not teach the synthetic doubled-stranded miR-135 linked to sertraline as required by the instant claims. However, these deficiencies are cured by Kelnar, Califano and Montefeltro.
Kelnar teaches that therapeutic microRNAs should be stable, active, and specifically hybridize with the correct mRNA target. Embodiments concern miR-124 mimics that have maintained and/or enhanced resistance to nuclease digestion, hybridization capability with the correct target mRNAs, and/or functionality (e.g., paragraph 0007). Kelnar teaches different RNA molecules containing the sequence of a mature miR-124. RNA molecules may be double-stranded and/or blunt-ended, which means the molecule is double-stranded throughout the molecule and/or blunt-ended on both ends. Moreover, embodiments concern chemical modifications of such RNA molecules to yield miR-124 mimics with improved or enhanced properties (e.g., paragraph 008).
Kelnar teaches methods also include targeting an miRNA in a cell or
organism. The term "corresponding to a miRNA" means a nucleic acid will be employed so as to mimic (provide the activity or function of) a selected miRNA. RNA delivery can be enhanced by targeting the RNA to a cell.
Targeting moieties can be conjugated to a variety of delivery compositions and provide selective or specific binding to a target cell(s ). Targeting moieties can include, but are not limited to moieties that bind to cell surface receptors, cell specific extracellular polypeptide, saccharides or lipids, and the like. For example, small molecules such as folate, peptides such as RGD containing peptides, and antibodies such as antibodies to epidermal growth factor receptor can be used to target specific cell types (e.g., paragraph 00385).
Califano teaches isolated nucleic acid sequences of newly discovered microRNAs that have been identified to exist in normal Human B cells and/or in tumor-related Human B cells (e.g., abstract). Califano teaches SEQ ID NO 3378 that has 100% homology with SEQ ID NO 40 of the instant claims (see alignment below).
PNG
media_image7.png
267
778
media_image7.png
Greyscale
Montefeltro teaches nucleic acid constructs which contain a nucleic acid specific for given target gene and a selective inhibitor of a neurotransmitter transporter (e.g., line 31, page 8). Montefeltro teaches the administration of a construction comprising a siRNA specific for the serotonin 5-HT1A receptor and a specific serotonin-transporter inhibitor (sertraline) results in reduction of the 5-HTIA receptor mRNA and a lack of hypothermia response in response to 8-OH-DPAT (a measure of serotoninergic signaling) which is much higher than that obtained with the non-conjugated siRNA (e.g., line 9, line 10, page 81 [see structure below indicating the linking group between the oligonucleotide and sertraline]). Montefeltro teaches a conjugate comprising (i) the selectivity agent is selected from the group of a selective serotonin reuptake inhibitor (SSRI), and (ii) the oligonucleotide is capable of specifically binding to a target molecule selected from the group of the mRNA encoding the serotonin receptor type IA (5-HT1A) or the mRNA encoding the serotonin transporter (5-HHT transporter or SERT) or mRNA encoding the serotonin receptor type IB (5-HTrn) or the mRNA encoding the TREK-I potassium channel or the Gir-K potassium channel, for use in the treatment or prevention of a depression-related disorder. (e.g., line 29, page 9).
PNG
media_image8.png
261
784
media_image8.png
Greyscale
It would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to combine the teachings of “876” -a method of treating medical condition selected from the group consisting of a mood disorder, a depression, an anxiety, a stress, the method comprising administering to said subject a modified miR-135, wherein said modified miR-135 comprises a backbone modification selected from the group consisting of a phosphorothioate, a 2'-0-methoxyethyl, and a 2'-0-methyl, with the teachings of Kelnar -the therapeutic use of modified mimetic double stranded miR-124, that has enhanced resistance to nuclease digestion, and/or functionality, the teachings of Califano SEQ ID NO 40 and the teachings of Montefeltro –a conjugate comprising a siRNA specific for the serotonin 5-HT1A receptor linked to a specific serotonin-transporter inhibitor sertraline; for someone skilled in the art would have been obvious to use these teachings to achieve the predictable result of developing a modified double-stranded miR-135 linked to sertraline for inhibition of serotonin uptake receptor.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to try to develop a modified doubled-stranded miR-135 linked to sertraline for the treatment of depression-related disorder.
Claims 1-20 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-10 of U.S. Patent No. 10,125,365 (“365”, cited as reference 1, filed on IDS 07/23/2023) in view of Kelnar et al. (“Kelnar”, WO 2012/106586 A1), Califano et al. (“Califano”, US 8,586,726 B2) and Montefeltro et al. (“Montefeltro”, WO 2011/131693 A2, cited as reference 37, filed on IDS 07/23/2023).
Although the claims at issue are not identical, they are not patentably distinct from each other because both claim sets are drawn to the miR-135. The difference is that “365” claims are directed to method of using the modified miR-135, whereas the instant claims are directed to the double-stranded miR-135 product and to a method of using the product. However, one of the ordinary skill in the art would recognize that if he/she knew how to make the instantly claimed product of producing the modified double-stranded miR-135, then it is obvious that the instant method of producing double-stranded miR-135 was known at the time of the filing.
Regarding claims 1-4, 20, “365” teaches method of treating a bipolar disorder in a subject in need thereof, the method comprising administering to the subject therapeutically effective amount of a miR-135, a precursor thereof or a nucleic acid molecule encoding said miR-135 or said precursor thereof, thereby treating the bipolar disorder (claim 1). The method of claim 1, wherein said miR-135 is selected from the group consisting of miR-135a and miR-135b (claim 2). The method of claim 1, wherein said miR-135 is as set forth in SEQ ID NO: 58-62 (claim 3). The method of claim 1, wherein said miR-135 comprises a modification selected from the group consisting of a modified sugar-phosphate backbone and a modified base (claim 5). The method of claim 1, wherein said miR-135 comprises a modification in both a sugar and an internucleoside linkage (claim 6).
SEQ ID NO 37 of the instant claims has 100% match with SEQ ID NO 62 of “876”, see alignment below.
PNG
media_image9.png
345
966
media_image9.png
Greyscale
Regarding claims 5-7, “365” teaches The method of claim 5, wherein said modification is selected from the group consisting of a phosphorothioate, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkyl phosphotriester, a methyl phosphonate,
an alkyl phosphonate, a chiral phosphonate, a phosphinate, a phosphoramidate, an amino, alkylpho, sphoramidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a boranophosphate, a phosphodiester, a 2'-O-methoxyethyl, a 2'-O-methyl, a 2'-fluoro, a locked nucleic acid (LNA), a peptide nucleic acid (PNA) and a 2'-Fluoroarabinooligonucleotides (PANA) (claim 7).
The teachings of Kelnar, Califano and Montefeltro are discussed above under U.S.C nonstatutory double patenting Rejections.
It would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to combine the teachings of “365” - a method of treating medical condition selected from the group consisting of a mood disorder, a depression, an anxiety, a stress, the method comprising administering to said subject a modified miR-135, wherein said modified miR-135 comprises a backbone modification selected from the group consisting of a phosphorothioate, a 2'-0-methoxyethyl, and a 2'-0-methyl, with the teachings of Kelnar -the therapeutic use of modified mimetic double stranded miR-124, that has enhanced resistance to nuclease digestion, and/or functionality, the teachings of Califano SEQ ID NO 40 and the teachings of Montefeltro –a conjugate comprising a siRNA specific for the serotonin 5-HT1A receptor linked to a specific serotonin-transporter inhibitor sertraline; for someone skilled in the art would have been obvious to use these teachings to achieve the predictable result of developing a modified double-stranded miR-135 linked to sertraline for inhibition of serotonin uptake receptor.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to try to develop a modified doubled-stranded miR-135 linked to sertraline for the treatment of depression-related disorder.
Claims 1-20 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-10 of U.S. Patent No. 9,150,858 B2 (“858”, cited as reference 23, filed on IDS 07/23/2023) in view of Kelnar et al. (“Kelnar”, WO 2012/106586 A1), Califano et al. (“Califano”, US 8,586,726 B2) and Montefeltro et al. (“Montefeltro”, WO 2011/131693 A2, cited as reference 37, filed on IDS 07/23/2023).
Although the claims at issue are not identical, they are not patentably distinct from each other because both claim sets are drawn to the miR-135. The difference is that “858” claims are directed to method of using the modified miR-135, whereas the instant claims are directed to the double-stranded miR-135 product and to a method of using the product. However, one of the ordinary skill in the art would recognize that if he/she knew how to make the instantly claimed product of producing the modified double-stranded miR-135, then it is obvious that the instant method of producing double-stranded miR-135 was known at the time of the filing.
Regarding claims 1-3, 20, “858” teaches a method of treating a medical condition in which an elevation of serotonin level is therapeutically beneficial in a subject in need thereof, and wherein the medical condition is
selected from the group consisting of a mood disorder, a depression, an anxiety, a stress, an impaired cognitive function, a panic attach, a compulsive behavior, an addiction, a social phobia, a sleep disorder and a food related disorder, the method comprising administering to said subject at least one microRNA selected from the group consisting of miR-135, miR-335, miR-26 and miR-182, or a precursor thereof, or expressing in a cell of said subject an exogenous polynucleotide encoding said at least one microRNA or a precursor thereof, thereby treating the medical condition (claim 1). A method of increasing a serotonin level in a synaptic cleft of a subject in need thereof, the method comprising administering to said subject at least one microRNA selected from the group consisting of miR-135, miR-335, and miR-182, or a precursor thereof, or expressing in a serotonergic neuron of said subject an exogenous polynucleotide encoding
said at least one microRNA or a precursor thereof, thereby increasing said serotonin level in the synaptic cleft (claim 2). The method of claim 1, wherein said at least one microRNA comprises a miR-135 (claim 3). The method of claim 1, wherein said miR-135 is as set forth in SEQ ID NO: 58-62 (claim 4).
SEQ ID NO 37 of the instant claims has 100% match with SEQ ID NO 62 of “876”, see alignment below.
PNG
media_image9.png
345
966
media_image9.png
Greyscale
Regarding claims 4-7, “858” teaches the method of claim 1, wherein saidmiR-135 comprises a modification selected from the group consisting of a modified backbone, a modified internucleoside linkage and a
modified base (claim 8). The method of claim 8, wherein said modified backbone comprises a modification selected from the group consisting
of a phosphorothioate, a chiral phosphorothioate, a phosphorodithioate,
a phosphotriester, an aminoalkyl phosphotriester, a methyl phosphonate, an alkyl phosphonate, a chiral phosphonate, a phosphinate, phosphoramidate, an aminoalky- lphosphoramidate, a thionophosphoramidate, a thionoalkylphosphonate,
a thionoalkylphosphotriester, boranophosphate, a phosphodiester, a peptide nucleic acid (PNA), a 2'-0-methoxyethyl, a 2'-0-methyl and a 2'-fluoro (claim 9). The method of claim 1, wherein said miR-135 comprises a modification in both a sugar and an internucleoside linkage (claim 10). The method of claim 5, wherein miR-135 comprises a
modification selected from the group consisting of a modified
backbone, a modified internucleoside linkage and a modified
45 base (claim 11). The method of claim 11, wherein said modified backbone comprises a modification selected from the group consisting
of a phosphorothioate, a chiral phosphorothioate, a
phosphorodithioate, a phosphotriester, an aminoalkyl phos-
photriester, a methyl phosphonate, an alkyl phosphonate, a chiral phosphonate, a phosphinate, a phosphoramidate, an
aminoalkylphosphoramidate, a thionophosphoramidate, a
thionoalkylphosphonate, a thionoalkylphosphotriester, a
boranophosphate, a phosphodiester, a peptide nucleic acid
(PNA), a 2'-0-methoxyethyl, a 2'-0-methyl and a 2'-fluoro (claim 12). The method of claim 5, wherein said miR-135 comprises a modification in both a sugar and an internucleoside linkage (claim 13). The method of claim 1, wherein said polynucleotide encoding said at least one microRNA or said precursor thereof comprises a miR-135 or a precursor of said miR-135, and optionally wherein said miR-135 comprises a modification
selected from the group consisting of a modified backbone, a modified internucleoside linkage and a modified base (claim 14). The method of claim 14, wherein said modified backbone comprises a modification selected from the group consisting of a phosphorothioate, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkyl phosphotriester, a methyl phosphonate, an alkyl phosphonate, a chiral phosphonate, a phosphinate, a phosphoramidate, an
aminoalkylphosphoramidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a boranophosphate, a phosphodiester, a peptide nucleic acid (PNA), a 2'-0-methoxyethyl, a 2'-0-methyl and a 2'-fluoro (claim 15). The method of claim 14, wherein said miR-135 comprises a modification in both a sugar and an internucleoside
linkage (claim 16).
The teachings of Kelnar, Califano and Montefeltro are discussed above under U.S.C nonstatutory double patenting Rejections.
It would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to combine the teachings of “858” -a method of treating a medical condition in which an elevation of serotonin level is therapeutically beneficial in a subject in need thereof, and wherein the medical condition is selected from the group consisting of a mood disorder, a depression, an anxiety, a stress, an impaired cognitive function, a panic attach, a compulsive behavior, an addiction, a social phobia, a sleep disorder and a food related disorder, the method comprising administering to said subject at least one microRNA selected from the group consisting of miR-135, wherein saidmiR-135 comprises a modification selected from the group consisting of a modified backbone, a modified internucleoside linkage and a modified base, with the teachings of Kelnar -the therapeutic use of modified mimetic double stranded miR-124, that has enhanced resistance to nuclease digestion, and/or functionality, the teachings of Califano SEQ ID NO 40 and the teachings of Montefeltro –a conjugate comprising a siRNA specific for the serotonin 5-HT1A receptor linked to a specific serotonin-transporter inhibitor sertraline; for someone skilled in the art would have been obvious to use these teachings to achieve the predictable result of developing a modified double-stranded miR-135 linked to sertraline for inhibition of serotonin uptake receptor.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to try to develop a modified doubled-stranded miR-135 linked to sertraline for the treatment of depression-related disorder.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JULIO GOMEZ RODRIGUEZ whose telephone number is (571)270-0991. The examiner can normally be reached Monday - Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 5712722916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JULIO WASHINGTON GOMEZ RODRIGUEZ/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637