Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application is a CIP of PCT/CN2022/073321 filed 01/21/2022. PCT/CN2022/073321 claims foreign priority to CN202110133128.5 filed 02/01/2021. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e).
Failure to provide a certified translation may result in no benefit being accorded for the non-English application.
Election/Restrictions
Applicant’s election without traverse of Group I, consisting of claims 1-16, in the reply filed on 07/28/2026 is acknowledged. Claims 17-19 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Groups II and III, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 07/28/2026. Claim 1 is now the only independent claim. Claims 1-16 are under examination.
Specification
The specification is objected to because the use of improperly demarcated trademarks has been noted in this application. Although the use of trademarks is permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner that might adversely affect their validity as trademarks. See MPEP §608. 01(v). 9. Examples of such an improperly demarcated trademarks “Illumina”, “Zymo” and “Qiagen” which appears in the present specification in paragraphs [0045], [0051], and [0051], respectively. Examiner notes that the provided examples are not meant to be a complete list of improperly demarcated trademarks found in the present specification. Applicant should review the entire specification and correct all instances of improperly demarcated trademarks. Appropriate corrections required. Each letter of a trademark should be capitalized or otherwise the trademark should be demarcated with the appropriate symbol indicating its proprietary nature (e.g., ™, ©, ®) and accompanied by generic terminology. Applicants may identify trademarks using the USPTO's trademark database. Trademark Electronic Search System (TESS), on the Internet at https://tmsearch.uspto.go
Claim Objections
Claim 7 is objected to because of the following informalities: typographical errors.
Claim 7 recites “(3) inactivating the protease and optionally purifying the lysate or diluting the lysate to eleminate any factor from inhibition on the subsequent reaction” which should recite “(3) inactivating the protease and optionally purifying the lysate or diluting the lysate to eliminate any factor from inhibition on the subsequent reaction”
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 7, 9, and 15 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 7 recites the broad recitation “(2) lysing each single cell in its tube with a lysis buffer or protease”, and the claim also recites “(3) inactivating the protease” regardless of which alternative was employed in step (2), which is the narrower statement of the range/limitation. When step (2) is performed using only a lysis buffer without a protease, step (3) is rendered internally inconsistent, as there is no protease to inactivate. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Furthermore, the term “aimed range” in claim 7 is a relative term which renders the claim indefinite. The term “aimed” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. While the claim subsequently recites “300bp – I000bp or any range in between” the modifier “aimed” introduces uncertainty as to whether the recited size range is a target, an approximation, or a hard boundary, such that the metes and bounds of the claim cannot be determined with reasonable certainty.
Claim 9 contains the trademark/trade name Illumina. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a next generation sequencing platform and, accordingly, the identification/description is indefinite.
Claim 15 contains the trademark/trade names Zymo and Qiagen. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe lysis buffer reagents, and, accordingly, the identification/description is indefinite.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-3 are rejected under 35 U.S.C. 102(a)(1)/102(a)(2) as being anticipated by Gunderson et al. (US 2018/0273933 Al published Sep. 27, 2018).
In regards to claim 1, Gunderson teaches a method for construction of a medium-throughput sequencing library, comprising: providing sorted single cells (see Gunderson [0134] discloses sorting single cells and capturing individual single cells in individual droplets or vessels); independently lysing each single cell to fully expose a genomic DNA (gDNA) of the single cells (see Gunderson [0127], [0135], [0179]); tagmenting the gDNA and conducting sample-specific DNA labeling to obtain the whole set of fragmented gDNAs labeled with a cell-specific barcode in a given cell, while each cell has a different barcode (see Gunderson [0114], [0188]-[0192] disclosing that barcodes or indexes are attached to genomic DNA through tagmentation using transposases complexes); and pooling the labeled fragmented gDNAs of a plurality of single cells to collectively construct a sequencing library for subsequent sequencing (see Gunderson [0183], [0186]), wherein Tn5 transposome is used to tagment the gDNA in the single cell and label each gDNA fragments with a barcode (see Gunderson [0188]-[0192]); and further, after next-generation sequencing (NGS) is completed with the constructed sequencing library, data output is analyzed by a relevant program and method to determine the DNA copy number profile over the whole genome of each cell (see Gunderson [0186] disclosing sequencing the pooled barcoded library and [0127], [0136] disclosing that the sequencing information can reveal mutations associated with cancer, genetic heterogeneity, and copy number information).
In regards to claim 2, Gunderson discloses that indexed transposome complexes are assembled by annealing an indexed oligonucleotide comprising a P5 or P7 sequences, a unique index sequence, and a mosaic end (ME) sequence (corresponding to Primer B or C) to a universal 5’ phosphorylated ME complementary oligonucleotide (corresponding to primer A, the phosphorylated strand partially complementary to the indexed adapter strand) (see Gunderson [0189]). The resulting double-stranded transposon end is then assembled with Tn5 transposase to form the transposome complex.
In regards to claim 3, Gunderson explicitly discloses that the indexed oligonucleotides used in the transposome comprise P7 sequences linked to a unique index sequence and the ME sequence, directly corresponding to the Primer A architecture annealed to a universal 5’ phosphorylated ME complementary oligonucleotide (corresponding to Primer C), and an oligonucleotide comprising a P5 sequence and an ME sequence (corresponding to Primer B) annealed to the same universal phosphorylated ME complementary oligonucleotide (see Gunderson [0189]-[0190]). Both duplexes are assembled with Tn5 transposase to form the complete transposome complex. Claim 3 is therefore anticipated by Gunderson.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-16 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al. (CN110886021B, published Mar. 17, 2020) in view of Gunderson et al. (US 2018/0273933 Al published Sep. 27, 2018).
In regards to claims 1 and 15, Wang discloses a method for constructing a single-cell copy number variation sequencing library (see Wang [0002]) comprising: providing sorted single cells individually depositing into separate reaction tubes or well (see Wang [0077]); independently lysing each single cell using Qiagen protease lysis buffer (see Wang [0075]-[0077], reading on claim 15 where Qiagen protease is recited as a lysis agent) to fully expose a genomic DNA (gDNA) of the single cells (see Wang [0077]); tagmenting the gDNA of each single cell using a Tn5 transposome assembled with double-stranded oligonucleotide adapters comprising the mosaic end (ME) sequences 5’- AGATGTGTATAAGAGACAG-3’ (corresponding to instant SEQ ID NO:51, see Wang [0078], [0161]); PCR amplification with P5 and P7 indexed primers, to introduce a barcode (see Wang [0050], [0133]); and pooling barcoded DNA fragments for sequencing on the Illumina HiSeq platform to generate copy number variation data (see Wang [0002], [0050], [0156]).
Wang discloses that the Tn5 transposome used in the double-adapter method comprises a first adapter (Primer B: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3’, comprising a P5 PCR handle and ME sequence) and a second adapter (Primer C: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3’, comprising a P7 PCR handle and ME sequence), which are structurally analogous to the Primer B and Primer C architecture recited in claims 2 and 3 of the instant application, and which comprised the P5 and P7 Illumina flow cell adapter sequences recited in claim 9 and the ME anchor sequences recited in claim 11.
Wang does not explicitly disclose a cell-specific barcode labeling incorporated into the Tn5 transposome adapter itself such that tagmentation of each single cell’s genomic DNA simultaneously labels each fragment with a cell-specific barcode. In Wang’s method the barcode is added during a separate downstream PCR amplification step using indexed Nextera primers (see Wang [0186]-[0188]).
Gunderson discloses a method of single-cell profiling in which a Tn5 transposome is assembled with adapter oligonucleotides comprising a cell-specific barcode sequence incorporated into the transposome adapter prior to tagmentation, such that tagmentation and cell-specific barcoding of each genomic DNA fragment occur simultaneously in a single step (see Gunderson [0188]- [0192]).
It would have been prima facie obvious to one of ordinary skill in the art at the time of filing to modify the method of Wang by incorporating the cell-specific barcode into the Tn5 transposome adapter as taught by Gunderson, such that tagmentation and barcoding occur simultaneously rather than sequentially. Both Wang and Gunderson operate in the same field of single-cell genomics using Tn5 transposase-based library preparation for use on an Illumina sequencing platform. Wang’s own specification identifies pooling of multiple barcoded samples for CNV sequencing as an explicit goal of the invention, and Gunderson teaches that incorporating the barcode into the transposome adapter achieves more efficient sample processing by combining the fragmentation and barcoding steps and “Advantageously, such indexing enables haplotype information to be obtained at higher concentrations of nucleic acid compared to the mere dilution of a nucleic acid in a single compartment to an amount equivalent to a hap lo type of the nucleic acid” (see Gunderson [0019]). A skilled artisan would have had a reasonable expectation of success because both references use the same Tn5 transposase chemistry and Illumina adapter architecture, such that substituting Wang’s unlabeled Tn5 transposome with barcoded transposome of the type taught by Gunderson constitutes a routine adaption of known techniques toward a known goal. See KSR Int’l Co. v. Teleflex Inc., 550 U.S. 398, 416, 82 USPQ2d 1385, 1395 (2007). As such, Claim 1 is unpatentable over Wang in view of Gunderson.
In regards to claims 2 and 3, Wang explicitly discloses the double adapter Tn5 transposome comprising Primer A (5’-[phos]- CTGTCTCTTATACACATCT-3’), Primer B (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3’), and Primer C ( 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3’) (see Wang [0060]-[0061], [0159]-[0169]). Wang’s Primer B and Primer C each comprises a P5 and P7 Illumina sequence linked to the ME sequence, directly corresponding to the Primer B architecture of claims 2 and 3. As set forth in the discussion of claim 1, the modification of Wang’s Primer A to incorporate a cell-specific barcode labeling sequences as taught by Gunderson would have been obvious (see Gunderson [0188]-[0192]). Claims 2 and 3 are therefore unpatentable over Wang in view of Gunderson.
In regards to claim 4, the claim recites Primer A sequences (SEQ ID NOs: 1-48), each comprising a cell-specific barcode labeling sequence. Wang discloses that primers for recognizing the sequencing adapter may contain a tag (barcode) sequence of 6-16 nucleotides which may be a defined sequence specific to a particular sample (see Wang [0030]-[0033]). As set forth in the discussion of claim 1, it would have been obvious to incorporate such cell-specific barcode sequences into the Tn5 transposome adapter in view of Gunderson. The selection of specific 8-nucleotide barcode sequences represents routine design choice within the skill in the art. See In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
In regards to claim 5, the claim recites that Primer B has a sequence corresponding to SEQ ID NO:49 (gtctcgtcga cgactgggct cgagatgtgt ataagagaca g). Wang discloses a Primer B comprising a P5 PCR handle linked to the ME sequences (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3’) (see Wang [0161]), which shares the ME sequence at its 3’ end with SEQ ID NO: 49 but differs in the PCR handle region. The specific PCR handle sequence recited in SEQ ID NO: 49 is not disclosed by Wang or Gunderson. However, the selection of a specific PCR handle sequence for use in a Tn5 transposome adapter constitutes routine design choice within the skill of the art, as PCR handle sequences are interchangeable functional elements whose specific nucleotide compositions does not affect the fundamental tagmentation and barcoding method. The particular PCR handle sequences recited in SEQ ID NO: 49 represents obvious routine optimization of a known functional element. See In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
In regards to claim 6, Wang explicitly discloses Primer A (5’-[phos]- CTGTCTCTTATACACATCT-3’), which is the phosphorylated reverse complement of the ME sequence and directly corresponds to SEQ ID NO: 50 as recited in claim 6.
In regards to claim 7, the claim recite the detailed step-by-step method of library construction. Wang explicitly discloses each of steps (1) through (3) and steps (5) through (7): distributing single cells into individual PCR tubes (see Wang [0077], [0178]), lysing each cell with protease lysis buffer and heat-inactivating the protease (see Wang [0075]-[0077], [0175]-[0178]), Tn5 tagmentation of the single-cell genomic DNA (see Wang [0079]-[0082], [0179]-[0183]), pooling samples (see Wang [0050], [0156]), PCR amplification with indexed P5/P7 primers (see Wang [0185]-[0196]), and magnetic bead purification and size selection of the library (see Wang [0094]-[0101], [0196]-[0202]). Step (4) of claim 7, tagmentation with a Tn5 transposome having a cell-specific barcode incorporated into the adapter, is supplied by Gunderson for the reasons set forth in the discussion of claim 1.
In regards to claim 8, Wang discloses that the adapter oligonucleotides comprising the ME anchor sequences are inserted into the genomic DNA during Tn5 mediated tagmentation, adding the anchor sequence to the 5’ terminus of each insert fragment (see Wang [0079]-[0082], [0161]-[0162]). Wang further discloses that the P5 and P7 Illumina adapter sequences and the i5/i7 index sequences are added during subsequent PCR amplification using indexed Nextera primers (see Wang [0186]-[0188]). Gunderson discloses that the cell-specific barcode is incorporated into the Tn5 transposome adapter such that the barcode is added to the 5’ terminus of each insert fragment simultaneously with the anchor sequence during tagmentation (see Gunderson [0188]-[0192]). The combination of Wang and Gunderson therefore discloses the two-step construction process recited in claim 8, barcode and anchor sequences added during tagmentation, followed by addition of NGS adapter and index sequences during PCR amplification. Wang discloses Primer B (5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3’) comprising the P5 sequencing primer binding site and ME anchor sequence, and Primer C (5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3’) comprising the P7 sequencing primer binding site and ME anchor sequence, both incorporated into the Tn5 transposome (see Wang [0161]-[0162]). Wang further discloses Nextera P5 primer (5’- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC-3’) and Nextera P7 primer (5’- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG) used during PCR amplification (Wang [0187]-[0188]). These elements, taken together with the cell-specific barcode incorporated into the transposome adapter as taught by Gunderson, produce and amplified library fragment having the complete 5’ to 3’ structure recited in claim 8: P5 adapter sequence, the first index sequence, the first sequencing primer binding site, the cell barcode sequence, the anchor sequence, the insert DNA fragment, the second sequencing primer binding site, the second index sequence, and the P7 adapter sequence. Claim 8 is therefore unpatentable over Wang in view of Gunderson.
In regards to claim 9, Wang explicitly discloses sequencing on the Illumina HiSeq platform (see Wang [0028], [0155]-[0156], [0210]).
In regards to claim 10, Wang discloses that the tag sequence incorporated into the sequencing library may be a defined sequence specific toa particular sample or an undefined sequences having 5n possibilities when n is the tag length, encompassing the concept of a random nucleotides positioned within a barcode region (see Wang [0030]-[0033]). The use of defined random nucleotides with a fixed barcode sequence for sequencing library diversity was well-known in the art as a routine barcode design practice. The specific range of 2-5 random nucleotides and 1 to 18 fixed barcode nucleotides represents routine optimization of known barcode design parameters within ranges known in the art and disclosed by Wang.
In regards to claim 11, Wang explicitly discloses this identical ME sequence as the transposase recognition sequence incorporated into both Primer B and Primer C of the double-adapter Tn5 transposome (see Wang [0018], [0161]-[0162]).
In regards to claim 12, Wang explicitly discloses the P5/P7 adapter sequences (see Wang [0133], [0187]-[0188]), the ME sequences (see Wang [0018], [0161]-[0162]), and the indexed primer architecture. Gunderson discloses the incorporation of a cell-specific barcode between the PCR handle sequence and the ME sequence within the transposome adapter (see Gunderson [0188]-[0192]), which together with Wang’s disclosed sequences produces the complete library structure recited in claim 12. Claim 12 is therefore unpatentable over Wang in view of Gunderson.
In regards to claim 13, Wang explicitly discloses the use of 100 HeLa cells as a positive control in the library construction method (see Wang [0077], [0178]). The claimed range of 2 to 1000 cells directly encompasses this positive control and represents an obvious scaling of the disclosed method. No unexpected results are associated with varying the number of input cells within this range when the fundamental method is otherwise unchanged. See In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
In regards to claim 14, Wang discloses that the invention uses picogram level single-cell genomic DNA as template material (see Wang [0050], [0077]). The substitution of intact single cells with purified extracted gDNA as the starting material eliminates only the lysis step while leaving the downstream tagmentation and library construction steps unchanged. Tn5 tagmentation or purified bulk gDNA was the original and well-established application of this technology as acknowledged in Wang’s background section (see Wang [0006]). It would therefore have been obvious to substitute purified gDNA for intact single cells in the combined method of Wang and Gunderson with a reasonable expectation of success.
In regards to claim 16, Wang discloses a method of constructing a single-cell whole genome sequencing library and sequencing the library to generate copy number variation data (see Wang [0001]-[0003], [0050], [0155]-[0156]). Wang explicitly discloses that the invention is applicable to the study of copy number variation in single cells including circulating tumor cells, and that the method is useful for identifying genetic heterogeneity within tumors and discovering cellular subclones (see Wang [0003], [0050]). Wang further discloses sequencing the library on the Illumina HiSeq platform and analyzing the resulting data to determine copy number variation (see Wang [0155]-[0156]). The downstream analysis of sequencing data to determine copy number profiles necessarily involves the use of analysis software, algorithms, databases, and visualization schemes, all of which were well known and routine component of NGS data analysis pipelines in the art at the time of filing.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Matthew H Raymonda whose telephone number is (703)756-5807. The examiner can normally be reached Monday - Friday 10:00 am - 4:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached at 571-272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MATTHEW HAROLD RAYMONDA/Examiner, Art Unit 1684 /AARON A PRIEST/Primary Examiner, Art Unit 1681
Prosecution Insights