DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This Office action is in response to the communication filed 11-20-25.
Claims 1-42 are pending in the instant application.
Election/Restrictions
Claims 17, 18, 20-42 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention or species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11-20-25.
Applicant’s election without traverse of Group I, one or more point mutations, and Cas9, claims 1-16 and 19, in the reply filed on 11-20-25 is acknowledged.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6, 7 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 6 and 7 recite ratios of “between about” and “about”. This language renders the claims vague and indefinite.
Appropriate correction is required.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-16, 19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The breadth of the claims
The claims are broadly drawn to systems for gene editing comprising any CRISPR associated protein (CAS) or a first Cas nucleotide sequence encoding a Cas polypeptide, any nuclease deficient Cas (dCas) polypeptide or a second Cas nucleotide sequence encoding a dCas polypeptide; and a guide nucleotide sequence encoding or comprising a crRNA sequence capable of hybridizing with a first target sequence on a first allele and a second target sequence on a second allele and forming a complex with the Cas polypeptide and the dCas polypeptide, which Cas polypeptide binds to the first target sequence on the first allele and induces genetic modification in the first target sequence, and which dCas polypeptide binds to the second target sequence on the second allele and protects the second target sequence from modification and from activity of the Cas polypeptide, which first target sequence comprises one or more mutations optionally comprising a stop codon, a point mutation, a deletion or an insertion, and which second target sequence is optionally identical to the first target sequence, which Cas and dCas polypeptides optionally belong to different CRISPR CAS families, or optionally comprises Cas9, Cpf1, Cas12a, Cas12e, CasX, Cas12d, CasY, Cas12b, C2C1, C2C7, C2C8, C2C9, C2C10, Cas13a, Cas13b, or Cas13c nuclease, or which Cas9 nuclease optionally comprises Streptococcus pyogenes, Staphylococcus aureus, Neisseria meningitidis, Actinomyces naeslundii, or Streptococcus thermophilus Cas9, which Cas:dCas optionally have a ratio of from 1:100 to 100:1 and are optionally on the same vector.
The teachings in the specification are not representative of the large genus of Cas molecules or mutants thereof as instantly claimed.
Teachings in the specification
The specification teaches on page 17:
In some embodiments, the dCas9 polypeptide from Streptococcus pyogenes comprises at least one mutation at position D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, A987 or any combination thereof… The dCas9 enzyme can contain a mutation at D10, E762, H983 or D986, as well as a mutation at H840 or N863. In some instances, the dCas9 enzyme contains a D10A or D10N mutation. Also, the dCas9 enzyme can include a H840A, H840Y, or H840N. In some embodiments, the dCas9 enzyme of the present invention comprises D10A and H840A; D10A and H840Y; D10A and H840N; D10N and H840A; D10N and H840Y; or D10N and H840N substitutions.
The specification also teaches the following examples:
Example 1
Cas9 proteins used in the following experiments are Alt-R® S.p. HiFi Cas9 Nuclease V3 (catalog number 1081061 or 1081060 or 10007803 (IDT)) and Alt-R® S.p. dCas9 Protein V3 (catalog number 1081066 or 1081067 (IDT)). Ultramer donor oligos were synthesized and purified
desired changes to make in the targeted allele) (SEQ ID NO: 1).
The sgRNA (C473) was synthesized with this 20 nt Cas9 spacer sequence TCTTTATGCGCAGTGCGGTG (SEQ ID NO: 2) … as a full-length sgRNA.
HifiCas9 and dCas9 were mixed at indicated ratios with 6-fold molar excess sgRNA and electroporated or microinjected into C576BL/6J mouse embryos. Electroporated/microinjected embryos were transferred into pseudopregnant mouse recipients and embryos were carried to term. Live born mice were genotyped for the presence of mutated alleles by PCR using …primers.
EXAMPLE 2
This Example demonstrates generating a mouse model using the disclosed system, as shown in FIG. 1. The results of a series of attempts to generate a mouse model of hereditary hemorrhagic telangiectasia by introducing a stop codon at amino acid position 478…
FIG. 2. Electroporating or microinjecting the Cas9-sgRNA and donor oligo resulted in very few live births, indicating modifications were being made to the locus which caused embryonic lethality (example of malformed embryo in FIG. 3). Upon use of a Cas9:dCas9 ratio of 1:4, there was a significant increase in the number of live animals born with any type of mutation (example of malformed embryo in FIG. 3). Sequence alignments reveals successful gene editing of the Acvrl1 locus to create the R478X allele. The R478X allele is a stop codon which prematurely terminates translation of Acvrl1 NGS sequencing of the single founder from Experiment 3, dAS- CRISPR 1, showing the R478X mutation at a detectable frequency (SEQ ID NO: 14) and an intact wild-type allele (SEQ ID NO: 12), necessary for survival.
Experiment 4, dASCRISPR 4, showing the R478X mutation at a detectable frequency in each founder and an intact wild-type allele (WT), which is necessary for survival. Other mutations (deletions, insertions,+; sequence changes, X>Y) are indicated. Upon further analysis, we found mice that harbored the R478X change at the Acvrl1 locus. Founder # 172 from experiment dAS- CRISPR 1 was bred and transmitted the R478X allele. Founders from dAS-CRISPR 2 are also being tested for germline transmission.
The method outlined in this invention preserves one intact wildtype allele, which allows the cell or embryo to survive. This is done using dCas9, which is a catalytically inactivated Cas9 protein that retains its function to bind CRISPR gRNAs and to strongly bind to DNA, hence sequestering or blocking one allele from the action of an active nuclease Cas9. The inventors accomplish this by adjusting the ratio of functional Cas9:dCas9. When a mixture of 20% functional Cas9 and 80% dCas9 is used, the desired research model can be generated. Reagents are introduced into by electroporation into 1-cell embryos or injected into a single cell of a 2-cell embryo (to prevent modifying the entire embryo). Precise modifications were only obtained when dCAS9 was utilized in conjunction with functional Cas9. dasCRISPR is a novel method to control the activity of Cas9 and allow successful creation of research models that may present a challenge with traditional CRISPR methods. Commercial enterprises that create mouse models would benefit from this method, allowing successful completion of projects. By protecting 1 of the 2 copies of a gene in vivo using dasCRISPR, a genetic change can be made that would otherwise be deleterious if both copies of the gene are modified. The same can be surmised for gene editing done in cell lines, which is a major service performed by biotech companies worldwide and in university facilities. Therapeutic gene editing would also benefit as this method could block access to some off-target sites by Cas protein and act as a brake in the gene editing process limiting modification to one allele while leaving the other off-target sites unaffected, when necessary. Some potential examples include: reduction of p53 activation by blocking sites, repairing only one allele; reduction of DNA damage response (DDR) by blocking cleavage at both alleles; or reduction of low specificity targeting in hematopoietic stem cells.
There are several applications for this method in production of research models and in therapeutic gene editing. 25-30% of gene knockouts in mouse, for example, lead to embryonic lethality, more when considering perinatal lethality and 7% result in infertility. These are barriers to propagation of research cell lines and animal models. By protecting 1 of the 2 copies of a gene in vivo using dasCRISPR, a genetic change can be made that would otherwise be deleterious if both copies of the gene are modified. The same can be surmised for gene editing done in cell lines, which is a major service performed by biotech companies worldwide and in university facilities.
The specification fails to provide the requisite guidance for making and using the large genus of Cas and/or dCas molecules instantly claimed. Since the disclosure fails to describe the common attributes and characteristics concisely identifying members of the proposed genus of Cas and dCas polypeptides, and because the claimed genus is highly variant, the description provided is insufficient, one of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the broad genus of Cas molecules and mutants instantly claimed.
Thus, Applicant was not in possession of the broadly claimed genus.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1-16 and 19 is/are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Zhang et al (WO 2020/051507).
Zhang et al (WO 2020/051507) teach systems for gene editing comprising a CRISPR associated protein (CAS) or a first Cas nucleotide sequence encoding a Cas polypeptide, a nuclease deficient Cas (dCas) polypeptide or a second Cas nucleotide sequence encoding a dCas polypeptide; and a guide nucleotide sequence encoding or comprising a crRNA sequence capable of hybridizing with a first target sequence on a first allele and a second target sequence on a second allele and forming a complex with the Cas polypeptide and the dCas polypeptide, which Cas polypeptide binds to the first target sequence on the first allele and induces genetic modification in the first target sequence, and which dCas polypeptide binds to the second target sequence on the second allele and protects the second target sequence from modification and from activity of the Cas polypeptide, which first target sequence comprises one or more mutations optionally comprising a stop codon, a point mutation, a deletion or an insertion, and which second target sequence is optionally identical to the first target sequence, which Cas and dCas polypeptides optionally belong to different CRISPR CAS families, or optionally comprises Cas9, Cpf1, Cas12a, Cas12e, CasX, Cas12d, CasY, Cas12b, C2C1, C2C7, C2C8, C2C9, C2C10, Cas13a, Cas13b, or Cas13c nuclease, or which Cas9 nuclease optionally comprises Streptococcus pyogenes, Staphylococcus aureus,. Zhang teaches the stoichiometries of Cas9:dCas instantly claimed and compositions for target cell delivery (see esp. the abstract, pages 3-4, 8-9, Figures 1-6, pages 13, 21, 45, 54-59, 66, 67, 71-92, 99, 107, 112112-116, 121, 125, 135, 183).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1-16 and 19 are is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (WO 2020/051507) in view of Odate et al (CA 3047415).
The claims are broadly drawn to systems for gene editing comprising any CRISPR associated protein (CAS) or a first Cas nucleotide sequence encoding a Cas polypeptide, any nuclease deficient Cas (dCas) polypeptide or a second Cas nucleotide sequence encoding a dCas polypeptide; and a guide nucleotide sequence encoding or comprising a crRNA sequence capable of hybridizing with a first target sequence on a first allele and a second target sequence on a second allele and forming a complex with the Cas polypeptide and the dCas polypeptide, which Cas polypeptide binds to the first target sequence on the first allele and induces genetic modification in the first target sequence, and which dCas polypeptide binds to the second target sequence on the second allele and protects the second target sequence from modification and from activity of the Cas polypeptide, which first target sequence comprises one or more mutations optionally comprising a stop codon, a point mutation, a deletion or an insertion, and which second target sequence is optionally identical to the first target sequence, which Cas and dCas polypeptides optionally belong to different CRISPR CAS families, or optionally comprises Cas9, Cpf1, Cas12a, Cas12e, CasX, Cas12d, CasY, Cas12b, C2C1, C2C7, C2C8, C2C9, C2C10, Cas13a, Cas13b, or Cas13c nuclease, or which Cas9 nuclease optionally comprises Streptococcus pyogenes, Staphylococcus aureus, Neisseria meningitidis, Actinomyces naeslundii, or Streptococcus thermophilus Cas9, which Cas:dCas optionally have a ratio of from 1:100 to 100:1 and are optionally on the same vector.
Zhang et al (WO 2020/051507) teach systems for gene editing comprising a CRISPR associated protein (CAS) or a first Cas nucleotide sequence encoding a Cas polypeptide, a nuclease deficient Cas (dCas) polypeptide or a second Cas nucleotide sequence encoding a dCas polypeptide; and a guide nucleotide sequence encoding or comprising a crRNA sequence capable of hybridizing with a first target sequence on a first allele and a second target sequence on a second allele and forming a complex with the Cas polypeptide and the dCas polypeptide, which Cas polypeptide binds to the first target sequence on the first allele and induces genetic modification in the first target sequence, and which dCas polypeptide binds to the second target sequence on the second allele and protects the second target sequence from modification and from activity of the Cas polypeptide, which first target sequence comprises one or more mutations optionally comprising a stop codon, a point mutation, a deletion or an insertion, and which second target sequence is optionally identical to the first target sequence, which Cas and dCas polypeptides optionally belong to different CRISPR CAS families, or optionally comprises Cas9, Cpf1, Cas12a, Cas12e, CasX, Cas12d, CasY, Cas12b, C2C1, C2C7, C2C8, C2C9, C2C10, Cas13a, Cas13b, or Cas13c nuclease, or which Cas9 nuclease optionally comprises Streptococcus pyogenes, Staphylococcus aureus,. Zhang teaches the stoichiometries of Cas9:dCas instantly claimed and compositions for target cell delivery (see esp. the abstract, pages 3-4, 8-9, Figures 1-6, pages 13, 21, 45, 54-59, 66, 67, 71-92, 99, 107, 112112-116, 121, 125, 135, 183).
Odate et al (CA 3047415) teach compositions comprising Cas nucleases, including Cas9, Cpf1 nucleases, Cas nickases and inactivated forms of Cas, termed dCas DNA binding agents. Odate teaches the administration of vectors comprising Cas9, nickases, and dCas DNA binding agents to subjects having non-wildtype gene sequences involved in pathological conditions (see esp. para 0020, 0040, 0041, 0056-0059, 0090, 0092-0098).
It would have been obvious to make compositions comprising a Cas nuclease in combination with a deactivated Cas nuclease, because both Zhang and Odate have taught the molecules instantly claimed and their use in targeting mutant genes for therapeutic application. Various mutants of Cas nucleases have been taught by Zhang and Odate, and vectors for delivery comprising both functional and deactivated Cas nucleases were previously disclosed and well known in the art prior to the effective filing date of the instant application.
For these and the aforementioned reasons, the instant invention would have been obvious to one of ordinary skill in the art prior to the effective filing date of the instant application.
Conclusion
Certain papers related to this application may be submitted to Art Unit 1637 by facsimile transmission. The faxing of such papers must conform with the notices published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 C.F.R. ' 1.6(d)). The official fax telephone number for the Group is 571-273-8300. NOTE: If Applicant does submit a paper by fax, the original signed copy should be retained by applicant or applicant's representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED so as to avoid the processing of duplicate papers in the Office.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jane Zara whose telephone number is (571) 272-0765. The examiner’s office hours are generally Monday-Friday, 10:30am - 7pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Jennifer Dunston, can be reached on (571)-272-2916. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (703) 308-0196.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
Jane Zara
1-6-26
/JANE J ZARA/Primary Examiner, Art Unit 1637