Prosecution Insights
Last updated: July 17, 2026
Application No. 18/245,256

SYSTEMS FOR GENE EDITING AND METHODS OF USE THEREOF

Final Rejection §112
Filed
Mar 14, 2023
Priority
Sep 15, 2020 — provisional 63/078,449 +2 more
Examiner
ZARA, JANE J
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Rutgers, The State University of New Jersey
OA Round
2 (Final)
71%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
87%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
776 granted / 1096 resolved
+10.8% vs TC avg
Strong +16% interview lift
Without
With
+16.1%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
47 currently pending
Career history
1139
Total Applications
across all art units

Statute-Specific Performance

§101
2.1%
-37.9% vs TC avg
§103
43.4%
+3.4% vs TC avg
§102
12.0%
-28.0% vs TC avg
§112
19.4%
-20.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1096 resolved cases

Office Action

§112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This Office action is in response to the communication filed 4-28-26. Claims 1-12, 16-41 and 43 are pending in the instant application. Claims 17, 18, 20-41 and 43 are withdrawn as being drawn to unelected inventions or species. Claims 1-12 and 16 and 19 have been examined on their merits as set forth below. Response to Arguments and Amendments Withdrawn Rejections Any rejections not repeated in this Office action are hereby withdrawn. Maintained Rejections The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-12, 16, and 19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention for the reasons of record set forth in the Office action mailed 1-29-26 and as set forth below. Applicant’s Arguments Applicant argues: …claims 1, 5-7, and 12 have been amended to recite "Cas9" and "dCas9." Claims 8-10 have been amended to recite "Cas9." Accordingly, amended independent claim 1 pertains to a Cas9 polypeptide or a first Cas9 nucleotide sequence encoding a Cas9 polypeptide and a nuclease- deficient Cas9 (dCas9) polypeptide or a second Cas9 nucleotide sequence encoding a dCas9 polypeptide. Examples 1 and 2 of the Specification pertain to the use of Cas9 and dCas9 in the claimed system. Indeed, the Office Action cites these Examples. Response to Applicant’s Arguments The breadth of the claims: The claims are broadly drawn to systems for gene editing comprising any CRISPR associated 9 protein (CAS9) or a first Ca9s nucleotide sequence encoding a Cas9 polypeptide, any nuclease deficient Cas9 (dCas9) polypeptide or a second Cas nucleotide sequence encoding a dCas9 polypeptide; and a guide nucleotide sequence encoding or comprising a crRNA sequence capable of hybridizing with a first target sequence on a first allele and a second target sequence on a second allele and forming a complex with the Cas9 polypeptide and the dCas9 polypeptide, which Cas9 polypeptide binds to the first target sequence on the first allele and induces genetic modification in the first target sequence, and which dCas9 polypeptide binds to the second target sequence on the second allele and protects the second target sequence from modification and from activity of the Cas9 polypeptide, which first target sequence comprises one or more mutations optionally comprising a stop codon, a point mutation, a deletion or an insertion, and which second target sequence is optionally identical to the first target sequence, which Cas9 and dCas9 polypeptides optionally comprise Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Neisseria meningitidis Cas9 (NmCas9), Actinomyces naeslundii Cas9 (AnCas9), or Streptococcus thermophilus Cas9 (StCas9), which Cas:dCas optionally have a ratio of from 1:100 to 100:1 and are optionally on the same vector. As stated previously, and contrary to Applicant’s assertions, the teachings in the specification are not representative of the large genus of Cas molecules or mutants thereof as instantly claimed. Teachings in the specification: As stated previously, the specification teaches on page 17: In some embodiments, the dCas9 polypeptide from Streptococcus pyogenes comprises at least one mutation at position D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, A987 or any combination thereof… The dCas9 enzyme can contain a mutation at D10, E762, H983 or D986, as well as a mutation at H840 or N863. In some instances, the dCas9 enzyme contains a D10A or D10N mutation. Also, the dCas9 enzyme can include a H840A, H840Y, or H840N. In some embodiments, the dCas9 enzyme of the present invention comprises D10A and H840A; D10A and H840Y; D10A and H840N; D10N and H840A; D10N and H840Y; or D10N and H840N substitutions. The specification also teaches the following examples: Example 1 Cas9 proteins used in the following experiments are Alt-R® S.p. HiFi Cas9 Nuclease V3 (catalog number 1081061 or 1081060 or 10007803 (IDT)) and Alt-R® S.p. dCas9 Protein V3 (catalog number 1081066 or 1081067 (IDT)). Ultramer donor oligos were synthesized and purified desired changes to make in the targeted allele) (SEQ ID NO: 1). The sgRNA (C473) was synthesized with this 20 nt Cas9 spacer sequence TCTTTATGCGCAGTGCGGTG (SEQ ID NO: 2) … as a full-length sgRNA. HifiCas9 and dCas9 were mixed at indicated ratios with 6-fold molar excess sgRNA and electroporated or microinjected into C576BL/6J mouse embryos. Electroporated/microinjected embryos were transferred into pseudopregnant mouse recipients and embryos were carried to term. Live born mice were genotyped for the presence of mutated alleles by PCR using …primers. EXAMPLE 2 This Example demonstrates generating a mouse model using the disclosed system, as shown in FIG. 1. The results of a series of attempts to generate a mouse model of hereditary hemorrhagic telangiectasia by introducing a stop codon at amino acid position 478… FIG. 2. Electroporating or microinjecting the Cas9-sgRNA and donor oligo resulted in very few live births, indicating modifications were being made to the locus which caused embryonic lethality (example of malformed embryo in FIG. 3). Upon use of a Cas9:dCas9 ratio of 1:4, there was a significant increase in the number of live animals born with any type of mutation (example of malformed embryo in FIG. 3). Sequence alignments reveals successful gene editing of the Acvrl1 locus to create the R478X allele. The R478X allele is a stop codon which prematurely terminates translation of Acvrl1 NGS sequencing of the single founder from Experiment 3, dAS- CRISPR 1, showing the R478X mutation at a detectable frequency (SEQ ID NO: 14) and an intact wild-type allele (SEQ ID NO: 12), necessary for survival. Experiment 4, dASCRISPR 4, showing the R478X mutation at a detectable frequency in each founder and an intact wild-type allele (WT), which is necessary for survival. Other mutations (deletions, insertions,+; sequence changes, X>Y) are indicated. Upon further analysis, we found mice that harbored the R478X change at the Acvrl1 locus. Founder # 172 from experiment dAS- CRISPR 1 was bred and transmitted the R478X allele. Founders from dAS-CRISPR 2 are also being tested for germline transmission. The method outlined in this invention preserves one intact wildtype allele, which allows the cell or embryo to survive. This is done using dCas9, which is a catalytically inactivated Cas9 protein that retains its function to bind CRISPR gRNAs and to strongly bind to DNA, hence sequestering or blocking one allele from the action of an active nuclease Cas9. The inventors accomplish this by adjusting the ratio of functional Cas9:dCas9. When a mixture of 20% functional Cas9 and 80% dCas9 is used, the desired research model can be generated. Reagents are introduced into by electroporation into 1-cell embryos or injected into a single cell of a 2-cell embryo (to prevent modifying the entire embryo). Precise modifications were only obtained when dCAS9 was utilized in conjunction with functional Cas9. dasCRISPR is a novel method to control the activity of Cas9 and allow successful creation of research models that may present a challenge with traditional CRISPR methods. Commercial enterprises that create mouse models would benefit from this method, allowing successful completion of projects. By protecting 1 of the 2 copies of a gene in vivo using dasCRISPR, a genetic change can be made that would otherwise be deleterious if both copies of the gene are modified. The same can be surmised for gene editing done in cell lines, which is a major service performed by biotech companies worldwide and in university facilities. Therapeutic gene editing would also benefit as this method could block access to some off-target sites by Cas protein and act as a brake in the gene editing process limiting modification to one allele while leaving the other off-target sites unaffected, when necessary. Some potential examples include: reduction of p53 activation by blocking sites, repairing only one allele; reduction of DNA damage response (DDR) by blocking cleavage at both alleles; or reduction of low specificity targeting in hematopoietic stem cells. There are several applications for this method in production of research models and in therapeutic gene editing. 25-30% of gene knockouts in mouse, for example, lead to embryonic lethality, more when considering perinatal lethality and 7% result in infertility. These are barriers to propagation of research cell lines and animal models. By protecting 1 of the 2 copies of a gene in vivo using dasCRISPR, a genetic change can be made that would otherwise be deleterious if both copies of the gene are modified. The same can be surmised for gene editing done in cell lines, which is a major service performed by biotech companies worldwide and in university facilities. The specification fails to provide the requisite guidance for making and using the large genus of Cas and/or dCas molecules instantly claimed. Since the disclosure fails to describe the common attributes and characteristics concisely identifying members of the proposed genus of Cas and dCas polypeptides, and because the claimed genus is highly variant, the description provided is insufficient, one of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the broad genus of Cas molecules and mutants instantly claimed. Thus, Applicant was not in possession of the broadly claimed genus and the instant rejection is properly maintained. Conclusion THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Certain papers related to this application may be submitted to Art Unit 1637 by facsimile transmission. The faxing of such papers must conform with the notices published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 C.F.R. ' 1.6(d)). The official fax telephone number for the Group is 571-273-8300. NOTE: If Applicant does submit a paper by fax, the original signed copy should be retained by applicant or applicant's representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED so as to avoid the processing of duplicate papers in the Office. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jane Zara whose telephone number is (571) 272-0765. The examiner’s office hours are generally Monday-Friday, 10:30am - 7pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Jennifer Dunston, can be reached on (571)-272-2916. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (703) 308-0196. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). Jane Zara 5-30-26 /JANE J ZARA/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Mar 14, 2023
Application Filed
Jan 29, 2026
Non-Final Rejection mailed — §112
Apr 28, 2026
Response Filed
Jun 03, 2026
Final Rejection mailed — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12655430
HUMAN CHROMOSOME 9 OPEN READING FRAME 72 (C9ORF72) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
4y 0m to grant Granted Jun 16, 2026
Patent 12655436
IMPORT OF UNNATURAL OR MODIFIED NUCLEOSIDE TRIPHOSPHATES INTO CELLS VIA NUCLEIC ACID TRIPHOSPHATE TRANSPORTERS
3y 10m to grant Granted Jun 16, 2026
Patent 12644120
NUCLEIC ACID MOLECULE TARGETING MUTATION SITE OF CYP4V2 GENE AND USE THEREOF
3y 2m to grant Granted Jun 02, 2026
Patent 12618071
MULTIMERIC OLIGONUCLEOTIDES WITH DIVIDED STRANDS
3y 5m to grant Granted May 05, 2026
Patent 12612629
DUCHENNE MUSCULAR DYSTROPHY-RELATED EXONIC SPLICING ENHANCER, sgRNA AND GENE EDITING TOOL, AND APPLICATIONS
3y 1m to grant Granted Apr 28, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
71%
Grant Probability
87%
With Interview (+16.1%)
2y 10m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 1096 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month