Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group II, further electing Klebsiella pneumonia and SEQ ID NO: 232 in the reply filed on 8/28/2026 is acknowledged. Instant SEQ ID NO: 4, 5, and 6 have been examined in claims 18 and 19.
Claim 18, if it were amended to clearly require a primer pair comprising SEQ ID NO: 4 and SEQ ID NO: 5 would be free of the prior art. There is no suggestion to provide a primer pair comprising instant SEQ ID NO: 4 and SEQ ID NO: 5 in the prior art. The closest prior art, Brenton comprises a fragment of SEQ ID NO: 282 but does not comprise both of these primer sequences.
Information Disclosure Statement
The information disclosure statement filed 9/23/25 fails to comply with 37 CFR 1.98(a)(2), which requires a legible copy of each cited foreign patent document; each non-patent literature publication or that portion which caused it to be listed; and all other information or that portion which caused it to be listed. It has been placed in the application file, but the information lined through therein has not been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. See Figure 3.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 13-14 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural product without significantly more. The claim(s) recite(s) an isolated nucleic acid comprising SEQ ID NO: 232, a part of the sequence or a complementary sequence thereof. Each of these are fragments of the naturally occurring Klebsiella pneumonia genome and do not have any features that result in them being markedly different from the sequences in the K. pneumonia genome. This judicial exception is not integrated into a practical application because there are no elements in addition to the sequences. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because there are no additional elements.
Improper Markush Rejection
Claims 15-20 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of all of the different SEQ ID NO: is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons:
The molecules do not share a common structure that leads to their utility. The fact that they are all nucleic acids is not sufficient to lend to a common structure because not all nucleic acids are specific to any of the recited targets. It is the unique structure of each nucleic acid that leads to the asserted utility to detect a particular pathogen. The claimed group includes nucleic acids specific to many different pathogens, and so relative to one another they do not share a use. That is, some detect the elected Klebsiella pneumoniae while others are specific to other target pathogens.
Regarding the alternatives that are within a species, although these all share a common utility of being useful for detecting the respective species, they do not share a common structure. Each has a unique nucleotide sequence.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 15-20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
In claim 15, the language “primers for amplification of a pathogen specific nucleic acid fragments” is indefinite because it is not clear if the primers must be for one fragment or if the claim intends to require the primers for multiple fragments. The claim is interpreted as requiring primers for “a” fragment consistent with the requirement that they are to generate amplification “product” (singular).
It is not clear what it means for a crRNA to be “using” part of the amplification product as a target sequence- does “using” here mean capable of hybridizing to or does it mean “comprising” or does it mean something else entirely? There is no art accepted meaning for one nucleic acid “using” another.
The final wherein clause of claim 15 which recites the sequences of “a pathogen specific nucleic acid fragment” is unclear because the claim does not previously recite or require that one of these is the pathogen specific fragment to be amplified by the primers included in the kit. That is, claim 15 part (1) requires “primers for amplification of a pathogen specific nucleic acid fragments” but nothing in the claim connects the different recited fragments in the final “wherein” clause to the primers in part (1). As the claim is drafted, it is entirely unclear how the different fragments “corresponding” to different pathogens are meant to limit the claim; currently they appear not to be required. Furthermore, all the different potential pathogen specific fragments are listed and joined at the end with an “and” and even if it were clear that the claimed primers must amplify one of these fragments, it is further unclear if the claim is attempting to require primers in the kit for a pathogen specific fragment for each type of pathogen or if the presence of only one set of primers for “a” pathogen specific fragment is sufficient.
Claims 18 and 19 refer to, for example, “the primers used for amplification of a pathogen specific nucleic acid fragment of Klebsiella pneumoniae” and this phrase lacks proper antecedent basis because claim 15 does not recite or require primers for amplification of a pathogen specific nucleic acid fragment of Klebsiella pneumoniae. The same is true for each instance that begins “the primers used for” in claims 18 and 19, relative to the respective organism recited in each clause. Because there is no antecedent basis in the independent claim, it is unclear if these primers are required or optional or exemplary. Furthermore, the lengthy list of “the primers used” recitations is not joined with a conjunction and so it is not clear if these are alternatives or attempting to require all of the recited primer pairs (and in claim 19 target sequences). For this action, they are treated as alternatives and the primers and crRNA target relative to the elected embodiment are considered. With regard to “comprise sequences as set forth in” and “a sequence as set forth” it is not clear if this language is meant to require SEQ ID NO: 4 and SEQ ID NO: 5 and SEQ ID NO: 6 in their entirety, or merely primers that comprise any sequence “set forth in” the SEQ ID NO:, or in other words, comprise fragments. Further, even if the language intends to require the sequences in their entirety, it is not clear if the language is open claim language or closed. That is, it is unclear if primers consisting of or comprising the SEQ ID NO: intended to be claimed.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 20 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Since the sample is not a required element in the kit, but merely referred to in the claim, the further definition of the sample does not further limit the kit. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 13 and 14 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by US 6610836 B1, Brenton et al.
The reference teaches an isolated nucleic acid that comprises a complementary sequence of nucleotides 82-858 of instant SEQ ID NO: 282, see SEQ ID NO: 3157 nucleotides 1-777. The instant claims encompass fragments of any length, and they include any sequence that is “a complementary sequence” regardless of length or level of complementarity. The fragment comprised in the prior art sequence is not less than 60 nucleotides, therefore claims 13 and 14 are anticipated.
Claim 13 is rejected under 35 U.S.C. 102(b) as being anticipated by NEB catalog (1996/1997), pp. 111.
The claims are directed an isolated nucleic acid comprising “at least a part” of SEQ ID NO: 282 (consonant with the election), or a complementary sequence thereof. There is no minimum length limitation for the “a part” and “a complementary sequence thereof” does not require full complementarity. There are a multitude of sequences encompassed by the claim, particularly since the claim is also drawn using “comprising” language which means that a sequence which has “a part” of SEQ ID NO: 282 can be embedded in sequences that do not share identity with SEQ ID NO: 282.
The NEB catalog offered for sale a random primer mix of 12mer and 24mer nucleotide primers. As the calculation below shows, about 3.2 x 108 molecules of every 12-mer and about 9 molecules of every single 24 mer are present in each tube of the 24 nucleotide mixtures.
a. Molecular weight of 12-mer:
12 x 325 daltons/nucleotide = 3,900 daltons = 3,900 g/mol
b. Total number of possible 12-mers:
412 = 1.6 x 107 molecules
c. How many molecules of 12-mer in a vial sold by NEB:
1 A260 unit = 33 mg = 3.3 x 10-5 g
3.3 x 10-5 g / 3,900 g/mol = 8.4 x 10-9 mol
(8.4 x 10-9 mol) x (6.02 x 1023 molecules/mol) = 5 x 1015 molecules
d. How many molecules of each 12-mer in a single vial:
5 x1015 molecules / 1.6 x 107 molecules = 3.2 x 108 molecules of each 12-mer per vial
e. Molecular weight of 24-mer:
24 x 325 daltons/nucleotide = 7,800 daltons = 7,800 g/mol
f. Total number of possible 24-mers:
424 = 2.8 x 1014 molecules
g. How many molecules of 24-mer in a vial sold by NEB:
1 A260 unit = 33 mg = 3.3 x 10-5 g
3.3 x 10-5 g / 7,800 g/mol = 4.2 x 10-9 mol
(4.2 x 10-9 mol) x (6.02 x 1023 molecules/mol) = 2.5 x 1015 molecules
h. How many molecules of each 24-mer in a single vial:
2.5 x1015 molecules / 2.8 x 1014 molecules = 9 molecules/vial
The claims encompass a large genus of possible nucleic acid primers with no particular base composition or length. The NEB catalog kits inherently and necessarily contained 12 and 24 nucleotides primers encompassed by the claimed recitation, since every single 12mer and every single 24mer is present in the mixes.
Thus, the prior art inherently teaches each and every structural limitation of the instant claim.
Claim(s) 13, 14, 15, 16, and 18-20 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Xiao et al. (J ClinMicrobiol. Feb 2020. 58:e01368-19. https://doi.org/10.1128/JCM.01368-19.).
Xiao et al teaches a set of reagents that comprises primers for amplification of pathogen specific nucleic acid fragments and cas12a which is a nuclease of CRISPR/Cas family with trans cleavage activity, a cRNA to hybridize to the amplification products, and a single stranded DNA reporter molecule with a fluorescent group and a quencher group. See page 2. The instant specification does not define the term “kit” and this term is being interpreted to include a collection of reagents, which is taught by Xiao.
This rejection is being applied against claims 13 and 14 because the claim language requires a nucleic acid molecule comprising “a part” of SEQ ID NO: 282 (consonant with the election) where there is no size requirement as to how long the “part” must be. The primers taught by Xiao et al. read on nucleic acids that comprise “a part” where “a part” can be only one or two nucleotides. Furthermore, the amplification products taught by Xiao et al. read on nucleic acids comprising “a part” of SEQ ID NO: 282 and are greater than 60 nt in length.
This rejection is being applied against claim 15 because although the “wherein” clause recites “a pathogen specific nucleic acid fragment corresponding to Klebsiella pneumoniae” wherein SEQ ID NO: 282 is elected, the claim never recites that the fragments in the “wherein” clause are the options for the fragment referred to in part (1) of the claim.
Regarding claim 16, any of the target sequences taught in the reference comprise “a part” of SEQ ID NO: 282.
Regarding claims 18 and 19, the claims are indefinite, as discussed. Insofar as the recited primers SEQ ID NO: 4, 5, and cRNA comprising SEQ ID NO: 6 are optional, preferable or not required, or the claims encompass primers comprising fragments of unspecified length the reference reads on the claims. Clarification of the claim to clearly provide antecedent basis for the primers used for amplification of pathogen specific nucleic acid fragment of Klebsiella pneumoniae and to define the structure required more clearly would overcome this rejection.
Regarding claim 20, the sample does not change the elements in the kit.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 15-16 and 18-20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Brenton in view of Xiao.
Brenton teaches SEQ ID NO: 82, as discussed in the rejection for anticipation, this sequence comprises a fragment of SEQ ID NO: 282 and a complementary sequence.
Brenton further teaches that their SEQ ID NO: 82 corresponds to an entire coding sequence of a K. pneumoniae protein (Col. 2, line 46 and following). Brenton teaches substantially isolated nucleic acids that are fragments of the coding sequence, see Col. 8, line 3 and following. The reference further teaches primers for the amplification of K. pneumoniae nucleic acid. The primers are preferably twenty or more nucleotides in length from sequences in the sequence listing, which include SEQ ID NO: 82 disclosed therein. See Col. 20, lines 5-14. The reference teaches that the amplification products can be used in diagnostic assays to detect genes from K. pneumoniae, see Col. 20, line 20-23.
Following this, it would have been obvious to have selected primer pairs from within the SEQ ID NO: 82 taught by Brenton. One would have been motivated to do so by the direct teaching of Brenton of primers that are fragments of the disclosed sequences that can be used in diagnostic assays.
Any primer selected from within SEQ ID NO: 82 of Brenton would produce an amplicon comprising a fragment of instant SEQ ID NO: 282.
Brenton does not teach a kit that comprises all the elements of claim 15.
Xiao teaches a kit that comprises the elements of claim 15 for the detection of Mycobacterium species. See discussion under section 102 which is fully incorporated here. Furthermore, Xiao teaches that the method the reagents are used for is a promising tool for the rapid, accurate and cost-effective identification of the targeted pathogens (abstract).
It would have been prima facie obvious to have combined the primers taught by Brenton with the set of reagents taught by Xiao in order to provide a set of reagents for the rapid and accurate detection of K. pneumoniae. One would have been motivated to do so because Xiao teaches the benefits of the Cas12a/gRNA based platform, and Brenton specifically suggests PCR amplification of K. pneumoniae targets, including SEQ ID NO: 82 disclosed in that reference.
Claim(s) 17 is/are rejected under 35 U.S.C. 103 as being unpatentable over Xiao in viewo of Chen (Analyst, 2020, 145, 5226).
Claim(s) 17 is/are rejected under 35 U.S.C. 103 as being unpatentable over Brenton in view of Xiao as applied to claims 15-16 and 18-20 above, and further in view of Chen.
The teachings of Xiao as they were applied in the anticipation rejection and the teachings of Brenton in view of Xiao as they were applied in the obviousness rejection are fully incorporated here.
Xaio does not teach wherein the nuclease is lbCas12, neither does Brenton in view of Xiao.
Chen teaches that lbCas12a has collateral cleavage activity and exemplifies the use of this nuclease for the detection of amplification products produced by RPA.
It would have been obvious to have modified the set of reagents taught by Xiao OR the set of reagents taught by Brenton in view of Xiao to have substituted lbCas12a for the nuclease employed by Xiao. Such a modification would have been obvious as the substitution of one known element for the other to achieve the predictable outcome of providing a set of reagents (i.e. a kit) that could be used for detection of targets.
Requirement for Information
Applicant and the assignee of this application are required under 37 CFR 1.105 to provide the following information that the examiner has determined is reasonably necessary to the examination of this application.
In response to this requirement, provide the registered and posted complete research protocol, informed consent, case report form, researcher manual, and other information that was referenced in the IDS reference Wang et al. as having been “posted” in July 2019:
PNG
media_image1.png
129
581
media_image1.png
Greyscale
Provide the date the subject matter was posted and provide sufficient translation to determine whether instant SEQ ID NO: 282, SEQ ID NO: 4, 5, or 6, as well as the elements of part (2) of claim 15 were disclosed in the posted subject matter.
The timing fee and certification requirements of 37 CFR 1.97 are waived for those documents submitted in reply to the requirement. This waiver extends only to those documents within the scope of this requirement under 37 CFR 1.105 that are included in the applicant’s first complete communication responding to this requirement. Any supplemental replies subsequent to the first communication responding to this requirement and any information disclosures beyond the scope of this requirement under 37 CFR 1.105 are subject to the fee and certification requirements of 37 CFR 1.97 where appropriate.
The applicant is reminded that the reply to this requirement must be made with candor and good faith under 37 CFR 1.56. Where the applicant does not have or cannot readily obtain an item of required information, a statement that the item is unknown or cannot be readily obtained may be accepted as a complete reply to the requirement for that item.
This requirement is an attachment of the enclosed Office action. A complete reply to the enclosed Office action must include a complete reply to this requirement. The time period for reply to this requirement coincides with the time period for reply to the enclosed Office action.
Conclusion
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
WO2019048930A2 teaches a mutant bacterial sequence which comprises a sequence complementary to instant SEQ ID NO: 282, see nucleotides 9376-10610 of the prior art sequence SEQ ID NO: 82. An alignment of the two sequences is as follows:
RESULT 2
BGD28867/c
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
ID BGD28867 standard; DNA; 36316 BP.
XX
AC BGD28867;
XX
DT 02-MAY-2019 (first entry)
XX
DE MKP2_coc_1 mutant bacterial DNA sequence, SEQ ID 82.
XX
KW antiinflammatory; cholangitis; crohns disease; ds; gastrointestinal-gen.;
KW inflammatory bowel disease; mutant; therapeutic; ulcerative colitis.
XX
OS Klebsiella pneumoniae; Strain 2H7.
OS Synthetic.
XX
CC PN WO2019048930-A2.
XX
SQ Sequence 36316 BP; 7563 A; 10264 C; 11145 G; 7344 T; 0 U; 0 Other;
Query Match 97.5%; Score 1212.8; Length 36316;
Best Local Similarity 99.1%;
Matches 1233; Conservative 0; Mismatches 2; Indels 9; Gaps 1;
Qy 1 CCGTTTCGCTGACAGTATTCAGGTCAAGCCCGCCGGCGAAATTGCCGTACAGGATGTCAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10610 CCGTTTCGCTGACAGTATTCAGGTCAAGCCCGCCGGCGAAATTGCCGTACAGGATGTCAT 10551
Qy 61 ACAGGGAGGGACGAGGCATTTTCACTTCTCCTTAAACGGGTGCAGCGTCAGTTGATTTTG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10550 ACAGGGAGGGACGAGGCATTTTCACTTCTCCTTAAACGGGTGCAGCGTCAGTTGATTTTG 10491
Qy 121 GCTGGCTTCGATAATGCGCGGCCTCGCCGGATCAAGTTCGTCCCGGGTGAGTACCAGCCG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10490 GCTGGCTTCGATAATGCGCGGCCTCGCCGGATCAAGTTCGTCCCGGGTGAGTACCAGCCG 10431
Qy 181 CCAGCTGTTTTGCGTCAGGTCTGGATCGATAAACATGGCCGCCACCGCCACAAACTGCGC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10430 CCAGCTGTTTTGCGTCAGGTCTGGATCGATAAACATGGCCGCCACCGCCACAAACTGCGC 10371
Qy 241 GCTGGTTTCCATGGGCATATCGACGGTCACCGATTCGCCCGGACGCAGGCGAACATCTTT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10370 GCTGGTTTCCATGGGCATATCGACGGTCACCGATTCGCCCGGACGCAGGCGAACATCTTT 10311
Qy 301 TTCCGCCACCCGGTCCGCCTGCAGCGCCTGGCCATCGCCGGCAAACAGCGACGGGTAGTC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10310 TTCCGCCACCCGGTCCGCCTGCAGCGCCTGGCCATCGCCGGCAAACAGCGACGGGTAGTC 10251
Qy 361 AGTATTGTCGAACGCTTGCCGGTCCTTCAGCTGATAAATACGCACCACCGTCGCCAGGGA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10250 AGTATTGTCGAACGCTTGCCGGTCCTTCAGCTGATAAATACGCACCACCGTCGCCAGGGA 10191
Qy 421 GGCGCCTTTGGCGTTGTTATTCACGCCTTCCCGGGCGCGAAGATCCAGATGCAGGGTTTT 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10190 GGCGCCTTTGGCGTTGTTATTCACGCCTTCCCGGGCGCGAAGATCCAGATGCAGGGTTTT 10131
Qy 481 CACCTGGGGGTAAAAAATGGACTGGGTCACGGAAACGGCGCCGTCTTTCACGGTCTGCGT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10130 CACCTGGGGGTAAAAAATGGACTGGGTCACGGAAACGGCGCCGTCTTTCACGGTCTGCGT 10071
Qy 541 CAGGCCGCAGCCGGTTAAGACGGTAACCATGAGGAATGCCAGCAACCTGGCGGAGGGTTT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10070 CAGGCCGCAGCCGGTTAAGACGGTAACCATGAGGAATGCCAGCAACCTGGCGGAGGGTTT 10011
Qy 601 AACTGCGGTAATCGCCATCTTCATCGCTCTCCCTGCGGTGGATATTTTCCCGGACGCGCT 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10010 AACTGCGGTAATCGCCATCTTCATCGCTCTCCCTGCGGTGGATATTTTCCCGGACGCGCT 9951
Qy 661 GATAGCGCCCCAGATAAATCGTGACTCTGTCGTCAGCCTGTTTCTGCGCATCCAGAGGAC 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9950 GATAGCGCCCCAGATAAATCGTGACTCTGTCGTCAGCCTGTTTCTGCGCATCCAGAGGAC 9891
Qy 721 GCAGCACAGCGGTACGGCCGAGCTGGACGGCATGCTCCTGCTGGCAGCAAAGTTGCGCAT 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9890 GCAGCACAGCGGTACGGCCGAGCTGGACGGCATGCTCCTGCTGGCAGCAAAGTTGCGCAT 9831
Qy 781 CCGGCAGTAAATGGCGGGCGACGCAAAGCTGCAGCCGCACGTCAAGATGAGATCCGAGCC 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9830 CCGGCAGTAAATGGCGGGCGACGCAAAGCTGCAGCCGCACGTCAAGATGAGATCCGAGCC 9771
Qy 841 AGACGTGCAGAAGCGCCATCAGGTCGCTGAACAGTTCGCCGCCGGGCAGCCAGCCGCGAA 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9770 AGACGTGCAGAAGCGCCATCAGGTCGCTGAACAGTTCGCCGCCGGGCAGCCAGCCGCGAA 9711
Qy 901 CCTCATCAGGCTTTTCCGTGGCCAGCTGCAGCAATACCTGACCGTTCACATCCGTGGCGT 960
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9710 CCTCATGAGGCTTTTCCGTGGCCAGCTGCAGCAATACCTGACCGTTCACATCCGTGGCGT 9651
Qy 961 GGGTTCCCATCACTGGCCTATGTTGCAGGCTAACCGGCTGACGGACGCTCATCGTTAACG 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9650 GGGTTCCCATCACTGGCCTATGTTGCAGGCTAACCGGCTGACGGACGCTCATCGTTAACG 9591
Qy 1021 GCTGCGACAAGGGGATCCGGCAGGGATCGTGGTGGTACACCGTCGCCCGGGTCCCCGGGG 1080
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9590 GCTGCGACAAGGGGATCCGGCAGGGATCGTGGTGGTACACCGTCGCCCGGGTCCCCGGGG 9531
Qy 1081 CCAGGAGCGCCACCAGCGCCTCCATGCCTTCCCCGGATCTCCCCGGCAGCATCATCACCG 1140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9530 CCAGGAGCGCCACCAGCGCCTCCATGCCTTCCCCGGATCTCCCCGGCAGCATCATCACCG 9471
Qy 1141 GCAGCAGCGCCAGAAATCGCGACAGCGGCGCTAAAAAAAAAGCGGCAACGGCGGCACATC 1200
|||||||||||||||||||||||||||||||| |||||||||||||||||||
Db 9470 GCAGCAGCGCCAGAAATCGCGACAGCGGCGCT---------GCGGCAACGGCGGCACATC 9420
Qy 1201 CCGGTATGCCCAGCCCCGCCAGGCCCAGCAGATACTGCGAGATG 1244
||||||||||||||||||||||||| ||||||||||||||||||
Db 9419 CCGGTATGCCCAGCCCCGCCAGGCCGAGCAGATACTGCGAGATG 9376
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Juliet Switzer whose telephone number is (571)272-0753. The examiner can normally be reached Monday to Thursday, 8:00 AM-3:30 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at (571)-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Juliet Switzer
Primary Examiner
Art Unit 1682
/JULIET C SWITZER/Primary Examiner, Art Unit 1682
Prosecution Insights