DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I in the reply filed on 02/05/2025 is acknowledged.
Claims 6, 8, and 31 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 02/05/2025. Upon further consideration, the requirement for restriction between Groups I and IV has been withdrawn. Therefore claim 9 will be examined with elected group I."
Once the restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01.
Claims 1, 3, 9, 12, 15-28 are examined on the merits.
Priority
This application is a national stage application, of International Patent Application No. PCT/IB2021/059017, filed 09/30/2021, which claims priority from U.S. Provisional Application 63085950, filed 09/30/2020 is acknowledged.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 18 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 18 recites “wherein the AIMP2-DX2 does not have an exon comprising a nucleotide sequence encoding an amino acid that is at least 90% identical to SEQ ID NO: 10 or 11” (which corresponds to the sequence of exon 2). Claim 18 depends from claim 1, which recites “administering to the subject a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.” Thus, the independent claim excludes all exon 2 regardless of the particular sequence of exon 2, whereas the dependent claim only excludes exon 2 “comprising a nucleotide sequence encoding an amino acid that is at least 90% identical to SEQ ID NO: 10 or 11.” Accordingly, the dependent claim allows for some exon 2 sequences to be present and no longer contains all of the limitations of the claim from which it depends.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 3, 9, 16-19 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Choi et al. (“Choi”, KR20170041363A, English translation is provided).
Regarding claim 1, Choi teaches a method of treating amyotrophic lateral sclerosis, comprising the administration of a vector comprising the exon 2-deleted AIMP2 variant (AIMP2-DX2) gene that exhibits inhibition of apoptosis, improvement of motor dysfunction, and inhibition of oxidative stress (e.g., paragraphs 0016-0017, 0030)
Choi teaches the administration of the same recombinant vector to the same patient population. Thus, the claimed outcomes would necessarily be achieved.
Regarding claims 3 and 9, Choi teaches a method for treating spinal muscular atrophy, comprising administrating AIMP2 mutant gene lacking exon 2 (AIMP2-DX2) or a vector containing the gene (e.g., paragraphs 016-0017, 0030).
Regarding claims 16-17, Choi teach the SEQ ID NO 2 corresponding to AIMP2-DX2 with 100% identity to SEQ ID NO 2 of the instant claims (see alignment below).
PNG
media_image1.png
665
849
media_image1.png
Greyscale
Regarding claims 18-19, Choi teaches the nucleic acid comprising SEQ ID NO 1 that does not have an exon comprising a nucleotide sequence encoding an amino acid of SEQ ID NO 10 or 11 (corresponds to exon 2) (SEQ ID NO 1 encodes AIMP2-DX2 protein) (e.g., columns 13-14).
Claims 1, 3, 9, 16-19 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Choi et al. (“Choi”, US 10,716,866 B2).
Regarding claim 1, Choi teaches a method of treating amyotrophic lateral sclerosis, comprising administration of a vector containing the AIMP2-DX2 gene exhibiting inhibition of apoptosis, improvement of motor dysfunction, and inhibition of oxidative stress (e.g., lines 34-47, column 3).
Choi teaches the administration of the same recombinant vector to the same patient population. Thus, the claimed outcomes would necessarily be achieved.
Regarding claims 3 and 9, Choi teaches a method for treating spinal muscular atrophy, comprising administrating AIMP2 mutant gene lacking exon 2 (AIMP2-DX2) or a vector containing the gene (e.g., lines 35-55).
Regarding claims 16-17, Choi teach the SEQ ID NO 2 corresponding to AIMP2-DX2 with 100% identity to SEQ ID NO 2 of the instant claims (e.g., columns 13-14) (see alignment below).
PNG
media_image2.png
764
975
media_image2.png
Greyscale
Regarding claims 18-19, Choi teaches the nucleic acid comprising SEQ ID NO 1 that does not have an exon comprising a nucleotide sequence encoding an amino acid of SEQ ID NO 10 or 11 (corresponds to exon 2) (SEQ ID NO 1 encodes AIMP2-DX2 protein) (e.g., columns 13-14).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 12, 15, 20-28 are rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (“Choi”, KR20170041363A, English translation is provided) as applied to claims 1, 3, 9, 16-19 above, and further in view of Qiao et al. (“Qiao” Gene Therapy, 2011).
The teachings of Choi et al are described above and applied as before.
Choi does not teach a vector comprising AIMP2-DX2 and miR-142 target sequence. However, this is cured by Qiao.
Qiao teaches used the hematopoietic lineage miR-142-3p or
miR-142-5p target sequences in AAV expression cassettes in an
attempt to decrease transgene expression in antigen-presenting cells
and prolong transgene expression in normal mice (e.g., paragraph 4th, right column, page 407; Fig. 6). Qiao teaches plasmid constructs with 4x miR-142-3pT target site (tccataaagtaggaaacactaca) 100% identical to SEQ ID NO 5, and plasmid with 4x miR-142-5-pT target site (agtagtgctttctactttatg) 100% identical to SEQ ID NO 7 (e.g., paragraph 2nd, plasmid construction page 708).
Based on these teachings, it would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to modify the teachings of Choi, -method for treating a neurological disease amyotrophic lateral sclerosis, comprising a step of administering the pharmaceutical composition a viral vector comprising the AIMP2-DX2, with the teaching of Qiao -a vector expressing 4x miR-142 target sites comprising miR-142-3p (SEQ ID NO 5) or miR-142-5p (SEQ ID NO 7) to repress the expression of the transgene in antigen presenting cells that express the miR-142 to avoid an immune response against the transgene; for someone skilled in the art would have been obvious to use these teachings to achieve the predictable result of developing a vector comprising AIMP2-DX2 gene and with miR-142 target sites for the expression of AIMP2-DX2 protein in neural cells and not in antigen presenting cells.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to develop a method for treating subjects with amyotrophic lateral sclerosis with a vector comprising AIMP2-DX2 gene and with miR-142 target sites for the expression of AIMP2-DX2 in neural cells and not in antigen-presenting cells avoiding an immune response against the AIMP2-DX2 protein.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3, 9, 12, 15-28 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 of U.S. Patent No. 10,716,866 (“866”) in view of (“Holzbaur”, Neurobiology of Disease, 2006) and Qiao et al. (“Qiao” Gene Therapy, 2011). Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are a variation of “866” patent claims drawn to a method for improving motor activity or prolonging the lifespan of a subject with amyotrophic lateral sclerosis (ALS), comprising administering to the spinal cord of the subject a pharmaceutically effective amount of a viral vector comprising an exon 2 -deleted AIMP2 variant (AIMP2 -D X2 gene) SEQ ID NO 1. The difference is that the some of the dependent claims include a miR-142 target site in the vector expressing AIMP2-DX. However, one of ordinary skill in the art would incorporate at least two miR-142 binding sites having SEQ ID NO 5 or SEQ ID NO 7 claimed in the instant claims, into the genetic vector comprising the AIMP2-DX2, then it is obvious that the instant genetic construct was known at the time of filing.
Claim 1 of the “866” is drawn to a method for improving motor activity or prolonging the lifespan of a subject with amyotrophic lateral sclerosis (ALS), comprising administering to the spinal cord of the subject a pharmaceutically effective amount of a viral vector comprising an exon 2 -deleted AIMP2 variant ( AIMP2-DX2) gene. Claim 1 of the ”866” anticipates instant claim 1.
Claim 2 of the “866” is drawn to the method according to claim 1 , wherein the exon 2 - deleted AIMP2 variant (AIMP2 - DX2) gene has a base sequence set forth in SEQ ID NO : 1. The protein sequence encoded by SEQ ID NO 1 anneals 100% with SEQ ID NO 2 of the instant claims. Claim 2 of the ‘866 patent anticipates instant claims 16-17.
PNG
media_image3.png
435
655
media_image3.png
Greyscale
“866” does not teach a method of treating muscle atrophy in a subject with amyotrophic lateral sclerosis, as required by the instant claims. “866” does not teach a vector comprising AIMP2-DX2 and miR-142 target sequence. However, this is cured by Holzbaur and Qiao.
Regarding claims 3, 9, Holzbaur teaches that amyotrophic lateral sclerosis (ALS) is a late onset and fatal neurodegenerative disease characterized by degeneration of motor neurons in the brain and spinal cord and subsequent muscle atrophy (e.g., paragraph 1st, right column, page 697). Holzbaur teaches mouse and rat models of familial ALS, inhibition of myostatin results in enhanced muscle mass and strength, which is maintained through the early stages of disease but lost by end-stage. Myostatin inhibition slowed degenerative changes in skeletal muscle in early-stage disease, but did not delay onset of paralysis nor extend survival, as defined by right reflex failure, nor did myostatin inhibition significantly slow motor neuron loss (It reads on treating muscle atrophy) (e.g., paragraph 4th, left column, page 706; Figs. 3-5).
Regarding claims 12, 15, 20-28, Qiao teaches used the hematopoietic lineage miR-142-3p or miR-142-5p target sequences in AAV expression cassettes in an attempt to decrease transgene expression in antigen-presenting cells and prolong transgene expression in normal mice (e.g., paragraph 4th, right column, page 407; Fig. 6). Qiao teaches plasmid constructs with 4x miR-142-3pT target site (tccataaagtaggaaacactaca) 100% identical to SEQ ID NO 5, and plasmid with 4x miR-142-5-pT target site (agtagtgctttctactttatg) 100% identical to SEQ ID NO 7 (e.g., paragraph 2nd, plasmid construction page 708).
Based on these teachings, it would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to combine the teachings of “866” -a method for improving motor activity or prolonging the lifespan of a subject with amyotrophic lateral sclerosis (ALS), comprising administering to the spinal cord of the subject a pharmaceutically effective amount of a viral vector comprising an exon 2 - deleted AIMP2 variant (AIMP2 -D X2 gene), with the teachings of Holzbaur - inhibition of muscle atrophy by slowing degenerative changes in skeletal muscle in mouse and rat models of familial ALS, with the teachings of the teachings of Qiao -a vector expressing 4x miR-142 target sites comprising miR-142-3p (SEQ ID NO 5) or miR-142-5p (SEQ ID NO 7) to repress the expression of the transgene in antigen presenting cells that express the miR-142 to avoid an immune response against the transgene; for someone skilled in the art would have been obvious to use these teachings to achieve the predictable result of developing a vector comprising AIMP2-DX2 gene and with miR-142 target sites for the expression of AIMP2-DX2 protein in neural cells and not in antigen-presenting cells.
One of ordinary skill in the art before the effective filing date of the invention would have been motivated to develop a method for treating subjects with amyotrophic lateral sclerosis with a vector comprising AIMP2-DX2 gene and with miR-142 target sites for the expression of AIMP2-DX2 in neural cells and not in antigen-presenting cells avoiding an immune response against the AIMP2-DX2 protein.
Claims 1, 3, 9, 12, 15-28 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 4-6, 9-17, 22-24 of copending Application No. 16/819,998 (hereinafter the ‘998 application”). Although the claims at issue are not identical, they are not patentably distinct from each other because.
Although the claims at issue are not identical, they are not patentably distinct from each other. Claim 22 of the “998” is drawn to the method of claim 21, wherein the neuronal disease is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, retinal degeneration, mild cognitive impairment, multi-infarct dementia, fronto-temporal dementia, dementia with Lewy bodies, Huntington's disease, degenerative neural disease, metabolic cerebral disorders, depression, epilepsy, multiple sclerosis, cortico-basal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, spinocerebella ataxia, primary lateral sclerosis, spinal muscular atrophy, or stroke. Claim 23 of the “998” is drawn to the method of claim 22, wherein the neuronal disease is ALS. Claim 1 of the “998” is drawn to a recombinant vector comprising exon 2-deleted AIMP2 variant (AIMP2-DX2) gene and a miR-142 target nucleic acid, wherein the AIMP-DX2 gene is selectively expressed in a neuron.
Those embodiments of the “998” application anticipate instant claim 1.
Claim 24 of the “998” is drawn to the method claim 23, wherein the treatment improves motor activity or prolongs lifespan of the subject. Those embodiments of the “998” application anticipate instant claim 3.
Claim 22 of “998” is drawn to the method of claim 21, wherein the neuronal disease is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, retinal degeneration, mild cognitive impairment, multi-infarct dementia, fronto-temporal dementia, dementia with Lewy bodies, Huntington's disease, degenerative neural disease, metabolic cerebral disorders, depression, epilepsy, multiple sclerosis, cortico-basal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, spinocerebella ataxia, primary lateral sclerosis, spinal muscular atrophy, or stroke. Those embodiments of the “998” application anticipate instant claim 9.
Claim 4 of the “998” is drawn to the vector of claim 1, wherein the miR-142 target nucleic acid is 3' to the AIMP2-DX2 gene. Those embodiments of the “998” application anticipate instant claims 12, 15.
Claims 5 of the “998” is drawn to the vector of claim 1, wherein the AIMP2-DX2 gene has a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO:2. Those embodiments of the “998” application anticipate instant claim 16.
SEQ ID NO 2 of “998” has an identity of 99.6% with SEQ ID NO 2 of the instant claims (see alignment below).
PNG
media_image4.png
477
650
media_image4.png
Greyscale
Claim 6 of the “998” is drawn to the vector of claim 5, wherein the AIMP2-DX2 gene has a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:2. SEQ ID NO 2 of “998” has and identity of 99.6% with SEQ ID NO 2 of the instant claims (it does not have exon 2) (see alignment above).
Those embodiments of the “998” application anticipate instant claim 17-19.
Claim 9 of the “998” is drawn to the vector of claim 1, wherein the miR-142 target nucleic acid comprises a nucleotide sequence comprising ACACTA. Those embodiments of the “998” application anticipate instant claim 20.
Claim 10 of the “998” is drawn to the vector of claim 9, wherein the miR-142 target nucleic acid comprises a nucleotide sequence comprising ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO:5.
SEQ ID NO 5 of “998” has an identity of 100% with SEQ ID NO 5 of the instant claims (see alignment below).
PNG
media_image5.png
210
696
media_image5.png
Greyscale
Those embodiments of the “998” application anticipate instant claim 21.
Claim 11 of the “998” is drawn to the vector of claim 1, wherein the miR-142 target nucleic acid comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO:5 (TCCATAAAGTAGGAAACACTACA). Those embodiments of the “998” application anticipate instant claim 22.
Claim 12 of the :998” is drawn to the vector of claim 11, wherein the miR-142 target nucleic acid comprises a nucleotide sequence of SEQ ID NO:5. Those embodiments of the “998” application anticipate instant claim 23.
Claim 13 of the “998” is drawn to the vector of claim 1, wherein the miR-142 target nucleic acid comprises a nucleotide sequence comprising ACTTTA. Those embodiments of the “998” application anticipate instant claim 24.
Claim 14 of the “998” is drawn to the vector of claim 13, wherein the miR-142 target nucleic acid comprises a nucleotide sequence comprising ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO:7.
SEQ ID NO 7 of “998” has an identity of 100% with SEQ ID NO 7 of the instant claims (see alignment below).
PNG
media_image6.png
252
694
media_image6.png
Greyscale
Those embodiments of the “998” application anticipate instant claim 25.
Claim 15 of the “998” is drawn to the vector of claim 1, wherein the miR-142 target nucleic acid comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO:7 (AGTAGTGCTTTCTACTTTATG). Those embodiments of the “998” application anticipate instant claim 26.
Claim 16 of the “998” is drawn to the vector of claim 15, wherein the miR-142 target nucleic acid comprises a nucleotide sequence of SEQ ID NO:7. Those embodiments of the “998” application anticipate instant claim 27.
Claim 17 of the “998” is drawn to the vector of claim 1, wherein the miR-142 target nucleic acid is repeated 2-10 times. Those embodiments of the “998” application anticipate instant claim 28.
This is a provisional statutory double patenting rejection since the claims directed to the same invention have not in fact been patented.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JULIO GOMEZ RODRIGUEZ whose telephone number is (571)270-0991. The examiner can normally be reached Monday - Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 5712722916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JULIO WASHINGTON GOMEZ RODRIGUEZ/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637