DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .2. This action is in response to the amendment filed on 15 July 2026. Applicant's arguments and amendments to the claims have been fully considered but do not place the application in condition for allowance.
All objections and rejections not reiterated herein are hereby withdrawn.
In particular, the previous rejection of claims 1, 3-8, 10 and 11 under 35 U.S.C. 101 has been obviated by the amendment to the claims to require that the detection of the presence or absence of the chromosome interaction is accomplished by detecting the presence or absence of ligated DNA using the probe consisting of the nucleotide sequence of SEQ ID NO: 1 or using the primer pairs consisting of the nucleotide sequences consisting of SEQ ID NO: 51 and 52.
The rejection of claims 1, 3-8, 10 and 11 under 35 U.S.C. 102(a)(1) as being anticipated by Akoulitchev et al (WO 2019069067; cited in the IDS of 25 April 2023) has been obviated by the amendment to claim 1 to recite that the chromosome interaction that is detected is Hg38 2 151357305 151361853 151612320 151619007 RF and that the chromosome interaction is “detected by the probe AATGTTGATAAGTATTAGACGACTGGTTTCGATTTTCTTTTAATCACTGCTAAATCTGCA (SEQ ID NO: 1) or the primer sequences CACACTGAGACTGATGGTGCGTGAGT (SEQ ID NO: 51) and CAGTGTCTGAAGCAAATCCTCTGAC (SEQ ID NO: 52).”
The rejection of claims 1, 3-8, 10 and 11 under 35 U.S.C. 112(a) – written description – has been obviated by the amendment to claim 1 to recite the particular chromosome interaction of Hg38 2 151357305 151361853 151612320 151619007 RF and to recite that the ligated DNA and the chromosome interaction is “detected by the probe AATGTTGATAAGTATTAGACGACTGGTTTCGATTTTCTTTTAATCACTGCTAAATCTGCA (SEQ ID NO: 1) or the primer sequences CACACTGAGACTGATGGTGCGTGAGT (SEQ ID NO: 51) and CAGTGTCTGAAGCAAATCCTCTGAC (SEQ ID NO: 52).” Note again that the claims have been examined to the extent that they read on the above identified elected species and not with respect to the non-elected species recited in claim 1 of any chromosome interaction detectable with a probe or primer selected from SEQ ID NO: 2-50 and 52-1200.
Claim Status
3. Claims 1, 2, 7-10 and 12-21 are pending.
Claim 2, 9, 12-18 and 21 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim.
Claims 1, 7, 8, 10, 19 and 20 read on the elected invention and have been examined herein to the extent that the claims read on the elected species. The claims encompass non-elected chromosome interactions, probes and primers. Prior to the allowance of the claims, any non-elected subject matter which has not been rejoined with the elected subject matter will be required to be removed from the claims.
In the interest of compact prosecution, it is noted that the dependent claims reference the chromosome interactions, primers and probes listed in Tables 1A and 1B. As set forth in the Office action of 17 April 2026, the reference in the claims to the subject matter recited in tables from the specification renders the claims incomplete and thereby indefinite under 35 U.S.C. 112(b).
Non-Compliant Amendment
3. The status identifiers used for claims 12-18 and 21 are not correct as these claims are directed to non-elected subject matter and should be accompanied by the status identifier of “(Withdrawn-New).”
As set forth in MPEP 714, “For any amendment being filed in response to a restriction or election of species requirement and any subsequent amendment, any claims which are non-elected must have the status identifier (withdrawn). Any non-elected claims which are being amended must have either the status identifier (withdrawn) or (withdrawn – currently amended) and the text of the non-elected claims must be presented with markings to indicate the changes. Any non-elected claims that are being canceled must have the status identifier (canceled).”
MPEP provides the following list of acceptable alternative status identifiers:
PNG
media_image1.png
435
908
media_image1.png
Greyscale
New Claim Objections
5. Claims 1, 7, 8, 10, 19 and 20 are objected to because of the following informalities:
Claim 1, and thereby dependent claims 7, 8, 10, 19 and 20, recite “treating a selected individual” (claim 1 at (c)), whereas the claims should recite “treating the selected individual.”
Appropriate correction is required.
Maintained / Modified Improper Markush Grouping Rejection
6. Claims 1, 7, 8, 10, 19 and 20 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 706.03(y).
The Markush groupings of the chromosome interactions using one or more probes or primers selected from SEQ ID NO: 1-1200 and including the interaction of Hg38 2 151357305 151361853 151612320 151619007 RF using the probe AATGTTGATAAGTATTAGACGACTGGTTTCGATTTTCTTTTAATCACTGCTAAATCTGCA (SEQ ID NO: 1) or the primer sequences CACACTGAGACTGATGGTGCGTGAGT (SEQ ID NO: 51) and CAGTGTCTGAAGCAAATCCTCTGAC (SEQ ID NO: 52) are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons:
It is first noted that MPEP 706.03(y) states that “A Markush claim may be rejected under judicially approved “improper Markush grouping” principles when the claim contains an improper grouping of alternatively useable members. A Markush claim contains an “improper Markush grouping” if either: (1) the members of the Markush group do not share a “single structural similarity” or (2) the members do not share a common use. Supplementary Guidelines at 7166 (citing In re Harnisch, 631 F.2d 716, 721-22, 206 USPQ 300, 305 (CCPA 1980)). “ Members of a Markush group share a “single structural similarity” when they belong to the same recognized physical or chemical class or to the same art-recognized class (prong 1) and the members of a Markush group share a common function or use when they are disclosed in the specification or known in the art to be functionally equivalent (prong 2).
The phrase “significant structural element is shared by all of the alternatives” refers to cases where the compounds share a common chemical structure which occupies a large portion of their structures, or in case the compounds have in common only a small portion of their structures, the commonly shared structure constitutes a structurally distinctive portion in view of existing prior art, and the common structure is essential to the common property or activity.
A recognized physical class, a recognized chemical class, or an art-recognized class is a class wherein “there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention. In other words, each member could be substituted one for the other, with the expectation that the same intended result would be achieved” (see MPEP 706.03(y)IIA).
Herein, the recited alternative species do not share a single structural similarity, as each chromosome interaction occurs at a different location in the genome and involves different nucleotide sequences. Thus, each chromosome interaction has a different chemical structure in that it consists of a different nucleotide sequence. The probes and primers used to detect the chromosome interactions also have a different chemical structure in that they consist of different nucleotide sequences – i.e., the nucleotide sequences of SEQ ID NO: 1-1200. The only structural similarity present is that all of the chromosome interactions, and probes and primers, comprise nucleotides. The fact that the chromosome interactions comprise nucleotides per se does not support a conclusion that they have a common single structural similarity because the structure of comprising nucleotides alone is not essential to the asserted common activity of being correlated with muscular atrophy. Accordingly, while the different chromosome interactions are asserted to have the property of being “muscular atrophy related,” they do not share a substantial structural similarity essential to this activity.
Further, the recited chromosome interactions do not belong to a chemical or art-recognized class because there is no expectation from the knowledge in the prior art that the chromosome interactions behave in the same manner and can be substituted for one another with the same intended result achieved. There is no evidence of record to establish that it is clear from their very nature that the recited chromosome interactions possess the common property of being indicative of muscular atrophy status. Nor is there any evidence of record to establish that it is clear from their very nature that the recited probes and primers possess the common property of being useful to detecting a chromosome interaction indicative of muscular atrophy status.
Following this analysis, the claims are rejected as containing an improper Markush grouping.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Response to Remarks:
The response argues that the claimed method provides a contribution over the prior art. For example, it is stated “Without the applicant's in-house expertise these are problems which would be close to impossible to overcome based on the knowledge in the field at the priority date.”
However, these arguments do not address the rejection. It is maintained that the primers and probes and the chromosomal interactions detected by the primers and probes do not share a single structural similarity. Alternatively, the primers and probes and chromosome interactions detected by the primers and probes do not belong to a chemical or art-recognized class because there is no expectation from the knowledge in the prior art that the chromosome interactions, primers and probes behave in the same manner and can be substituted for one another with the same intended result achieved.
The response states:
“claim 1 now requires detection of the elected chromosome interaction (the first chromosome interaction listed in Table 1 A designated Hg38_2_151357305_151361853_151612320_151619007_RF) either by the probe AATGTTGATAAGTATTAGACGACTGGTTTCGATTTTCTTTTAATCACTGCTAAATCTGCA (SEQ ID NO: 1) or the primer sequences CACACTGAGACTGATGGTGCGTGAGT (SEQ ID NO: 51) and CAGTGTCTGAAGCAAATCCTCTGAC (SEQ ID NO: 52).”
However, claim 1 is not limited to methods that detect the Hg38_2_151357305_151361853_151612320_151619007_RF chromosomal interaction using the probe of SEQ ID NO: 1 or the primers of SEQ ID NO: 51-52. Rather, claim 1 encompasses methods that detect at least this chromosome interaction in combination with any other chromosome interaction that is detectable “using a probe or primer having a sequence selected from the sequences set forth in SEQ ID NOS: 1-1200.” The selection of the patient is based on the detection of a combination of any of these (undefined) chromosome interactions together with the chromosome interaction of Hg38_2_151357305_151361853_151612320_151619007_RF. Thus, the claims still recite improper Markush groupings.
This rejection may be obviated by amendment of claim 1 to limit the method to one that detects the Hg38_2_151357305_151361853_151612320_151619007_RF chromosome interaction using a probe having a nucleotide sequence consisting of SEQ ID NO: 1 or the primers having a nucleotide sequence consisting of SEQ ID NO: 51 and 52 and to recite in dependent claims that the method further comprises detecting a chromosomal interaction using one or more primers or probes selected from SEQ ID NO: 2-50 and 52-1200.
New Claim Rejections - 35 USC § 112(b) - Indefinite
7. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 7, 8, 10, 19 and 20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A. Claims 1, 7, 8, 10, 19 and 20 are indefinite over the recitation of “the cross-linked DNA” (see claim 1 at (ii)) because this phrase lacks proper antecedent basis. While the claims previously recite “cross-linking of chromosome interactions,” the claims do not previously refer to cross-linked DNA per se. It is also unclear as to what is meant by cross-linking the chromosome interactions, rather than the chromosome regions / chromosomal DNA involved in the interaction. This rejection may be obviated by amendment of claim 1 to recite “(i) cross-linking chromosome regions in the sample which have come together in a chromosome interaction; (ii) subjecting the cross-linked regions to cleavage to form cross-linked cleaved DNA.”
B. Claims 1, 7, 8, 10, 19 and 20 are indefinite over the recitation of an “anti-SBMA therapeutic agent.” This phrase is not used in the specification and there is no art recognized definition for this phrase. It is unclear as to what therapeutics are encompassed by this phrase and what therapeutics would be excluded by this phrase. For example, it is unclear as to whether the therapeutic is limited to one that treats a symptom of SBMA or if the therapeutic is limited to one that fully cures or causes a patient to fully recover from and no longer have any symptoms of SBMA or if the therapeutic encompasses agents that prevent SBMA. Accordingly, the metes and bounds of the claimed subject matter are not clear.
C. Claim 10 is indefinite over the recitation that the ligated DNA is detected using primers capable of amplifying the ligated DNA and a “probe with the sequence comprising AATGTTGATAAGTATTAGACGACTGGTTTCGATTTTCTTTTAATCACTGCTAAATCTGCA (SEQ ID NO: 1), wherein said probe comprises a fluorophore covalently attached to the 5' end of the probe, and/or - a quencher covalently attached to the 3' end of the probe.” Claim 1, from which claim 10 depends, requires that the chromosome interaction and the ligated DNA are detected “by the probe AATGTTGATAAGTATTAGACGACTGGTTTCGATTTTCTTTTAATCACTGCTAAATCTGCA (SEQ ID NO: 1) or the primer sequences CACACTGAGACTGATGGTGCGTGAGT (SEQ ID NO: 51) and CAGTGTCTGAAGCAAATCCTCTGAC (SEQ ID NO: 52).” Thus, claim 1 limits the probe to one consisting of SEQ ID NO: 1. It is unclear as to how claim 10 is intended to properly depend from claim 1 to the extent that claim 10 further defines the probe of claim 1 since claim 1 is limited to a probe consisting of SEQ ID NO: 1 (i.e., “the probe AATGTTGATAAGTATTAGACGACTGGTTTCGATTTTCTTTTAATCACTGCTAAATCTGCA (SEQ ID NO: 1”), whereas claim 10 defines the probe as comprising (i.e., including additional nucleotides and other moieties) SEQ ID NO: 1 and the 5’ fluorophore and/or 3’ quencher. Thus, claim 10 does not further limit the subject matter of a claim from which it depends. To the extent that claim 10 is intended to depend from claim 1 by requiring the primers of SEQ ID NO: 51 and 52 and then defining the probe as the one recited in claim 10, claim 10 does not require such a limitation since this claim recites more broadly that the method is one “which uses primers capable of amplifying the ligated DNA.”
New Claim Rejections - 35 USC § 112(a) – New Matter
8. The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 7, 8, 10, 19 and 20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a New Matter rejection.
The disclosure as originally filed does not provide support for the amendments to the claims to recite selecting and treating an individual for spinal and bulbar muscular atrophy (SBMA) comprising (in part) selecting an individual “based on a chromosome interaction being present or absent in the sample”, wherein the chromosome interaction includes at least the chromosome interaction designated Hg38 2 151357305 151361853 151612320 151619007 RF, and then “treating a selected individual by administering to the individual an anti-SBMA therapeutic agent.”
The response of 15 July 2025 states:
“Support for claims 12-21 is found throughout the specification as originally filed and particularly in Tables 1 A parts 1 b, 2b, 3b, 4b, 1f, 2f, 3f, 4f and Tables 1 B parts 1 b, 2b, 3b, 4b, i f, 2f, 3f, 4f. No new matter is added.”
However, the cited text does not provide support for the amendments to claim 1.
First, the disclosure teaches that the chromosome interaction Hg38 2 151357305 151361853 151612320 151619007 RF is present only in subjects having spinal and bulbar muscular atrophy (SBMA) and is not present in control subjects. For instance, the specification (para [0055]; paragraph numbering herein is with respect to the published application) states:
“Table 1 shows 400 specific markers which can be used to detect muscular atrophy, i.e. their presence or absence can be used in such a detection (i.e. they are ‘disseminating’ markers). Table 1A shows 200 markers which are only present in muscular atrophy. Table 1B shows 200 markers which are present only healthy controls, i.e. they are absent in muscular atrophy.”
Note that Hg38 2 151357305 151361853 151612320 151619007 RF is listed as the first entry in Table 1A. Thus, the specification teaches that a subject is selected for treatment for SBMA based on detecting the presence of the chromosome interaction Hg38 2 151357305 151361853 151612320 151619007 RF .
The originally filed disclosure does not provide support for the distinct concept encompassed by the claims of selecting and treating an individual for SBMA based on detecting the absence of the chromosome interaction Hg38 2 151357305 151361853 151612320 151619007 RF.
Secondly, the disclosure as originally filed does not provide support for the recitation of “treating a selected individual by administering to the individual an anti-SBMA therapeutic agent.” The originally filed disclosure does not use the phrase “anti-SBMA therapeutic agent.” As discussed above, it is not clear as to what is encompassed by and what is excluded by an “anti-SBMA therapeutic agent.” The specification (para [0006]) states that the methods disclosed therein are preferable “carried out to select an individual for receiving therapy or a treatment for muscular atrophy.” The specification (para [0154]) teaches that “Therapeutic agents and treatments which can be used in the invention include physiotherapy, rehabilitation, agents that treat muscle tremors, agents that treat muscle cramps, hormone therapy, anti-testosterone leuprorelin.” However, these disclosures do not provide basis for the broader and distinct concept encompassed by the claims of any “anti-SBMA therapeutic agent,” which potentially encompasses agents that prevent or cure SBMA.
If Applicant maintains that the originally filed disclosure provides basis for the amended claims, Applicant should point to specific teachings (e.g., by page and line number) in the present application to establish basis for each of the recitations set forth in the claims.
See MPEP 2163 II at “(b) New Claims, Amended Claims, or Claims Asserting Entitlement to the Benefit of an Earlier Priority Date or Filing Date under 35 U.S.C. 119, 120, 365, or 386” which states:
“To comply with the written description requirement of 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph, or to be entitled to an earlier priority date or filing date under 35 U.S.C. 119, 120, 365, or 386, each claim limitation must be expressly, implicitly, or inherently supported in the originally filed disclosure.”
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CARLA J MYERS whose telephone number is (571)272-0747. The examiner can normally be reached M-Th 6:30-5:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng (Winston) Shen can be reached on 571-272-0731. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CARLA J MYERS/Primary Examiner, Art Unit 1682
Prosecution Insights