DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status
Claims 1- 5, 18- 21, and 23- 31 are pending.
Claims 1- 5, and 23- 31 are examined on the merits.
Claims 18- 21 are withdrawn.
Claim 25 is objected.
Claims 1- 5, and 23- 31 are rejected.
No Claims are allowed.
Election/Restrictions
Claims 18- 21 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on March 16, 2026.
Applicant’s election without traverse of species SEQ ID No 79 in the reply filed on March 16, 2026 is acknowledged. Furthermore, applicant neglected to elect a species of the group: SEQ ID Nos 64, 65, 66. In order to forward prosecution, this examiner has examined SEQ ID No 64 as recited in claim 25.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 3 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 3 recites the structure of the gRNA such that it comprises seven sequences (SEQ ID Nos 74, 78, 79, 80, 82, 83, and 84), flanked by the 5’-(X)n- region and the skeleton sequence-3’ region. This is unclear because as written, the gRNA comprises all seven of these stated sequences (in no specific orientation) instead of only one of these sequences. This is inconsistent with the specification where the gRNA comprising any one of these SEQ ID Nos is described in the alternative (page 14, 3rd paragraph). The specification fails to describe the gRNA comprising all of these SEQ ID Nos.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 5 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 1 requires an RNA molecule. However, claim 5 recites “one or more isolated nucleic acid molecule(s)” which broadly encompasses molecules that are not necessarily RNA molecules such as DNA molecules. So claim 5 fails to further limit claim 1 from which it depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 2, 4, 5, 23- 29, and 31 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Yang (R. R. Yang. US 20200255859 A1, published 2020 Aug. 13, filed 2018 July 31).
Yang teaches gRNAs specifically targeting CYP4V2 within 200 bp of the mutation, “FIG. 12 (shown below) shows a region of the CYP4V2 sequence and the position of the guide RNAs (gRNAs) designed relative to the c.802-8_810del17insGC mutation”[0202].
PNG
media_image1.png
362
770
media_image1.png
Greyscale
Therefore, Yang teaches all of the elements of claim 1 and therefore anticipates claim 1.
Regarding claim 4, Yang teaches a single stranded gRNA, “the protospacer element [gRNA] is about 20 bases, about 19 bases, about 21 bases, about 19-21 bases, about 18-22 bases, or about 16-24 bases.”[0063].
Regarding claim 5, Yang describes the plasmid encoding the gRNA, “FIG. 17 shows the position of the gRNA (using g1 as an example) relative to the U6 promoter in the pX459-hSpCas9-2A-Puro plasmid,”[0207].
Regarding claim 23, Yang teaches “FIG. 16 is a vector map of gRNA (using g1 as example), Cas9 and PuroR co-expression plasmid pX459-hSpCas9-2A-Puro”[0206].
Regarding claim 24, Yang teaches the embodiment “the donor nucleic acid sequence is selected from… a sequence that is complementary thereof, for use to correct, disrupt or replace the c.802-8-810del17insGC mutation of the CYP4V2 gene”[0066]. Yang explains correction “’repaired,’ or "corrected," can refer to a restoration of the affected sequence (e.g., the genetic or epigenetic alteration) to the wild type sequence or to another non-mutant sequence as described herein” [0295]. Furthermore, it is understood in the art, that corrections to the instant CYP4V2 mutation encompasses sequences within 800 bp upstream or downstream of c.802-8_810del17bpinsGC.
Regarding claim 26, 27, 28, Yang teaches the embodiment “the genetic or epigenetic alteration in the iPS-ocular cells from the subject has been genetically repaired using gene editing… the gene editing method utilizes… a recombinant AAV vector or another viral vector”[0094].
Regarding claim 29, Yang teaches the embodiment “exogenous CYP4V2 mutation is introduced artificially via gene editing or gene manipulation at this stage or any of the following stages; inducing pluripotency in the cells”[0048].
Regarding claim 31, Yang teaches the embodiment “a composition for treating or preventing a disease in a subject is provided, including an effective amount of a vector and a pharmaceutically acceptable carrier”[0133].
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 2 and 3 are rejected under 35 U.S.C. 103 as being unpatentable over Yang (R. R. Yang. US 20200255859 A1) in view of Friedland (Friedland et al. Genome Biol. 2015 Nov 24;16:257.), and NG_007965.1 (NCBI Reference Sequence, Homo sapiens cytochrome P450 family 4 subfamily V member 2 (CYP4V2), priority to August 24, 2019).
Yang teaches all of the elements of claim 1.
Yang does not teach a gRNA comprising SEQ ID No 79.
However, Yang teaches gRNAs as described above. Furthermore, Yang teaches the 540 base region described as SEQ ID No 68, that comprises a 21 base region that shares 100% identity with the gRNA, instant SEQ ID No 79. In their description of Fig. 14, Yang describes SEQ ID No 68, “CYP4V2 locus indicating mutation site (SEQ ID NO:68).”
The instant SEQ ID NO 79 aligns to nucleotides 14527- 14547 of CYP4V2 and downstream of the GC mutation site. Therefore, SEQ ID No 79 is predictably within 200 bp of the c.802-8_810del17insGC mutation site, which corresponds to nucleotide position 14630 in NG_007965.1. This gRNA sequence is followed by AAGAAA, a variant of the known PAM sequence NNGRRV as evidenced by Friedland “saCas9… shows… moderate cleavage of targets with NNGRRV PAMs” (Friedland et al. Genome Biol. 2015 Nov 24;16:257.).
SEQ ID NO 79 1 TAGGCTTAGAAAAATAAATGA 21
|||||||||||||||||||||
NG_007965.1 14527 TAGGCTTAGAAAAATAAATGAAAGAAA 14553
It would have been obvious for a person having ordinary skill in the art (PHOSITA) at the time of filing to have taken the known CYP4V2 mutation site as described by Yang’s SEQ ID No 68, and further used that sequence information to generate a gRNA directed toward that very site, as described by Yang (Fig. 12 above) and had a reasonable expectation of success because it is simply choosing from a finite number of identified, predictable solutions. Yang identified the need in the art to treat mutations in the CYPV2 gene that cause “diseases in the eye.” Yang further identified the region surrounding the c.802-8_810del17insGC mutation as a finite region to probe with gRNAs. S. aureus Cas9 was known. There was motivation to choose a gRNA in this region because the corresponding the PAM site for saCas9 was known to be present in this region. Furthermore, saCas9 was known to be ideal because it's smaller and effective. A PHOSITA would have had a reasonable expectation of success selecting a gRNA based on Yang’s SEQ ID No 68, and the location of the PAM site and the use of saCas9.
Claim 3, is currently interpreted consistent with the specification where the gRNA comprising any one of SEQ ID Nos 74, 79-80, and 82-84 is described in the alternative (specifications page 14, 3rd paragraph; see above for further explanation). The obviousness of a gRNA comprising SEQ ID NO 79 is addressed above as applied to claim 2.
Furthermore, the instant specification recites the following embodiment of the skeleton sequence, “the skeleton sequence may be any feasible sequence in the prior art” (page 6, 3rd paragraph). Similarly, the 5’ flank of the instant claimed gRNA is claimed as follows, “5'-(X)n-… wherein X is a base selected from any of A, U, C and G, and n is any integer from 0 to 15.” Therefore, the 5’ flank may also be any feasible sequence in the prior art less than 16 bases, including no flank at all. Yang describes such a scaffold region of the gRNA “a sequence which interacts with a CRISPR-associated protein 9 (Cas9)” [0062].
Claim 30 is rejected under 35 U.S.C. 103 as being unpatentable over Yang (R. R. Yang. US 20200255859 A1) as applied to claims 1, 5, and 27 above, and further in view of Mazerik (Mazerik et al. Cell Med. 2018 Jun 8;10:2155179018773758.).
Yang teaches all of the elements of claims 1, 5, and 27.
Yang does not teach “wherein the cell can be differentiated into a 3D-retinal organoid.”
However, Yang teaches their field of “cellular models for diseases of the eye” [Abstract] and further teaches, embodiments of their method where “the cell line comprises an iPS cell… characterized by… the ability to differentiate into the desired cell type (e.g., RPE [retinal pigment epithelium])” [0044]. Furthermore, Yang explicitly recites a motivation for using their technique in regenerative therapies “Therefore, these gene-corrected cells serve as a source of regenerative, genetically-repaired autologous cells that can be used as replacement cells in cell therapy.” [0675].
Mazerik teaches “3-D organoid culture systems offer platforms to integrate basic research findings with clinical care. Organoids … will be valuable resources for drug screening, disease modeling, and precision and regenerative medicine” (Abstract). Mazerik further describes the cellular origin of their organoids “Organoids used to model microphthalmia phenotypes using patient-derived iPSC to generate optic vesicles” (Table 1).
It would have been obvious for a person having ordinary skill in the art (PHOSITA) at the time of filing to have taken Yang’s isolated nucleic acid molecule, and further used the molecule to generate a 3-D retina organoid as described by Mazerik because there was teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention (“TSM”). Yang identified induced pluripotent stem cells (iPSC) as a viable optical disease therapy tool. Furthermore, Yang suggested, their iPSCs should be used in regenerative technologies. Mazerik similarly realized regenerative technologies (3-D retina organoids) were ideal therapies for optical diseases. Yang as noted above, provided the motivation to use their own iPSC therapy based cells with Mazerik’s regenerative 3-D retina organoid therapy to achieve cells with 3-D retina organoid potential. A PHOSITA would and had a reasonable expectation of success based on the past success of Mazerik in the same field of endeavor using iPSCs.
Allowable Subject Matter
Claim 25 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
This examiner was unable to locate prior art for the claim limitation “wherein the donor nucleic acid molecule comprises a nucleotide sequence set forth in any of SEQ ID NOs: 64-66.” SEQ ID Nos 64, 65, and 66 are artificial sequences each 2503 nt long. Page 2 of the instant specification describes a broad embodiment of SEQ ID Nos 64-66, “a donor nucleic acid molecule comprising a normal wild-type nucleotide sequence within 800 bp upstream or downstream of c.802-8_810del17bpinsGC mutation site of CYP4V2 gene.” Further embodiments and variants are described in the specification.
The closest prior art found was Trinklein (US 20090018031 A1), with 6000nt SEQ ID #10218 having 40.3% identity to instant SEQ ID No 64. Furthermore, the SEQ ID No 10218 shares 40.2% identity with instant SEQ ID No 65 and instant SEQ ID No 66.
SEQ ID No 10218 maps 100% to bases 12956- 18955 of CYP4V2 (NG_007965.1). Trinkelein describes embodiments their SEQ ID No 10218 “In some embodiments, the regulatory elements in an oncology pathway are selected from the group consisting of SEQ ID NO: 1-3836”[0008]; and “The present invention also provides a library of transcription regulatory elements, e.g., a library of transcriptional promoters… selected from the group consisting of SEQ ID NO: 1-3836”[0134].
As claimed, the substantial difference in sequence identity of SEQ ID Nos 64-66 from the nearest prior art separates the invention from the prior art.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AARON DUREL WARD whose telephone number is (571)272-8495. The examiner can normally be reached Monday to Thursday 8:00AM 6:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 15712705919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AARON DUREL WARD/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights