DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1-2, 4, 6, 9, 11, 14-15, 19, 22-23, 25-26, 29, 32-33, 35-37, and 39 are pending.
Election/Restrictions
Applicant’s election without traverse of the invention of Group I and the species nt 2946-2977 in SEQ ID NO 1632 in the reply filed on 08 January 2026 is acknowledged.
Claims 36-37 and 39 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 08 January 2026.
The restriction requirement explicitly asked Applicant to identify all claimed SEQ ID NOs that read on the elected region. See this modified excerpt of the previous Office Action:
PNG
media_image1.png
647
691
media_image1.png
Greyscale
Applicant’s response didn’t include any SEQ ID NOs for the later claims. While a notice of nonresponsiveness would be proper, in the interest of compact prosecution the claims are examined.
Claims 1-2, 4, 6, 9, 11, 14-15, 19, 22-23, 25-26, 29, 32-33, and 35 are examined.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. A certified copy of EUROPEAN PATENT OFFICE (EPO) 20306222.9, filed 16 October 2020, has been received.
Information Disclosure Statement
The IDS has been considered.
The Spec. cites references.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Claim Objections
Claim 1 should spell out LPA on first use: A double-stranded ribonucleic acid (dsRNA) that inhibits expression of a human lipoprotein(A) (LPA) gene…
Claim 2 should read: … wherein the sense strand and the AS strand are each no more than 30 nt in length.
Claim 22 should indent the following to show that …J is O…. targeting moiety… is within the same bullet point as Y is O…:
PNG
media_image2.png
543
570
media_image2.png
Greyscale
Furthermore, the lack of organization/pattern to the indenting, paragraph placement, and bullets in the claim is confusing. For example, it would make more sense for J is O or S… to be indented under the bullet point that recites J. Similarly, m, p, R2…, and R3 should be indented under the bullet that first mentions them. Applicant should revise the organization/pattern to the indenting, paragraph placement, bullets, and punctuation in the claim.
Claim 29: the formulas IgT3 and IT4 are not known in the art. The claim should show a picture of each formula.
Claim Interpretation
Claims that recite and/or are interpreted as requiring only one of the limitations.
Any optional limitations recited in Claims 11, 22-23, and 25 are interpreted as fully optional and not required.
Claim 2 recites that the sense and antisense (AS) strands are complementary to each other over a region of 15-25 contiguous nucleotides. That is interpreted as requiring full complementarity over 15-25 nt. Claim 2 recites: … wherein the sense strand and the AS strand are no more than 30 nt in length. That is interpreted as … wherein the sense strand and the AS strand are each no more than 30 nt in length.
Claims 4, 6, and 15 recite … a nucleotide sequence selected from the group consisting of SEQ ID NOs…. That is interpreted as requiring the entirety of any one of the recited SEQ ID NOs. (I.e., it is not interpreted as requiring just a shorter segment of the recited SEQ ID NOs.)
Claim 14 recites that the sense and AS sequences comprise alternating 2’-OMe and 2’-F nt. That claim doesn’t recite any guidelines for the pattern besides that the sense and AS sequences comprise alternating 2’-OMe and 2’-F nt, so it is interpreted as any amount of nt comprising this alternating pattern reads on the claims. (I.e., the claim doesn’t require the alternating pattern is applied to individual nt or that it continues across the entire sequence[s].) Therefore, a 26-mer comprising seven 2’-OMe nt followed by four 2’-F nt followed by fifteen 2’-OMe nt comprises a pattern of alternating 2’-OMe and 2’-F nt so it is considered to read on the claim.
Claim 22 recites said strand(s). That is interpreted as referring to either or both of the sense and AS strand(s).
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 4, 9, 11, 14, 19, 22-23, 25-26, 29, 32, and 35 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection.
Claims 1-2 and 4(i) recite :
A double-stranded ribonucleic acid (dsRNA) that inhibits expression of a human LPA gene by targeting a target sequence on an RNA transcript of the LPA gene, wherein the dsRNA comprises a sense strand comprising a sense sequence, and an antisense strand comprising an antisense sequence, and wherein the target sequence is nucleotides 2958- 2976, 4639-4657, 4892-5000, 220-238, 223-241, 302-320, 1236-1254, 2946-2964, 2953-2971, 2954-2972, 2959-2977, 4635-4653, 4636-4654, 4842-4860, 4980-4998, 6385-6403, or 6470-6488 of SEQ ID NO: 1632, and wherein the sense sequence is at least 90% identical to the target sequence (Claim 1);
The dsRNA of claim 1, wherein the sense strand and antisense strand are complementary to each other over a region of 15-25 contiguous nucleotides; and/or wherein the sense strand and the antisense strand are no more than 30 nucleotides in length (Claim 2); and
The dsRNA of claim 1, wherein:(i) the target sequence is nucleotides 2958-2976, 4639-4657, or 4982-5000 of SEQ ID NO: 1632 (Claim 4[i]).
Applicant has elected the species nt 2946-2977 of SEQ ID NO 1632.
Those broad claims encompass the large genus of dsRNAs wherein the dsRNA comprises a sense strand and an AS strand, wherein the target sequence is nt 2946-2977 of SEQ ID NO 1632, and wherein the sense sequence is at least 90% identical to the target sequence. Claims 1 and 4(i) and one embodiment of Claim 2 place no upper limit on strand length. The claims all recite compounds defined by a sense strand comprising a minimum of 90% identity to a target sequence that is nt 2946-2977 in SEQ ID NO 1632, and the claims also require that the dsRNA inhibits expression of a human LPA gene. Any kind of dsRNA whose sense strand comprises at least 90% identity to nt 2946-2977 in SEQ ID NO 1632 would be encompassed by the claims as instantly presented. Claim 1 doesn’t recite any requirements for the AS strand. Claim 2 requires only that the sense and AS strands are complementary to each other over a region of 15-25 contiguous nt OR a max length of 30 nt, and Claim 4(i) requires that the target sequence is nt 2958-2976 in SEQ ID NO 1632.
An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163.
Regarding sequences that are identical or target the elected species, the Spec. discloses SEQ ID NOs 104-111 and 403-410 in Table 1 and SEQ ID NOs 702-709 and 1001-1008 in Table 2. Table 2 discloses dsRNA comprising those SEQ ID NOs correspond to siLPA #s 104-111. All of those SEQ ID NOs are 19-mers. Fig.2 shows that compounds siLPA #s 104-111 inhibit expression of the LPA gene in human cells.
The Spec. does not disclose any other sequences or dsRNA compounds that target the region of nt 2946-2977 in SEQ ID NO 1632. The claims do not recite any length requirements for the dsRNA strands. The Spec. teaches (e.g., ¶9, ¶37-44) only possible lengths of various embodiments. Those passages allow for strands that are as few as 9 nt or greater than …30 nt in length. Even so, those lengths are merely potential embodiments, not requirements.
The claims encompass sense strands that are at least 90% identical to the target sequence. A sense strand could be at least 90% identical to the target sequence wherein the target sequence is nt 2946-2964, 2953-2971, 2954-2972, 2958-2976, or 2959-2977 of SEQ ID NO 1632. However, the claims don’t recite any requirements for the AS strand. While an artisan would recognize that the strands comprising a dsRNA comprise some amount of complementarity, Claims 1, 4(i), and all the other dependent claims don’t require that the sense and AS strands share any minimal amount of complementarity to one another. Claim 2 requires either complementarity between the sense and AS strands or a maximum strand length. Therefore, the claims encompass numerous AS strands that have little or no complementarity to the target mRNA. Although the Spec. discloses (¶31): As used herein, the term "double-stranded RNA" or "dsRNA" refers to an oligoribonucleotide molecule comprising a duplex structure having two antiparallel and substantially complementary nucleic acid strands, it does not disclose any requirement for what constitutes substantial complementarity or what is a minimum strand length. Therefore the claims encompass strands where, e.g., a 15-mer sense strand has 90% identity with nt 2946-2977 of SEQ ID NO 1632 but the AS strand could comprise an 8-mer with only 7 nt complementarity to the sense strand. Applicant hasn’t demonstrated possession of dsRNA comprising strands of lengths other than 19-mer, and they certainly haven’t demonstrated that dsRNA comprising shorter AS strands or AS strands with little complementarity to the sense strand are actually capable of inhibiting expression of an LPA gene. Fig. 2C shows siLPA compounds that increase LPA gene expression (e.g., siLPA #0298, among others) which demonstrates that some dsRNA formulated for inhibiting expression of an LPA gene do not work as anticipated.
Altogether, it is not clear that full breadth of sequences and dsRNA encompassed by the claims will inhibit expression of a human LPA gene. Since Applicant hasn’t shown a representative number of dsRNAs that read on the full breadth of the claims, Applicant hasn’t demonstrated that they were in possession of the full breadth of the claims.
Regarding what structure is encompassed by the dsRNA comprising sense and AS strands wherein the target sequence is nt 2946-2977 of SEQ ID NO 1632 and wherein the sense sequence is at least 90% identical to the target sequence, the Spec. does not provide information describing its necessary features. The Spec. does not disclose what physical structure(s) is responsible for the claimed function of inhibiting expression of a human LPA gene. Artisans know and the Spec. discusses (¶7) the AS strand is the strand that binds target RNA and is responsible for inhibition of gene expression. Yet the claims do not recite any requirements for the AS strand. The claims encompass a vast number of AS strands and a representative number of those haven’t been demonstrated to inhibit expression of a human LPA gene.
Applicant’s examples (e.g., Fig. 2) show some dsRNA encompassed by the claims inhibit expression of a human LPA gene. However, those examples are not sufficient to provide written description support for any dsRNA comprising sense and AS strands wherein the target sequence is nt 2946-2977 of SEQ ID NO 1632 and wherein the sense sequence is at least 90% identical to the target sequence and wherein the dsRNA inhibits expression of a human LPA gene. Although the claims claim the functional characteristics (i.e., inhibiting expression of a human LPA gene), the functional characteristic is not coupled with any known structure.
Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of inhibiting expression of a human LPA gene. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for inhibiting expression of a human LPA gene] in such a way to demonstrate possession of the full invention as claimed at time of filing. The vast number of AS strands encompassed by the claims do not share a core structure.
The specification teaches only these species within the claimed genus/genera (SEQ ID NOs 104-111 and 403-410 in Table 1 and SEQ ID NOs 702-709 and 1001-1008 in Table 2; Table 2 discloses dsRNAs comprising those SEQ ID NOs correspond to siLPA #s 104-111) but those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims.
While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 1-2, and 4 are rejected for failing to demonstrate possession of the claimed invention. Claims 2, 4, 9, 11, 14, 19, 22-23, 25-26, 29, 32, and 35 are rejected because they depend from Claim(s) 1 and do not remedy the issues.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6, 15, 19, 26, 29, and 33 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claims 6 and 15 recite the broad recitation “a nucleotide sequence selected from the group consisting of SEQ ID NOs:…”, and the claim also recites “…optionally wherein the sense strand and AS strand of the dsRNA respectively comprise the nt sequences of …SEQ ID NOs…” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. It is not clear whether or not the sense and AS strands should be selected from the recited pairs or if a nt sequence that reads on only (a) or (b) is sufficient to meet the claim requirements.
Regarding Claims 6 and 15, the phrase "a nucleotide sequence selected from the group consisting of SEQ ID NOs:…; optionally …SEQ ID NOs…" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
In the interest of compact prosecution the claims are interpreted as the recitations preceded by optionally are merely exemplary and therefore fully optional.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claim 19 recites the broad recitation “…the dsRNA is conjugated to one or more ligands…”, and the claim also recites “…optionally wherein the ligand is GalNAc…” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. It is not clear whether or not the ligand must be GalNAc, or whether any ligand is sufficient to meet the claim requirements.
Regarding Claim 19, the phrase “…the dsRNA is conjugated to one or more ligands… optionally wherein the ligand is GalNAc…” renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
In the interest of compact prosecution the claim is interpreted as the recitations preceded by optionally are merely exemplary and therefore fully optional.
Claims 26 and 33 are each indefinite for being “incomplete in itself”. It is noted that the Table A recited in Claim 26 is merely populated exclusively by chemical structures and Tables 1-4 in Claim 33 is merely populated exclusively by sequences, and there is no reason, other than inconvenience, that the structures cannot be recited in the claims. See MPEP 2173.05(s): “Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant' s convenience.”
Claims 26 and 33 are rejected for those reasons. Claim 29 is rejected because it depends from Claim 26 and doesn’t remedy the issues.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claim 29 recites the broad recitation “the 2 to 10 compounds of formula (I)”, and the claim also recites “optionally wherein the 2 to 10 compounds of formula (I)… the compounds of formula (I)… comprise IgT3…IT4” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. It is not clear whether or not the compounds of formula (I) must be IgT3 or IT4, or whether any compound of formula (I) is sufficient to meet the claim requirements.
Regarding Claim 29, the phrase "optionally wherein the 2 to 10 compounds of formula (I)… the compounds of formula (I)… comprise IgT3…IT4" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
In the interest of compact prosecution the claim is interpreted as the recitations preceded by optionally are merely exemplary and therefore fully optional.
A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. In the present instance, Claim 29 recites IgT3 and IT4. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. IgT3 and IT4 are not terms of the art and they are only defined in Table A. The claim should be revised to recite the structure of each compound in the claim.
In the interest of compact prosecution the claim is interpreted as reciting the compounds IgT3 and IT4 shown here:
PNG
media_image3.png
135
931
media_image3.png
Greyscale
PNG
media_image4.png
166
932
media_image4.png
Greyscale
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1-2, 4, 6, 9, 11, 14, 19, 32-33, and 35 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by United States Patent Application Publication No. US 2024/0344063 (“App063”, published on 17 October 2024 but effectively filed as US Provisional Application 63/074779 on 04 September 2020, “Pro779”). This publication has issued as US Pat. No. 12435336.
Although App063 was published 17 October 2024, the content relied upon for this rejection was effectively filed on 04 September 2020, which is approx. 1.5 months before the earliest provisional document of the instant application.
The App063 content discussed in this rejection are entitled to the priority date of 04 September 2020 and are considered prior art under 35 U.S.C. 102(a)(2).
If the issue date of the U.S. patent or publication date of the U.S. patent application publication or WIPO published application is not before the effective filing date of the claimed invention, it may be applicable as prior art under AIA 35 U.S.C. 102(a)(2) if it was "effectively filed" before the effective filing date of the claimed invention in question with respect to the subject matter relied upon to reject the claim. MPEP § 2152.01 discusses the "effective filing date" of a claimed invention. AIA 35 U.S.C. 102(d) sets forth the criteria to determine when subject matter described in a U.S. patent document was "effectively filed" for purposes of AIA 35 U.S.C. 102(a)(2).
§MPEP 2154.01
See also §MPEP 2152.01.
App063 discloses (§Abstract) oligont that inhibit LPA expression. App063 discloses (¶6/Pro779 ¶6) RNAi nt comprises a sense strand and an antisense (AS) strand that form a duplex region wherein the AS strand comprises a region of complementarity to an LPA mRNA target sequence of any one of various SEQ ID NOs including SEQ ID NOs 67-69. A modified excerpt of Table 2 from the PRO document (starts after ¶197) is presented below to show that App063 SEQ ID NOs 67-69 were in the Pro779 document. Note that Table 2 in the App063 publication starts after ¶227 and discloses the same information.
PNG
media_image5.png
469
990
media_image5.png
Greyscale
Those App063/Pro779 sequences comprise 100% identity to instantly claimed sense strand SEQ ID NOs 107-108 as shown by the following alignments:
US-18-040-302-67
Sequence 67, US/18040302
Publication No. US20240344063A1
GENERAL INFORMATION
APPLICANT: Dicerna Pharmaceuticals, Inc.
TITLE OF INVENTION: Compositions and Metthods for Inhibiting LPA Expression
FILE REFERENCE: 400930-026WO-185217
CURRENT APPLICATION NUMBER: US/18/040,302
CURRENT FILING DATE: 2023-02-02
PRIOR APPLICATION NUMBER: US 63/061,676
PRIOR FILING DATE: 2020-08-05
PRIOR APPLICATION NUMBER: US 63/074,779
PRIOR FILING DATE: 2020-09-04
NUMBER OF SEQ ID NOS: 1197
SEQ ID NO 67
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 100.0%; Score 19; Length 25;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGACAGAGUUAUCAAGGCA 19 claimed SEQ ID NO 107
|||||||||||||||||||
Db 2 GGACAGAGUUAUCAAGGCA 20 App063 SEQ ID NO 67
US-18-040-302-68
Sequence 68, US/18040302
Publication No. US20240344063A1
GENERAL INFORMATION
APPLICANT: Dicerna Pharmaceuticals, Inc.
TITLE OF INVENTION: Compositions and Metthods for Inhibiting LPA Expression
FILE REFERENCE: 400930-026WO-185217
CURRENT APPLICATION NUMBER: US/18/040,302
CURRENT FILING DATE: 2023-02-02
PRIOR APPLICATION NUMBER: US 63/061,676
PRIOR FILING DATE: 2020-08-05
PRIOR APPLICATION NUMBER: US 63/074,779
PRIOR FILING DATE: 2020-09-04
NUMBER OF SEQ ID NOS: 1197
SEQ ID NO 68
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 100.0%; Score 19; Length 25;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGACAGAGUUAUCAAGGCA 19 claimed SEQ ID NO 107
|||||||||||||||||||
Db 1 GGACAGAGUUAUCAAGGCA 19 App063 SEQ ID NO 68
US-18-040-302-69
Sequence 69, US/18040302
Publication No. US20240344063A1
GENERAL INFORMATION
APPLICANT: Dicerna Pharmaceuticals, Inc.
TITLE OF INVENTION: Compositions and Metthods for Inhibiting LPA Expression
FILE REFERENCE: 400930-026WO-185217
CURRENT APPLICATION NUMBER: US/18/040,302
CURRENT FILING DATE: 2023-02-02
PRIOR APPLICATION NUMBER: US 63/061,676
PRIOR FILING DATE: 2020-08-05
PRIOR APPLICATION NUMBER: US 63/074,779
PRIOR FILING DATE: 2020-09-04
NUMBER OF SEQ ID NOS: 1197
SEQ ID NO 69
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 100.0%; Score 19; Length 25;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GACAGAGUUAUCAAGGCAC 19 claimed SEQ ID NO 108
|||||||||||||||||||
Db 1 GACAGAGUUAUCAAGGCAC 19 App063 SEQ ID NO 69
In addition, App063 discloses target SEQ ID NO 868 which is 100% identical to instantly claimed sense strand SEQ ID NO 107, as shown by this alignment:
US-18-807-591-868
Sequence 868, US/18807591
Publication No. US20240401053A1
GENERAL INFORMATION
APPLICANT: DICERNA PHARMACEUTICALS, INC. (en)
TITLE OF INVENTION: COMPOSITIONS AND METHODS OF INHIBITING LPA EXPRESSION (en)
FILE REFERENCE: 400930-026USC1 (211985)
CURRENT APPLICATION NUMBER: US/18/807,591
CURRENT FILING DATE: 2024-08-16
NUMBER OF SEQ ID NOS: 1197
SEQ ID NO 868
LENGTH: 19
TYPE: DNA
FEATURE:
NAME/KEY: source
LOCATION: 1..19
QUALIFIERS: mol_type = other RNA
organism = synthetic construct
note = Synthetic
Query Match 100.0%; Score 19; Length 19;
Best Local Similarity 84.2%;
Matches 16; Conservative 3; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGACAGAGUUAUCAAGGCA 19 claimed SEQ ID NO 107
||||||||::|:|||||||
Db 1 GGACAGAGTTATCAAGGCA 19 App063 SEQ ID NO 868
The table above shows that the sense strand comprising 25-mer App063 SEQ ID NO 68 and 27-mer AS strand comprising App063 SEQ ID NO 468 together comprise LPA-2902. An alignment shows the two strands are complementary:
RESULT 1
US-63-074-779-468/c
Query Match 100.0%; Score 25; DB 1; Length 27;
Best Local Similarity 84.0%;
Matches 21; Conservative 4; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGACAGAGUUAUCAAGGCAAAUACT 25
||||||||::|:|||||||||:|||
Db 25 GGACAGAGTTATCAAGGCAAATACT 1
App063 shows (Fig. 1/Pro779 Fig. 1) LPA-2902 successfully inhibits LPA expression in human cells. Therefore App063 (Pro779) anticipates all limitations of Claim 1.
Regarding Claim 2, the alignment shown above demonstrates that the sense and AS strands are complementary over a region of 25 nt and neither strand is longer than 30 nt. Therefore App063 (Pro779) anticipates all limitations of Claim 2.
Regarding Claim 4(i), the following alignment demonstrates the App063 AS sequence SEQ ID NO 468 targets nt that encompass nt 2958-2976 of instant SEQ ID NO 1632:
RESULT 1
US-63-074-779-468/c
Query Match 0.4%; Score 25.4; DB 1; Length 27;
Best Local Similarity 96.3%;
Matches 26; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 2951 ATGGACAGAGTTATCAAGGCACATACT 2977 SEQ ID NO 1632
||||||||||||||||||||| |||||
Db 27 ATGGACAGAGTTATCAAGGCAAATACT 1 App063 SEQ ID NO 468
Regarding Claim 4(ii), the following alignment demonstrates the provided AS sequence SEQ ID NO 468 is at least 90% identical to claimed SEQ ID NO 406:
RESULT 1
US-63-074-779-468
Query Match 100.0%; Score 19; DB 1; Length 27;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 UGCCUUGAUAACUCUGUCC 19 claimed SEQ ID NO 406
|||||||||||||||||||
Db 7 UGCCUUGAUAACUCUGUCC 25 App063 SEQ ID NO 468
Therefore App063 (Pro779) anticipates all limitations of Claim 4.
Regarding Claim 6, the alignments above show that the sense and AS strands are complementary and the sense strand and AS strands of the dsRNA respectively comprise the nt sequence of claimed SEQ ID NOs 107 and 406. Therefore App063 (Pro779) anticipates all limitations of Claim 6.
Regarding Claim 9, App063 discloses (starts at ¶152/Pro779 ¶117) sugar modifications including 2’-F and 2’-OMe. App063 discloses (¶23/Pro779 ¶23) their oligont comprises at least one modified nt selected from 2’-F, 2’-OMe, and others. Therefore App063 (Pro779) anticipates Claim 9.
Regarding Claim 11, App063 discloses (¶22, ¶110, ¶132-133, ¶143/Pro779 ¶22, ¶76, ¶97-98, ¶108) overhangs of 1-6 nt on either end of either or both strands. Therefore App063 (Pro779) anticipates Claim 11.
Regarding Claim 14, App063 discloses (Fig. 10/Pro779 Fig. 10; ¶106/Pro779 ¶72) dsRNA comprising sense and AS strands comprising alternating regions of 2’-OMe and 2’-F nt (see Figs. 10 Patterns M1-M3). App063 also discloses (same § and Figs.) at least one strand with a region comprising the pattern 2’ F—2’-OMe—2’-F—2’-OMe—2’-F on 5 consecutive individual nt. App063 teaches (same §) benefits of modification: a modified nucleotide may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, reduced immunogenicity, etc. Therefore App063 (Pro779) anticipates Claim 14.
Regarding Claim 19(i) App063 discloses (¶170-181/Pro779 ¶135-146) the dsRNA can be conjugated to a targeting ligand that can be GalNAc. App063 discloses (¶179-180/Pro779 ¶143) conjugation to the dsRNA via a linker. Regarding Claim 19(ii), App063 discloses (¶109/Pro779 ¶75) their dsRNA can be siRNA. Therefore App063 (Pro779) anticipates all limitations of Claim 19.
Regarding Claim 32, App063 discloses (¶24/Pro779 ¶24) their dsRNA comprises at least one modified inter-nt linkage which can be a phosphorothioate linkage. Therefore App063 (Pro779) anticipates Claim 32.
Regarding Claim 33, the alignments above demonstrate that App063 discloses dsRNA wherein the strands comprise claimed SEQ ID NOs 107 and 406. App063 also discloses (¶12-17/Pro779 ¶12-17) their invention encompasses RNAi comprising a sense strand that is 15-30 or 18-36 nt long and an antisense strand that is 15-30 nt long, wherein the strands for a duplex region, and wherein the AS strands forms a 15- or 19-nt region of complementarity to SEQ ID NO 68. That demonstrates that the invention encompasses dsRNA whose strands comprise lengths that vary from 15- to 30-mer, as long as the AS strand comprises complementarity to at least 15 or 19 nt of LPA mRNA (i.e., App063 SEQ ID NO 68). That reads on a dsRNA wherein the sense strand comprises instant SEQ ID NO 107 and the AS strand comprises instant SEQ ID NO 406. Therefore App063 (Pro779) anticipates Claim 33.
Regarding Claim 35, App063 discloses (¶52/Pro779 ¶35) a pharmaceutical composition comprising the RNAi and a pharmaceutically acceptable excipient. Therefore App063 (Pro779) anticipates Claim 35.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-2, 4, 6, 9, 11, 14, 19, 32-33, and 35 are rejected under 35 U.S.C. 103 as being unpatentable over United States Patent Application Publication No. US 2024/0344063 (“App063”, published on 17 October 2024 but effectively filed as US Provisional Application 63/074779 on 04 September 2020, “Pro779”) as applied to Claim(s) 1-2, 4, 6, 9, 11, 14, 19, 32-33, and 35 in the 102 rejection above, and further in view of International Patent Application Publication Number WO2019/092283 ("WO283", published on 19 May 2019, of record). Note: citations to page # in WO documents refer to the PDF p. #.
The teachings of App063 as applicable to Claim(s) 1-2, 4, 6, 9, 11, 19, 32-33, and 35 have been described in the 102 rejection above.
App063 (Pro779) teaches dsRNA that inhibit expression of a human LPA gene, wherein the sense strand comprises claimed SEQ ID NO 107 and wherein the AS strand comprises claimed SEQ ID NO 406.
Regarding Claim 33, App063 does not explicitly disclose the same dsRNAs as in Table 1, wherein the sense strand is claimed SEQ ID NO 107 and wherein the AS strand is claimed SEQ ID NO 406.
However, App063 discloses (¶12-17/Pro779 ¶12-17) their invention encompasses RNAi comprising a sense strand that is 15-30 or 18-36 nt long and an antisense strand that is 15-30 nt long, wherein the strands for a duplex region, and wherein the AS strands forms a 15- or 19-nt region of complementarity to SEQ ID NO 68. That demonstrates that the invention encompasses dsRNA whose strands comprise lengths that vary from 15- to 30-mer, as long as the AS strand comprises complementarity to at least 15 or 19 nt of LPA mRNA (i.e., App063 SEQ ID NO 68). App063 discloses (¶125-130/Pro779 ¶90-95) various lengths of targeting sequence and that they discovered that certain nucleotide sequences of LPA mRNA are more amenable than others to oligonucleotide-based inhibition of LPA expression and are thus useful as target sequences for the oligonucleotides herein.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA for inhibiting LPA gene expression of App063/Pro779 with the teachings of App063/Pro779 for the benefit of identifying the sequence(s) most amenable to oligonucleotide-based inhibition of LPA. One would have been motivated to do so with a reasonable expectation of success because App063/Pro779 teaches using different sequence lengths and that certain nt sequences of LPA mRNA are more amenable than others to inhibition, and those teachings indicate varying the length of sense and AS strands was routine and conventional in the art of dsRNA design. Therefore the limitations of Claim 33 would have been obvious in view of App063.
App063 does not teach the dsRNA comprises alternating 2’-OMe and 2’-F nt (Claim 14) wherein the alternating modifications occur on each individual nt. App063 does not teach the dsRNA comprises inverted nt.
However, WO283, drawn to dsRNAs for targeting LPA, teaches (p. 84 L9-16, p. 112 L9-11, p. 131 L24-27) applying alternating 2’-OMe and 2’-F modifications to siRNAs. WO283 teaches (pp. 24-31 L1-35) various modifications that can be applied to the RNA molecules and teaches there are benefits of doing so. WO283 teaches (p. 22 L4-15) modifications improve in vitro and in vivo stability and bioavailability, minimize the possibility of inducing interferon activity, and enhance functional delivery to cells. WO283 teaches (p. 32 L1-3) using inverted nucleotides and that (p. 35 L5-15) inverted nt at strand ends impart stability to the nucleic acid. WO283 teaches (p. 29 L31-35) benefits of terminal modifications: they can be used to modulate activity or resistance to degradation. WO283 teaches (p. 25 L4-7) modified nt can include 3’terminal dT nt.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of App063/Pro779 with the modification pattern(s) and teachings about modifications of WO283 for the benefit of improving the function of the dsRNA. One would have been motivated to do so with a reasonable expectation of success because WO283 teaches (p. 22 L4-15) modifications improve in vitro and in vivo stability and bioavailability, minimize the possibility of inducing interferon activity, and enhance functional delivery to cells. The teachings of WO283 indicate that incorporating an alternating 2’-OMe and 2’-F modification pattern to dsRNA strands was routine and conventional in the art. Therefore the limitations of Claim 14 would have been obvious in view of App063 and WO283.
Claim(s) 1-2, 4, 6, 9, 11, 14, 19, 22-23, 25-26, 29, 32-33, and 35 are rejected under 35 U.S.C. 103 as being unpatentable over App063 and WO283 as applied to Claim(s) 1-2, 4, 6, 9, 11, 14, 19, 32-33, and 35 in the 103 rejection above, and further in view of International Patent Application Publication Number WO 2019/170731 ("WO731", published on 12 September 2019). Note: citations to page # in WO documents refer to the PDF p. #.
The teachings of App063 and WO283 as applicable to Claim(s) 1-2, 4, 6, 9, 11, 19, 32-33, and 35 have been described in the 103 rejection above.
App063 (Pro779) teaches dsRNA that inhibit expression of a human LPA gene, wherein the sense strand comprises claimed SEQ ID NO 107 and wherein the AS strand comprises claimed SEQ ID NO 406.
App063 and WO283 do not teach the chemical compounds shown in Claims 22 or 25. App063 and WO283 do not teach the modifications described in Claim 23. App063 and WO283 do not teach the modifications described in Claim 26.
However, WO731 teaches limitations App063 does not teach. WO731 is drawn to (§Abstract):
nucleotide precursors and nucleotide analogs that can be incorporated into oligonucleotides, including double-stranded oligonucleotides such as siRNAs. Oligonucleotides containing these analogs have superior biological activity, for example, increased in vitro stability and improved in vivo potency especially duration of action. The improved oligonucleotides are useful for silencing (e.g., reducing or eradicating) the expression of a target gene. In particular embodiments, this invention encompasses specific nucleotide analogs to be included in double-stranded RNAs (dsRNAs), and especially in siRNAs, that can hybridize to messenger RNAs (mRNAs) of interest, so as to reduce or block the expression of target genes of interest.
Regarding Claim 22: WO731 teaches (pp. 10-12, full pages) the same structure—called formula (II)—and allows all the same possible variables as Claim 22. An excerpt of those pages is shown here:
PNG
media_image6.png
901
631
media_image6.png
Greyscale
PNG
media_image7.png
517
632
media_image7.png
Greyscale
Regarding Claim 23: WO731 teaches (pp. 11-12 L15-26) variations of WO731 formula (II) that encompass the same variables as the instant claims. An excerpt of those passages is shown here:
PNG
media_image8.png
191
504
media_image8.png
Greyscale
PNG
media_image8.png
191
504
media_image8.png
Greyscale
Regarding Claim 24: WO731 teaches (pp. 12-13 L29-4) variations of WO731 formula (II) that encompass the same variables as the instant claims. An excerpt of those passages is shown here in a modified excerpt:
PNG
media_image9.png
242
503
media_image9.png
Greyscale
Regarding Claim 25(i): WO731 teaches P. 13 L5-6) R3 can be N-acetyl-galactosamine. Regarding Claim 25(ii): WO731’s Table A (starts on p. 259; see also p. 258 L16-20) shows examples of nt analogs encompassed by their invention. Those include some of the same nt analogs as in Table A in the instant Spec., including IT3 (p. 259), IT4 (p. 260), and IgT3 (p. 263). Table 10 (p. 278) shows sense strands comprising at least one of the nt analogs. Regarding Claim 25(iii): WO731 teaches (p. 12 L27-28) the oligont can comprise from 2-10 compounds of formula (II). Regarding Claim 25(iv): Table 10 (p. 278) shows sense strands comprising 2 nt analogs of the formula at the 5’end and 2 nt analogs of the formula at the 3’end. WO731 teaches (p. 281 L1-5) dTdT overhangs increase dsRNA stability.
Regarding Claim 29: WO731 Table 19 (starts on p. 286) shows sense strands comprising three consecutive IgT3 nt on the 5’end of the sense strand. WO731 Table 23 (starts on p. 291) shows two consecutive IT4 nt on the 3’end of the sense strand.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of App063 and WO283 with the novel nt analogs of WO731 (and their placements with a strand) for the benefit of improving the dsRNA. One would have been motivated to do so with a reasonable expectation of success because WO731 teaches (§Abstract) oligont comprising the analogs have superior biological activity, including increased in vitro stability and improved in vivo potency—especially duration of action—and that the improved oligont are useful for silencing expression of a target gene. It would have been a simple matter to incorporate WO731’s beneficial nt analogs into the dsRNA of App063. Deciding which nt to incorporate where would have been merely a design choice. In addition, WO731 teaches (p. 288 L3-24, p. 293 L1-13) benefits of terminal placement of IT4 and IgT3. Modifying the dsRNA of App063 and WO283 with the novel nt analogs of WO731 would have produced all the limitations of Claims 22-23, 25-26, and 29.
Claim(s) 1-2, 4, 6, 9, 11, 14-15, 19, 22-23, 25-26, 29, 32-33, and 35 are rejected under 35 U.S.C. 103 as being unpatentable over App063, WO283, and WO731 as applied to Claim(s) 1-2, 4, 6, 9, 11, 14, 19, 22-23, 25-26, 29, 32-33, and 35 in the 103 rejection above, and further in view of Vickers (et al. 2000. Effects of RNA secondary structure on cellular antisense activity. Nuc. Acid Res. 28[6]:1340-1347, “Vickers”) and Foster (et al. 2018. Advanced siRNA Designs Further Improve In Vivo Performance of GalNAc-siRNA Conjugates. Molec. Ther. 26[3]:708-717, “Foster”). Note: citations to page # in WO documents refer to the PDF p. #.
The teachings of App063, WO283, and WO731 as applicable to Claim(s) 1-2, 4, 6, 9, 11, 19, 32-33, and 35 have been described in the 103 rejection above.
App063 (Pro779), WO283, and WO731 teach dsRNA that inhibit expression of a human LPA gene, wherein the sense strand comprises claimed SEQ ID NO 107 and wherein the AS strand comprises claimed SEQ ID NO 406. App063 (Pro779), WO283, and WO731 all teach a variety of nt modifications that may be applied to dsRNA. As discussed, WO283 teaches (p. 22 L4-15) modifications improve in vitro and in vivo stability and bioavailability, minimize the possibility of inducing interferon activity, and enhance functional delivery to cells.
The references also teach terminal modifications, including with dT. WO731 teaches (p. 277 Tables 8-9) dsRNA that comprise terminal dTdT nt. WO283 teaches (p. 25 L4-7) modified nt can include 3’terminal dT nt and (p. 29 L31-35) benefits of terminal modifications: they can be used to modulate activity or resistance to degradation.
Regarding Claim 15: As discussed above, App063 teaches target sequences for their dsRNA. Those sequences include (see excerpt of App063/Pro779 Table 2, shown above) App063 SEQ ID NO 869 which comprises the nt sequence GGACAGAGUUAUCAAGGCA.
Vickers, drawn to effects of RNA secondary structure on cellular antisense activity, teaches (§Abstract) mRNA secondary structure can affect hybridization efficiency and potency of RNAi. Vickers teaches (§Introduction ¶3-4) oligont walk to identify sequences with best potency:
Identification of potent antisense sequences has often been based upon empirical approaches to oligonucleotide selection because the optimal target site on the mRNA cannot yet be predicted. Many investigators employ oligonucleotide ‘walks’, spacing oligonucleotides of a given length at intervals along the RNA and choosing the one with the most activity… activity was optimized by testing numerous oligonucleotides shifted either 5′ or 3′ of the initial site. These experiments change not only the target site on the mRNA, but also the sequence and base composition of oligonucleotides. Any or all of these changes might affect oligonucleotide potency. [emphasis added.]
Those teachings indicate it is routine and conventional in the art of interfering oligont design to produce oligont that target points along a target mRNA, and that is done because changing the target site on the mRNA and sequence/base composition of oligont can affect potency.
Foster, drawn to siRNA designs to further improve in vivo performance of siRNA, teaches (§Abstract) refining the proportion of 2’-deoxy-2’-fluoro and 2’-OMe ribosugar modifications across both strands of the dsRNA can enhance stability without compromising activity. Foster teaches (§Introduction ¶4) 2’-F and 2’-OMe modifications should be balanced within a dsRNA to produce the compound(s) with best performance:
It is well known in the field that modifying the position of RNA can significantly enhance the nuclease stability of oligonucleotides and that sterically more demanding modifications, such as 2’-OMe, can have a greater stabilizing effect compared to less bulky modifications, such as 2-F. If not applied judiciously, however, the steric bulk introduced by such modifications can substantially reduce RNAi activity.
Foster teaches (§Introduction ¶4-5) dsRNA comprising 2’-F are well-tolerated while 2’-OMe has better stabilizing effects but is bulkier and can reduce RNAi activity. Foster suggests (same §) refining, analyzing, and further refining dsRNA to improve dsRNA potency and duration. Foster teaches (§Results ¶3) placing 2’-F at positions 2, 6, and 14 of the AS strand. The sum teachings of Foster indicate that it is routine and conventional in the art of dsRNA design to change the proportion of 2’-F and 2’-OMe modifications in the strands of a dsRNA to find the proportion that works best for a chosen purpose.
Based on those teachings, it would have been obvious to an artisan before the effective filing date of the claimed invention to produce AS strands that target any of the target sequences disclosed in App063, including App063 SEQ ID NO 869. It would have been obvious to apply various 2’-F and 2’-OMe modifications to any sequence of a dsRNA, and it would have been obvious to apply a dTdT nt to the 3’-terminal end of either strand.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of App063, WO283, and WO731 with the teachings about the benefits of applying various modifications to a dsRNA of App063, WO283, WO731, and Foster and the teachings about an “oligowalk” to identify the best target sequence of Vickers. One would have done so for the benefit of improving the stability, efficacy, bioavailability, etc. of the dsRNAs. One would have been motivated to do so with a reasonable expectation of success because App063, WO283, WO731, and Foster teach benefits of the various modifications. One would have been motivated to do so with a reasonable expectation of success because Vickers teaches an oligowalk is a routine and conventional part of identifying RNA interference compounds that perform well. One would have been motivated to do so with a reasonable expectation of success because App063 discloses the LPA mRNA target sequence SEQ ID NO 869. Based on the teachings cited, it would have been routine and conventional for an artisan to identify any of the target sequences in App063 and design a modified AS strand to best inhibit that target. An artisan would only have had to produce an AS strand that is 100% complementary to App063 SEQ ID NO 869 and add a terminal dTdT to produce the nucleobase sequence of claimed SEQ ID NO 1005. The following alignment shows the alignment of SEQ ID NO 1005 to App063:
RESULT 2
US-18-040-302-869/c
Sequence 869, US/18040302
Patent No. 12435336
GENERAL INFORMATION
APPLICANT: Dicerna Pharmaceuticals, Inc.
TITLE OF INVENTION: Compositions and Metthods for Inhibiting LPA Expression
FILE REFERENCE: 400930-026WO-185217
CURRENT APPLICATION NUMBER: US/18/040,302
CURRENT FILING DATE: 2023-02-02
PRIOR APPLICATION NUMBER: US 63/061,676
PRIOR FILING DATE: 2020-08-05
PRIOR APPLICATION NUMBER: US 63/074,779
PRIOR FILING DATE: 2020-09-04
NUMBER OF SEQ ID NOS: 1197
SEQ ID NO 869
LENGTH: 19
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 90.5%; Score 19; Length 19;
Best Local Similarity 63.2%;
Matches 12; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUGCCUUGAUAACUCUGUC 19 SEQ ID NO 1005
|:|||::||:|||:|:|:|
Db 19 GTGCCTTGATAACTCTGTC 1 App063 SEQ ID NO 869
But without the terminal dTdT, that alignment is 100% complementary:
RESULT 1
US-63-074-779-869/c
Query Match 100.0%; Score 19; DB 1; Length 19;
Best Local Similarity 63.2%;
Matches 12; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUGCCUUGAUAACUCUGUC 19
|:|||::||:|||:|:|:|
Db 19 GTGCCTTGATAACTCTGTC 1
Then adding the terminal dTdT to the AS targeting App063 SEQ ID NO 869 would have resulted in the nucleobase sequence of claimed SEQ ID NO 1005, including the terminal dTdT.
The teachings of Foster indicate it would have been routine and conventional to then apply various 2’-F and 2’-OMe modifications to that antisense strand. In doing so, an artisan would have produced an AS strand comprising the entire claimed nucleotide sequence SEQ ID NO 1005.
The rationale to make such modifications falls under both “obvious to try” and “routine optimization”.
Obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). The motivation to combine falls under an “obvious to try” rationale; see MPEP 2143(I)(E):
To reject a claim based on this rationale, Office personnel must resolve the Graham factual inquiries. Then, Office personnel must articulate the following:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem;
(2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem;
(3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success; and
(4) whatever additional findings based on the Graham factual inquiries may be necessary, in view of the facts of the case under consideration, to explain a conclusion of obviousness.
The rationale to support a conclusion that the claim would have been obvious is that "a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely that product [was] not of innovation but of ordinary skill and common sense.
Regarding (1): App063 discusses (§ cited above) the market pressure to produce LPA-targeting dsRNA.
Regarding (2): App063 sets forth a large but finite number of target sequences for such LPA-targeting dsRNA. App063 figures (cited above) demonstrate that dsRNA targeting the region around the target sequence SEQ ID NO 869 were effective in inhibiting LPA expression.
Regarding (3): the teachings of the other references (as cited) indicate that all of the changes are well within the purview of what is routine and conventional.
Regarding optimization: As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. MPEP 2144.05 provides: It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions (In re Williams, 36 F.2d 436, 438 (CCPA 1929).
Here, the focus is that general conditions are known in the prior art and changes in form or, possibly, substitution of variants, over the prior art that does the same thing as what is known in the prior art is not patentable. Here both the target sequence (i.e., App063 SEQ ID NO 869) and all of the modifications, including terminal dTdT nt, were known in the art. Substitution of variants in terms of identifying optimal locations and proportions of 2’-F and 2’-OMe nt modifications is not inventive, since varying the locations and proportions in a double stranded RNA of these modifications for optimal or better results is known in the prior art.
Therefore the limitations of Claim 15 would have been obvious in view of App063, WO283, WO731, Vickers, and Foster.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 4, 6, 9, 11, 14, 19, 22-23, 25-26, 29, 32-33, and 35 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 and 18-19 of US Patent No. 11897911 in view of United States Patent Application Publication No. US 2024/0344063 (“App063”, published on 17 October 2024 but effectively filed as US Provisional Application 63/074779 on 04 September 2020, “Pro779”), International Patent Application Publication Number WO2019/092283 ("WO283", published on 19 May 2019, of record), Vickers (et al. 2000. Effects of RNA secondary structure on cellular antisense activity. Nuc. Acid Res. 28[6]:1340-1347, “Vickers”), and Foster (et al. 2018. Advanced siRNA Designs Further Improve In Vivo Performance of GalNAc-siRNA Conjugates. Molec. Ther. 26[3]:708-717, “Foster”).
Although the claims at issue are not identical they are directed to overlapping subject matter and the instant claims would have been obvious in view of the patented claims and the prior art. The instant claims are directed to dsRNAs that inhibit a human LPA gene and comprise complementarity to nt 2946-2977 of SEQ ID NO 1632, and comprise certain SEQ ID NOs, modifications, nt analogs, and modified nt.
The patented claims are directed to nt analogs of the following formula:
PNG
media_image10.png
163
257
media_image10.png
Greyscale
wherein B is a heterocyclic nucleobase… and
PNG
media_image11.png
144
181
media_image11.png
Greyscale
wherein A1….
The structure (and variables allowed in it) is the same structure in the patented and pending claims.
None of the patented claims recites inhibiting an LPA gene, the instantly claimed region on claimed SEQ ID NO 1632, or the claimed SEQ ID NOs, but those would have been obvious in view of the prior art because App063 teaches (§Abstract; ¶6/Pro779 ¶6; Table 2 from the PRO document starts after ¶197 and Table 2 in the App063 publication starts after ¶227; Fig. 1/Pro779 Fig. 1; §starts at ¶152/Pro779 ¶117; ¶23/Pro779 ¶23; ¶22, ¶110, ¶132-133, ¶143/Pro779 ¶22, ¶76, ¶97-98, ¶108; ¶170-181/Pro779 ¶135-146; ¶179-180/Pro779 ¶143; ¶109/Pro779 ¶75; ¶24/Pro779 ¶24; ¶12-17/Pro779 ¶12-17; ¶52/Pro779 ¶35; ¶125-130/Pro779 ¶90-95; Fig. 10/Pro779 Fig. 10; ¶106/Pro779 ¶72) SEQ ID NOs 68, 468, 868 (among others) that target that region on LPA and shows (Fig. 1) sequences capable of reducing LPA gene expression. WO283 teaches (p. 84 L9-16; p. 112 L9-11; p. 131 L24-27; pp. 24-31 L1-35; p. 22 L4-15; p. 32 L1-3; p. 35 L5-15; p. 29 L31-35; p. 25 L4-7) various modifications including terminal dT nt; Vickers teaches (§Abstract; §Introduction ¶3-4) oligowalking along a target mRNA to identify sequences that are most efficacious; and Foster teaches (§Abstract; §Introduction ¶4; §Introduction ¶4-5; §Results ¶3) altering the proportion of 2’F and 2’-OMe modifications in a dsRNA.
It would have been obvious for an artisan to use the formulas of the patented claims with the sequences of App063 for the benefit of inhibiting expression of a human LPA gene. One would have been motivated to do so with a reasonable expectation of success because App063 teaches (¶3-15) there are benefits to using their compounds to inhibit LPA expression and shows (Fig. 1) compounds that are capable of doing so. It also would have been obvious to incorporate various modifications to the dsRNA, including alternating 2’F and 2’OMe modifications because App039 teaches such modifications (cited above) and teaches (¶106/Pro779 ¶72) some benefits of modified nt, including improvements to thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, and reduced immunogenicity. It would have been obvious to apply the modifications and strategies for RNAi optimization as taught by WO283, Vickers, and Foster and one would have done so for the benefit of optimizing the dsRNA.
It would have been a simple matter to swap the dsRNA of App063 for the specific sequences in the patented claims and one would have been motivated to do so for the benefit of reducing LPA expression. Alternatively, it would have been a simple matter to incorporate the nt analog(s) of the formula of the patented claims into the known dsRNA of App063. It would have a simple matter to apply the modifications and strategies for RNAi optimization as taught by WO283, Vickers, and Foster because those references teach such strategies are routine and conventional. Doing so would have produced the invention of the instant claims.
Claims 1-2, 4, 6, 9, 11, 14, 19, 22-23, 25-26, 29, 32-33, and 35 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following copending Application Nos. in view of United States Patent Application Publication No. US 2024/0344063 (“App063”, published on 17 October 2024 but effectively filed as US Provisional Application 63/074779 on 04 September 2020, “Pro779”), International Patent Application Publication Number WO2019/092283 ("WO283", published on 19 May 2019, of record), Vickers (et al. 2000. Effects of RNA secondary structure on cellular antisense activity. Nuc. Acid Res. 28[6]:1340-1347, “Vickers”), and Foster (et al. 2018. Advanced siRNA Designs Further Improve In Vivo Performance of GalNAc-siRNA Conjugates. Molec. Ther. 26[3]:708-717, “Foster”).
App #
Claims
Notes
17638339
11-20
App339
17641014
1-9, 15, 17-23, 26, 28
App014
18248982
20-22
App982
18248988
37-40, 42, 46-47
App988
18532319
35-36, 44, 48, 50-51
App319
19407739
35-51
App739
Although the claims at issue are not identical they are directed to overlapping subject matter and the instant claims would have been obvious in view of the copending claims and the prior art. The instant claims are directed to dsRNAs that inhibit a human LPA gene and comprise complementarity to nt 2946-2977 of SEQ ID NO 1632, and comprise certain SEQ ID NOs, modifications, nt analogs, and modified nt.
The copending claims are directed to dsRNA comprising sense and AS strands comprising an oligont that comprises at least one nt analog of the following formulas (taken from the App339 claims):
PNG
media_image10.png
163
257
media_image10.png
Greyscale
wherein B is a heterocyclic nucleobase… and
PNG
media_image11.png
144
181
media_image11.png
Greyscale
wherein A1….
The different applications call the above chemical structure by different names but the structure (and variables allowed in it) is the same structure in each application.
None of the copending claim sets recites inhibiting an LPA gene, the instantly claimed region on claimed SEQ ID NO 1632, or the claimed SEQ ID NOs, but those would have been obvious in view of the prior art because App063 teaches (§Abstract; ¶6/Pro779 ¶6; Table 2 from the PRO document starts after ¶197 and Table 2 in the App063 publication starts after ¶227; Fig. 1/Pro779 Fig. 1; §starts at ¶152/Pro779 ¶117; ¶23/Pro779 ¶23; ¶22, ¶110, ¶132-133, ¶143/Pro779 ¶22, ¶76, ¶97-98, ¶108; ¶170-181/Pro779 ¶135-146; ¶179-180/Pro779 ¶143; ¶109/Pro779 ¶75; ¶24/Pro779 ¶24; ¶12-17/Pro779 ¶12-17; ¶52/Pro779 ¶35; ¶125-130/Pro779 ¶90-95; Fig. 10/Pro779 Fig. 10; ¶106/Pro779 ¶72) SEQ ID NOs 68, 468, 868 (among others) that target that region on LPA and shows (Fig. 1) sequences capable of reducing LPA gene expression. WO283 teaches (p. 84 L9-16; p. 112 L9-11; p. 131 L24-27; pp. 24-31 L1-35; p. 22 L4-15; p. 32 L1-3; p. 35 L5-15; p. 29 L31-35; p. 25 L4-7) various modifications including terminal dT nt; Vickers teaches (§Abstract; §Introduction ¶3-4) oligowalking along a target mRNA to identify sequences that are most efficacious; and Foster teaches (§Abstract; §Introduction ¶4; §Introduction ¶4-5; §Results ¶3) altering the proportion of 2’F and 2’-OMe modifications in a dsRNA.
It would have been obvious for an artisan to use the formulas of the copending claims with the sequences of App063 for the benefit of inhibiting expression of a human LPA gene. One would have been motivated to do so with a reasonable expectation of success because App063 teaches (¶3-15) there are benefits to using their compounds to inhibit LPA expression and shows (Fig. 1) compounds that are capable of doing so. It also would have been obvious to incorporate various modifications to the dsRNA, including alternating 2’F and 2’OMe modifications because App039 teaches such modifications (cited above) and teaches (¶106/Pro779 ¶72) some benefits of modified nt, including improvements to thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, and reduced immunogenicity. It would have been obvious to apply the modifications and strategies for RNAi optimization as taught by WO283, Vickers, and Foster and one would have done so for the benefit of optimizing the dsRNA.
It would have been a simple matter to swap the dsRNA of App063 for the specific sequences in the copending claims and one would have been motivated to do so for the benefit of reducing LPA expression. Alternatively, it would have been a simple matter to incorporate the nt analog(s) of the formula of the copending claims into the known dsRNA of App063. It would have a simple matter to apply the modifications and strategies for RNAi optimization as taught by WO283, Vickers, and Foster because those references teach such strategies are routine and conventional. Doing so would have produced the invention of the instant claims.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner (Ruth.Arieti@uspto.gov)
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636