DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1, 4, 6, 9, 11, 14-15, 19, 22-23, 25-26, 29, 32-33, 35-37, and 39-41 are pending. Claims 36-37 and 39 are withdrawn from consideration as being directed to nonelected inventions.
Status of the Application
Applicant’s response and amendment filed 24 July 2026 are acknowledged and entered.
Applicant has amended Claims 1, 4, 6, 9, 11, 15, 19, 22, 26, 29, 33. Applicant has added Claims 40-41. Applicant has cancelled Claim 2.
Applicant has amended the claims to overcome Objections; the previous objections are withdrawn.
Applicant has amended the claims to overcome the 112(a) rejection; the 112(a) rejection is withdrawn.
Applicant has amended the claims to overcome the 102 and 103 rejections; the 102 rejection is withdrawn. The 103 rejection is updated in response to claim amendments and maintained.
Applicant has amended the claims to overcome the NSDP rejections; the NSDP rejections are updated in response to claim amendments and maintained.
Claims 1, 4, 6, 9, 11, 14-15, 19, 22-23, 25-26, 29, 32-33, 35, and 40-41 are examined.
Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Information Disclosure Statement
The IDS has been considered.
Claim Interpretation
Claims that recite and/or are interpreted as requiring only one of the limitations.
Any optional limitations recited in Claims 11, 22-23, and 25 are interpreted as fully optional and not required.
Claim 1 recites that the sense and antisense (AS) strands are complementary to each other over a region of 15-25 contiguous nucleotides. That is interpreted as requiring full complementarity over 15-25 nt.
Claim 14 recites that the sense and AS sequences comprise alternating 2’-OMe and 2’-F nt. That claim doesn’t recite any guidelines for the pattern besides that the sense and AS sequences comprise alternating 2’-OMe and 2’-F nt, so it is interpreted as any amount of nt comprising this alternating pattern reads on the claims. (I.e., the claim doesn’t require the alternating pattern is applied to individual nt or that it continues across the entire sequence[s].) Therefore, a 26-mer comprising seven 2’-OMe nt followed by four 2’-F nt followed by fifteen 2’-OMe nt comprises a pattern of alternating 2’-OMe and 2’-F nt so it is considered to read on the claim.
Claim 22 recites said strand(s). That is interpreted as referring to either or both of the sense and AS strand(s).
Claim Objections
Claim 15 is objected to because of the following informalities:
Claim 15 recites …a) the sense strand comprises the nucleotide sequence of SEQ ID NO 1024…, but it should recite 1204..
Note that this is an objection because the issue is understood to be a typographical error. If the claim is intended to recite SEQ ID NO 1024, the claim will be subject to a 112(d) rejection for failing to include all the limitations of the claim from which it depends. That is because SEQ ID NOs 1024 and 1221 aren’t complementary to each other over a region of 15-25 contiguous nt which is required by Claim 1.
Appropriate correction is required.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1, 4, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 are rejected under 35 U.S.C. 103 as being unpatentable over United States Patent Application Publication No. US 2024/0344063 (“App063”, published on 17 October 2024 but effectively filed as US Provisional Application 63/074779 on 04 September 2020, “Pro779”, of record) and International Patent Application Publication Number WO 2019/170731 ("WO731", published on 12 September 2019, of record). This rejection is maintained and updated in view of the claim amendments.
Note: citations to page # in WO documents refer to the PDF p. #.
Although App063 was published 17 October 2024, the content relied upon for this rejection was effectively filed on 04 September 2020, which is approx. 1.5 months before the earliest provisional document of the instant application.
The App063 content discussed in this rejection are entitled to the priority date of 04 September 2020 and are considered prior art under 35 U.S.C. 102(a)(2).
If the issue date of the U.S. patent or publication date of the U.S. patent application publication or WIPO published application is not before the effective filing date of the claimed invention, it may be applicable as prior art under AIA 35 U.S.C. 102(a)(2) if it was "effectively filed" before the effective filing date of the claimed invention in question with respect to the subject matter relied upon to reject the claim. MPEP § 2152.01 discusses the "effective filing date" of a claimed invention. AIA 35 U.S.C. 102(d) sets forth the criteria to determine when subject matter described in a U.S. patent document was "effectively filed" for purposes of AIA 35 U.S.C. 102(a)(2).
§MPEP 2154.01
See also §MPEP 2152.01.
App063 discloses (§Abstract) oligont that inhibit LPA expression. App063 discloses (¶6/Pro779 ¶6) RNAi oligont for reducing LPA expression that comprises a sense strand and an antisense (AS) strand that form a duplex region, wherein the AS strand comprises a region of complementarity to an LPA mRNA target sequence of any one of various SEQ ID NOs including SEQ ID NOs 67-71, wherein the region of complementarity is at least 15 contiguous nt long. A modified excerpt of Table 2 from the PRO document (starts after ¶197) is presented below to show that App063 SEQ ID NOs 67-71 were in the Pro779 document. Note that Table 2 in the App063 publication starts after ¶227 and discloses the same information.
PNG
media_image1.png
411
624
media_image1.png
Greyscale
App063/Pro779 Table 2 teaches the target sequence SEQ ID NO 871. That target is within nt 2946-2977 of claimed SEQ ID NO 1632, as shown by the following alignment:
RESULT 1
NASEQ2_09082026_175524
Query Match 0.3%; Score 19; DB 1; Length 19;
Best Local Similarity 78.9%;
Matches 15; Conservative 4; Mismatches 0; Indels 0; Gaps 0;
Qy 2956 CAGAGTTATCAAGGCACAT 2974 SEQ ID NO 1632
|||||::|:|||||||||:
Db 1 CAGAGUUAUCAAGGCACAU 19 App063 SEQ ID NO 871
App063 teaches sense sequence SEQ ID NO 71 which is a 25-mer that comprises 86.4% identity to claimed SEQ ID NO 1204 (and SEQ ID NO 1231), as shown by the following alignments:
RESULT 1
US-18-040-302-71
Sequence 71, US/18040302
Patent No. 12435336
GENERAL INFORMATION
APPLICANT: Dicerna Pharmaceuticals, Inc.
TITLE OF INVENTION: Compositions and Metthods for Inhibiting LPA Expression
FILE REFERENCE: 400930-026WO-185217
CURRENT APPLICATION NUMBER: US/18/040,302
CURRENT FILING DATE: 2023-02-02
PRIOR APPLICATION NUMBER: US 63/061,676
PRIOR FILING DATE: 2020-08-05
PRIOR APPLICATION NUMBER: US 63/074,779
PRIOR FILING DATE: 2020-09-04
NUMBER OF SEQ ID NOS: 1197
SEQ ID NO 71
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 86.4%; Score 19; Length 25;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 4 GAGUUAUCAAGGCACAUAC 22 claimed SEQ ID NO 1204 and 1231
|||||||||||||||||||
Db 3 GAGUUAUCAAGGCACAUAC 21 App063 SEQ ID NO 71
(The nucleobase sequences of claimed SEQ ID NOs 1204 and 1231 are identical to each other.)
In addition, App063 discloses AS sequence SEQ ID NO 467, which is 95.2% identical to claimed SEQ ID NO 1221 (and SEQ ID NO 1007), as shown by this alignment:
RESULT 14
US-18-040-302-467
Sequence 467, US/18040302
Publication No. US20240344063A1
GENERAL INFORMATION
APPLICANT: Dicerna Pharmaceuticals, Inc.
TITLE OF INVENTION: Compositions and Metthods for Inhibiting LPA Expression
FILE REFERENCE: 400930-026WO-185217
CURRENT APPLICATION NUMBER: US/18/040,302
CURRENT FILING DATE: 2023-02-02
PRIOR APPLICATION NUMBER: US 63/061,676
PRIOR FILING DATE: 2020-08-05
PRIOR APPLICATION NUMBER: US 63/074,779
PRIOR FILING DATE: 2020-09-04
NUMBER OF SEQ ID NOS: 1197
SEQ ID NO 467
LENGTH: 27
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 95.2%; Score 20; Length 27;
Best Local Similarity 95.0%;
Matches 19; Conservative 1; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUAUGUGCCUUGAUAACUCT 20 Claimed SEQ ID NOs 1007 and 1221
|||||||||||||||||||:
Db 1 GUAUGUGCCUUGAUAACUCU 20 App063 SEQ ID NO 467
(The nucleobase sequences of claimed SEQ ID NOs 1007 and 1221 are identical to each other.) Examination of the App063 sequences in comparison with the claimed sequences finds that the nucleobase sequences of claimed SEQ ID NOs 1204 and 1221 are identical to the LPA mRNA target/sense strand (i.e., App063 SEQ ID NO 71), aside from the sense strand 5’terminal TTT and AS strand 3’terminal dTdT.
The table above shows that the sense strand comprising 25-mer App063 SEQ ID NO 71 and 27-mer AS strand comprising App063 SEQ ID NO 471 together comprise LPA-2905. An alignment shows the two strands are fully complementary:
RESULT 1
US-63-074-779-471/c
Query Match 100.0%; Score 25; DB 1; Length 27;
Best Local Similarity 76.0%;
Matches 19; Conservative 6; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CAGAGUUAUCAAGGCACAUACUUCA 25
|||||::|:|||||||||:||::||
Db 25 CAGAGTTATCAAGGCACATACTTCA 1
App063 discusses (¶231 and Pro779 ¶202; Fig. 1) their dsRNA successfully inhibits LPA expression in human cells.
The alignment shown above demonstrates that the sense and AS strands are complementary over a region of 25 nt and neither strand is longer than 30 nt.
Regarding Claim 4, the following alignment demonstrates the App063 AS sequence SEQ ID NO 471 targets nt that encompass nt 2958-2976 of instant SEQ ID NO 1632:
RESULT 1
US-63-074-779-471/c
Query Match 0.4%; Score 27; DB 1; Length 27;
Best Local Similarity 100.0%;
Matches 27; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 2954 GACAGAGTTATCAAGGCACATACTTCA 2980 SEQ ID NO 1632
|||||||||||||||||||||||||||
Db 27 GACAGAGTTATCAAGGCACATACTTCA 1 App063 SEQ ID NO 471
Regarding the exact nucleobase sequences recited in Claim 1: App063 discloses (¶125-130/Pro779 ¶90-95) various lengths of targeting sequence and that they discovered that certain nucleotide sequences of LPA mRNA are more amenable than others to oligonucleotide-based inhibition of LPA expression and are thus useful as target sequences for the oligonucleotides herein. App063 teaches (¶7-8, same in Pro779) the sense strand can be 18-36 nt long and the AS strand can be 15-30 nt long. That indicates App063 envisioned shortening their SEQ ID NOs to any lengths within the range of 18-36 nt (sense strand) and 15-30 nt (AS strand). As mentioned above, the claimed nucleobase sequences of claimed SEQ ID NOs 1204 and 1221 are identical to the LPA mRNA target/sense strand (i.e., App063 SEQ ID NO 71), aside from the sense strand 5’terminal TTT and AS strand 3’terminal dTdT.
Regarding Claim 11, App063 discloses (¶22, ¶97, ¶110, ¶132-133, ¶143/Pro779 ¶22, ¶63, ¶76, ¶97-98, ¶108) overhangs of 1-5 or more nt on either end of either or both strands.
Regarding Claims 19(i) and 41: App063 discloses (¶26, ¶170-181/Pro779 ¶26, ¶135-146) the dsRNA can be conjugated to one or more targeting ligands that can be GalNAc. App063 discloses (¶179-180/Pro779 ¶143) conjugation to the dsRNA via a linker. Regarding Claim 19(ii), App063 discloses (¶109/Pro779 ¶75) their dsRNA can be siRNA.
Regarding Claim 32, App063 discloses (¶24/Pro779 ¶24) their dsRNA comprises at least one modified inter-nt linkage which can be a phosphorothioate linkage.
Regarding Claim 35, App063 discloses (¶52/Pro779 ¶35) a pharmaceutical composition comprising the RNAi and a pharmaceutically acceptable excipient.
Regarding modifications: App063 discloses (starts at ¶152/Pro779 ¶117) sugar modifications including 2’-F and 2’-OMe. App063 discloses (¶23/Pro779 ¶23) their oligont comprises at least one modified nt selected from 2’-F, 2’-OMe, and others. App063 discloses (Fig. 10/Pro779 Fig. 10; ¶106/Pro779 ¶72) dsRNA comprising sense and AS strands comprising alternating regions of 2’-OMe and 2’-F nt (see Figs. 10 Patterns M1-M3). App063 also discloses (same § and Figs.) at least one strand with a region comprising the pattern 2’ F—2’-OMe—2’-F—2’-OMe—2’-F on 5 consecutive individual nt. App063 teaches (same §) benefits of modification: a modified nucleotide may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, reduced immunogenicity, etc.
App063 does not teach the exact nucleobase sequences for either the sense strand sequence comprised by SEQ ID NOs 1204 or the AS strand comprised by SEQ ID NO 1221, wherein sense strand SEQ ID NO 1204 comprises 5’terminal TTT and AS strand SEQ ID NO 1221 comprises 3’terminal dTdT (i.e., instead of a single terminal RNA T).
However, App063 discloses (¶12-17/Pro779 ¶12-17) their invention encompasses RNAi comprising a sense strand that is 15-30 or 18-36 nt long and an AS strand that is 15-30 nt long, wherein the strands form a duplex region, and wherein the AS strand forms a 15- or 19-nt region of complementarity to SEQ ID NO 71. That demonstrates that the invention encompasses dsRNA whose strands comprise lengths that vary from 15- to 30-mer, as long as the AS strand comprises complementarity to at least 15 or 19 nt of LPA mRNA (i.e., App063 SEQ ID NOs 71 and 467). App063 discloses (¶125-130/Pro779 ¶90-95) various lengths of targeting sequence and that they discovered that certain nucleotide sequences of LPA mRNA are more amenable than others to oligonucleotide-based inhibition of LPA expression and are thus useful as target sequences for the oligonucleotides herein.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA for inhibiting LPA gene expression of App063/Pro779 with the teachings of App063/Pro779 for the benefit of identifying the sequence(s) most and least amenable to oligonucleotide-based inhibition of LPA. One would have been motivated to do so with a reasonable expectation of success because App063/Pro779 teaches using different sequence lengths and teaches certain nt sequences of LPA mRNA are more amenable than others to inhibition. Those teachings indicate varying the length of sense and AS strands was routine and conventional in the art of dsRNA design.
App063’s teachings would have motivated an artisan to use the sequences disclosed by App063 as a base sequence that could be shortened. An artisan would have done so for the purpose of identifying whether any sequences shorter than those disclosed by App063 would be effective for inhibiting LPA expression and thereby producing sequences that effectively inhibit but are also shorter and therefore cheaper. Therefore, nucleobase sequences of an AS strand and corresponding sense strand that bind to an LPA target would have been obvious in view of App063. Among those sequences would have been GAGUUAUCAAGGCACAUAC, a 19-mer portion of claimed SEQ ID NO 1204 and GUAUGUGCCUUGAUAACUC, a 19-mer portion of claimed SEQ ID NO 1221, or GUAUGUGCCUUGAUAACUCT, a 20-mer portion of claimed SEQ ID NO 1221. The following alignment shows that AS strand SEQ ID NO 1221 comprises 20 nt complementarity to App063 SEQ ID NO 71:
RESULT 1
NASEQ2_09172026_090057/c
Query Match 95.2%; Score 20; DB 1; Length 25;
Best Local Similarity 65.0%;
Matches 13; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUAUGUGCCUUGAUAACUCT 20 SEQ ID NO 1221
|:|:|:|||::||:|||:||
Db 21 GTATGTGCCTTGATAACTCT 2 Reverse complement of App063 SEQ ID NO 71
App063 does not teach the exact modification patterns comprised by SEQ ID NOs 1204 and 1221 (Claims 1 and 15) or the sense strand comprising 5’terminal TTT and AS strand comprising 3’terminal dTdT. App063 does not teach the chemical compounds shown in Claims 22 or 25. App063 and WO283 do not teach the compounds described in Claim 23. App063 does not teach the modifications described in Claim 26.
However, WO731 teaches the exact modification patterns and DNA-thymine overhangs that are applied to the LPA-targeting sequences that would have been obvious in view of App063 (i.e., sense strand GAGUUAUCAAGGCACAUAC and AS strands GUAUGUGCCUUGAUAACUC or GUAUGUGCCUUGAUAACUCT).
WO731 is drawn to (§Abstract):
nucleotide precursors and nucleotide analogs that can be incorporated into oligonucleotides, including double-stranded oligonucleotides such as siRNAs. Oligonucleotides containing these analogs have superior biological activity, for example, increased in vitro stability and improved in vivo potency especially duration of action. The improved oligonucleotides are useful for silencing (e.g., reducing or eradicating) the expression of a target gene. In particular embodiments, this invention encompasses specific nucleotide analogs to be included in double-stranded RNAs (dsRNAs), and especially in siRNAs, that can hybridize to messenger RNAs (mRNAs) of interest, so as to reduce or block the expression of target genes of interest.
WO731 generically teaches that (pp. 2-4 L15-29) nt modifications can improve on stability, delivery efficiency, and off-target effects in vivo, and (p. 16 L1-15) novel nt analogs can be incorporated into oligont to improve stability and duration of action in vivo.
Regarding the nt modifications applied to the claimed SEQ ID NOs and recited in the claims (i.e., Claims 1, 22-23, 25-26, and 29): WO731 teaches (pp. 10-12, full pages) the same structure—called formula (II)—and allows all the same possible variables as Claim 22. An excerpt of those pages is shown here:
PNG
media_image2.png
901
631
media_image2.png
Greyscale
PNG
media_image3.png
517
632
media_image3.png
Greyscale
Regarding Claim 23: WO731 teaches (pp. 11-12 L15-26) variations of WO731 formula (II) that encompass the same variables as the instant claims. An excerpt of those passages is shown here:
PNG
media_image4.png
191
504
media_image4.png
Greyscale
PNG
media_image4.png
191
504
media_image4.png
Greyscale
Regarding Claim 25: WO731 teaches (pp. 12-13 L29-4) variations of WO731 formula (II) that encompass the same variables as the instant claims. An excerpt of those passages is shown here in a modified excerpt:
PNG
media_image5.png
242
503
media_image5.png
Greyscale
Regarding Claim 26(i): WO731 teaches P. 13 L5-6) R3 can be N-acetyl-galactosamine.
Regarding Claim 26(ii): WO731’s Table A (starts on p. 259; see also p. 258 L16-20) shows examples of nt analogs encompassed by their invention. Those include some of the same nt analogs as in Table A in the instant Spec., including IT3 (p. 259), IT4 (p. 260), and IgT3 (p. 263). Table 10 (p. 278) shows sense strands comprising at least one of the nt analogs.
Regarding Claim 26(iii): WO731 teaches (p. 12 L27-28) the oligont can comprise from 2-10 compounds of formula (II).
Regarding Claim 26(iv): Table 10 (p. 278) shows sense strands comprising 2 nt analogs of the formula at the 5’end and 2 nt analogs of the formula at the 3’end. WO731 teaches (p. 281 L1-5) dTdT overhangs increase dsRNA stability.
Regarding Claim 29: WO731 Table 19 (starts on p. 286) shows sense strands comprising three consecutive IgT3 nt on the 5’end of the sense strand. WO731 Table 23 (starts on p. 291) shows two consecutive IT4 nt on the 3’end of the sense strand.
Regarding Claim 32: WO731’s Table 23 shows modification patterns that comprise one or more phosphodiester (PO) and phosphorothioate (PS) linkages.
Regarding the modification patterns applied to claimed sequences SEQ ID NOs 1204 and 1221, WO731 discloses many different modification patterns which indicates it was routine and conventional in the dsRNA arts to apply different modification patterns to determine which works best. WO731’s examples show doing exactly those experiments.
WO731 teaches (p. 288 L3-25) dsRNAs comprising three IgT3 nt induce robust target knockdown and robust delivery to hepatocytes. WO731 teaches (p. 288 L3-25, Fig. 3) sense strands comprising 5’end attachment of three IgT3 units in combination with double PS on the 3’end show significantly longer duration of action than sense strands comprising 3’end analogs or sense strands lacking double PS on the 3’end. WO731 teaches (same §) the IgT3 nt imparts clear stability benefits.
Regarding the sense strand 5’terminal TTT and AS strand 3’terminal dTdT, WO731 teaches (pp. 290-296) Example 5 which uses as negative control a dsRNA comprising a 22-mer sense strand and a 21-mer AS strand. Those modification patterns are shown here in excerpts of Tables 23-25:
PNG
media_image6.png
158
760
media_image6.png
Greyscale
PNG
media_image7.png
137
760
media_image7.png
Greyscale
PNG
media_image8.png
121
518
media_image8.png
Greyscale
Those modification patterns, including the sense strand 5’terminal TTT and AS strand 3’terminal dTdT, are exactly the same as those applied to claimed sense strand SEQ ID NO 1204 and claimed AS strand SEQ ID NO 1221.
Regarding Claim 14, those modification patterns (and others disclosed in the same tables) comprise alternating 2’-OMe and 2’-F nts.
WO731 teaches (Table 25) these modification patterns were applied to negative control strand sequences and (p. 291 L1-10) mice were treated subcutaneously with a single dose of the siRNA. (Note that siRNA2-0 is also called LV-2 or LV2 and Fig. 1 teaches that is a nonsilencing control.) A person of ordinary skill familiar with experimental design concepts would readily understand that a negative control sequence would be expected to persist through the entire duration of an experiment (because otherwise it’s not performing its negative control function), and Fig. 6 shows that the experiment continued for at least 55 days after subcutaneous dosing. That indicates those specific modification patterns applied to WO731’s siRNA2-0 were selected to impart persistence and stability to a negative control. Those characteristics—stability and persistence over at least 55 days—would have motivated an artisan to apply those same modification patterns to dsRNA sequences intended for treatment purposes for the benefits of increasing dsRNA stability and extending dsRNA persistence.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of App063/Pro779 with the modification pattern(s) of WO731’s negative control ss2-0 (a.k.a. LV2 and LV-2), including but not limited to the 3’terminal *dT*dT overhang connected by PS linkages on the AS strand and the leading 5’terminal IgT3-IgT3-IgT3 modification on the sense strand, and WO731’s teachings about modifications for the benefit of improving the function of the LPA-targeting dsRNA.
One would have been motivated to do so with a reasonable expectation of success because App063 teaches their invention comprises LPA-targeting dsRNA wherein a sense strand is 15-30 nt long and an AS strand is 15-30 nt long, wherein (App063 ¶10) the strands form a 19-mer duplex region, and wherein the AS strand forms a 15- or 19-nt region of complementarity to SEQ ID NO 71; those teachings indicate App063’s invention encompasses nucleobase sequences additional to those expressly taught. One would have been motivated to do so with a reasonable expectation of success because WO731 teaches they applied the specific modification patterns of their siRNA2-0 to their negative control, indicating those patterns impart stability, and an artisan would have found it obvious to try applying those modification patterns to a dsRNA intended to knock down a target. It would have been a simple matter to apply known modification patterns (including 5’ terminal IgT3-IgT3-IgT3 and 3’ terminal *dT*dT) to sequences that would have been obvious in view of App063 SEQ ID NO 71. Therefore, all the limitations of Claims 1, 4, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 would have been obvious in view of App063 and WO731.
Claims 1, 4, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 are rejected under 35 U.S.C. 103 as being unpatentable over App063 and WO731 as applied to Claim(s) 1, 4, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 in the 103 rejection above, and further in view of Vickers (et al. 2000. Effects of RNA secondary structure on cellular antisense activity. Nuc. Acid Res. 28[6]:1340-1347, “Vickers”, of record). Note: citations to page # in WO documents refer to the PDF p. #. This rejection is maintained and updated in view of the claim amendments.
The teachings of App063 and WO731 as applicable to Claim(s) 1, 4, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 have been described in the 103 rejection above.
App063 and WO731 make obvious LPA-targeting dsRNA that comprise specific sequences and modification patterns.
As discussed above, App063 teaches nucleobase sequences that can be shortened within certain parameters.
As discussed above, App063 and WO731 do not explicitly teach the exact nucleobase sequences recited in the instant claims.
However, Vickers, generically drawn to effects of RNA secondary structure on cellular antisense activity, teaches (§Abstract) mRNA secondary structure can affect hybridization efficiency and potency of RNAi. Vickers teaches (§Introduction ¶3-4) oligont walk to identify sequences with best potency:
Identification of potent antisense sequences has often been based upon empirical approaches to oligonucleotide selection because the optimal target site on the mRNA cannot yet be predicted. Many investigators employ oligonucleotide ‘walks’, spacing oligonucleotides of a given length at intervals along the RNA and choosing the one with the most activity… activity was optimized by testing numerous oligonucleotides shifted either 5′ or 3′ of the initial site. These experiments change not only the target site on the mRNA, but also the sequence and base composition of oligonucleotides. Any or all of these changes might affect oligonucleotide potency. [emphasis added.]
Those teachings indicate it is routine and conventional in the art of interfering oligont design to produce oligont that target points along a target mRNA, and that is done because changing the target site on the mRNA and/or oligont’s sequence or base composition can affect potency.
Vickers’ teachings apply generically to design of any interfering RNA for any target. Those teachings indicate it is routine and conventional to design a variety of RNAis to target points along an mRNA to identify the most efficacious ones.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of App063 and WO731 with the teachings about an “oligowalk” to identify the best target sequence of Vickers. One would have been motivated to do so with a reasonable expectation of success because Vickers teaches an oligowalk is a routine and conventional part of identifying RNA interference compounds that perform well and it would have been a simple matter to take the sequences disclosed by App063 and shorten them according to the teachings of App063, thereby slightly modifying the target as taught by Vickers. One would have been motivated to do so with a reasonable expectation of success because App063 discloses the LPA mRNA target sequences, shows their compound LPA-2905 is efficacious, and an artisan would have wanted to produce even shorter nucleobase sequences to produce a less expensive product.
The rationale to make such modifications falls under both “obvious to try” and “routine optimization”.
Obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). The motivation to combine falls under an “obvious to try” rationale; see MPEP 2143(I)(E):
To reject a claim based on this rationale, Office personnel must resolve the Graham factual inquiries. Then, Office personnel must articulate the following:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem;
(2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem;
(3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success; and
(4) whatever additional findings based on the Graham factual inquiries may be necessary, in view of the facts of the case under consideration, to explain a conclusion of obviousness.
The rationale to support a conclusion that the claim would have been obvious is that "a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely that product [was] not of innovation but of ordinary skill and common sense.
Regarding (1): App063 discusses (§ cited above) the market pressure to produce LPA-targeting dsRNA.
Regarding (2): App063 sets forth a large but finite number of target sequences for such LPA-targeting dsRNA and specific size limitations. App063 figures (cited above) demonstrate that dsRNA targeting the region around the sequence targeted by LPA 2905 effectively inhibits LPA expression.
Regarding (3): the teachings of the other references (as cited) indicate that all of the changes are well within the purview of what is routine and conventional.
Regarding optimization: As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. MPEP 2144.05 provides: It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions (In re Williams, 36 F.2d 436, 438 (CCPA 1929).
Here, the focus is that general conditions are known in the prior art and changes in form or, possibly, substitution of variants, over the prior art that does the same thing as what is known in the prior art is not patentable. Here the target sequence (i.e., App063 SEQ ID NO 71) was disclosed in App063 and all of the modifications were disclosed in WO731. Shortening a sequence in terms of identifying optimal length is not inventive, since App063 teaches doing so and Vickers teaches varying an exact sequence for optimal or better results is known.
Therefore, the limitations of Claims 1, 4, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 would have been obvious in view of App063, WO731, and Vickers.
Claims 1, 4, 9, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 are rejected under 35 U.S.C. 103 as being unpatentable over App063 and WO731 as applied to Claim(s) 1, 4, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 in the 103 rejection above, and further in view of International Patent Application Publication Number WO2019/092283 ("WO283", published on 19 May 2019, of record). Note: citations to page # in WO documents refer to the PDF p. #. This rejection is maintained and updated in view of the claim amendments.
The teachings of App063 and WO731 as applicable to Claim(s) 1, 4, 11, 14-15, 19, 22-23, 25-26, 29, 32, 35, and 40-41 have been described in the 103 rejection above.
App063 and WO731 make obvious LPA-targeting dsRNA that comprise specific sequences and modification patterns.
App063 and WO731 do not teach the dsRNA comprises inverted nt (i.e., Claim 9).
However, WO283, drawn to dsRNAs for targeting LPA, teaches (p. 84 L9-16, p. 112 L9-11, p. 131 L24-27) applying alternating 2’-OMe and 2’-F modifications to siRNAs. WO283 teaches (pp. 24-31 L1-35) various modifications that can be applied to the RNA molecules and teaches there are benefits of doing so. WO283 teaches (p. 22 L4-15) modifications improve in vitro and in vivo stability and bioavailability, minimize the possibility of inducing interferon activity, and enhance functional delivery to cells.
Regarding Claim 9: WO283 teaches (pp. 31-32 L24-3) using inverted deoxyribose nucleotides and that (same § and p. 35 L5-15) inverted nt at strand ends impart stability to the nucleic acid. WO283 teaches (p. 29 L31-35) benefits of terminal modifications: they can be used to modulate activity or resistance to degradation.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of App063 and WO731 with the inverted deoxyribose nt of WO283 for the benefit of determining whether or not adding a terminal inverted nt improves the function of the dsRNA. One would have been motivated to do so with a reasonable expectation of success because WO283 teaches (p. 22 L4-15) modifications improve in vitro and in vivo stability and bioavailability, minimize the possibility of inducing interferon activity, and enhance functional delivery to cells, and (p. 35 L5-15) inverted nt impart stability to a nucleic acid. The teachings of WO283 indicate that incorporating any of their modifications or mod patterns to dsRNA strands was routine and conventional in the art. Therefore, the limitations of Claim 9 would have been obvious in view of App063, WO731, and WO283.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 4, 6, 9, 11, 14-15, 19, 22-23, 25-26, 29, 32-33, 35, and 40-41 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 and 18-19 of US Patent No. 11897911 in view of United States Patent Application Publication No. US 2024/0344063 (“App063”, published on 17 October 2024 but effectively filed as US Provisional Application 63/074779 on 04 September 2020, “Pro779”, of record), International Patent Application Publication Number WO 2019/170731 ("WO731", published on 12 September 2019, of record), Vickers (et al. 2000. Effects of RNA secondary structure on cellular antisense activity. Nuc. Acid Res. 28[6]:1340-1347, “Vickers”, of record), and International Patent Application Publication Number WO2019/092283 ("WO283", published on 19 May 2019, of record). This rejection is maintained and updated in view of the claim amendments.
Although the claims at issue are not identical they are directed to overlapping subject matter and the instant claims would have been obvious in view of the patented claims and the prior art. The instant claims are directed to dsRNAs that inhibit a human LPA gene and comprise complementarity to nt 2946-2977 of SEQ ID NO 1632, and comprise certain SEQ ID NOs, modifications, nt analogs, and modified nt.
The patented claims are directed to nt analogs of the following formula:
PNG
media_image9.png
163
257
media_image9.png
Greyscale
wherein B is a heterocyclic nucleobase… and
PNG
media_image10.png
144
181
media_image10.png
Greyscale
wherein A1….
The structure (and variables allowed in it) is the same structure in the patented and pending claims.
None of the patented claims recites inhibiting an LPA gene, the instantly claimed region on claimed SEQ ID NO 1632, or the claimed SEQ ID NOs, but those would have been obvious in view of the prior art:
App063 teaches (§Abstract, ¶6/Pro779 ¶6, Table 2,, ¶231 and Pro779 ¶202; Fig. 1, ¶125-130/Pro779 ¶90-95, ¶7-8, ¶22, ¶97, ¶110, ¶132-133, ¶143/Pro779 ¶22, ¶63, ¶76, ¶97-98, ¶108, ¶26, ¶170-181/Pro779 ¶26, ¶135-146, ¶179-180/Pro779 ¶143, ¶109/Pro779 ¶75, ¶24/Pro779 ¶24, ¶52/Pro779 ¶35, §starts at ¶152/Pro779 ¶117; ¶23/Pro779 ¶23; Fig. 10/Pro779 Fig. 10; ¶106/Pro779 ¶72, Figs. 10 Patterns M1-M3, ¶10-17/Pro779 ¶10-17, ¶125-130/Pro779 ¶90-95) SEQ ID NOs 71, 471, 467, and 871 (among others) that target that region on LPA, variations of them (including shortened variations), and shows (Fig. 1) sequences capable of reducing LPA gene expression.
WO731 teaches (§Abstract), pp. 2-4 L15-29, p. 16 L1-15, pp. 10-12, full pages, pp. 11-12 L15-26, pp. 12-13 L29-4, p. 13 L5-6, Table A [starts on p. 259; see also p. 258 L16-20]; p. 259, p. 260, p. 263, Table 10, p. 12 L27-28, p. 281 L1-5, Table 19 [starts on p. 286], Table 23 [starts on p. 291], p. 288 L3-25, p. 288 L3-25, Fig. 3, pp. 290-296 Example 5, Tables 23-25, Table 25 heading, p. 291 L1-10, Fig. 1) the exact modification patterns claimed and reasons to apply them to any sequence.
Vickers teaches (§Abstract, §Introduction ¶3-4) generic motivation to modify known RNAi sequences.
WO283 teaches (p. 84 L9-16, p. 112 L9-11, p. 131 L24-27, pp. 24-31 L1-35, p. 22 L4-15, pp. 31-32 L24-3, p. 35 L5-15, p. 29 L31-35) inverted nt and reasons to use them.
It would have been obvious for an artisan to use the formulas of the patented claims with the sequences that would have been obvious in view of App063 and Vickers for the benefit of optimizing LPA inhibition. One would have been motivated to do so with a reasonable expectation of success because App063 teaches (¶3-15) there are benefits to using their compounds to inhibit LPA expression and shows (Fig. 1) compounds that are capable of doing so but WO731 teaches RNAis can be further improved by incorporating modified nts. It would have been obvious to incorporate various modifications to the dsRNA, including the patterns of WO731 and/or the inverted nt of WO283 because WO731 teaches modifications improve in vivo targeting and their experiments indicate that the particular mod patterns of siRNA2-0 improve stability and persistence and WO283 teaches inverted bases improve stability. One would have made those modifications for the benefit of optimizing an LPA-targeting dsRNA.
It would have been a simple matter to use the modified nt of the patented claims in the LPA-targeting sequences that would have been obvious in view of App063, WO731, and Vickers. In fact, the modified nt of the patented claims are required to produce the LPA-targeting sequences that would have been obvious in view of App063, WO731, and Vickers. It would have a simple matter to apply the modifications and strategies for RNAi optimization as taught by App063, WO731, Vickers, and WO283, because LPA was a known target of interest and all the modifications were known, and the references teach such optimization strategies are routine and conventional. Doing so would have produced the invention of the instant claims.
Claims 1, 4, 6, 9, 11, 14-15, 19, 22-23, 25-26, 29, 32-33, 35, and 40-41 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following copending Application Nos. in view of App063WO731, Vickers, and WO283. This rejection is maintained and updated in view of the claim amendments.
App #
Claims
Notes
17638339
11-20
App339
17641014
1-5, 7-9, 15, 17-21, 23, 26, 28
App014
18248982
20-22
App982
18248988
37-40, 42, 46-47
App988
19407739
35-36, 48, 50-51
App739
Although the claims at issue are not identical they are directed to overlapping subject matter and the instant claims would have been obvious in view of the copending claims and the prior art. The instant claims are directed to dsRNAs that inhibit a human LPA gene and comprise complementarity to nt 2946-2977 of SEQ ID NO 1632, and comprise certain SEQ ID NOs, modifications, nt analogs, and modified nt.
The copending claims are directed to dsRNA comprising sense and AS strands comprising an oligont that comprises at least one nt analog of the following formulas (taken from the App339 claims):
PNG
media_image9.png
163
257
media_image9.png
Greyscale
wherein B is a heterocyclic nucleobase… and
PNG
media_image10.png
144
181
media_image10.png
Greyscale
wherein A1….
The different applications call the above chemical structure by different names but the structure (and variables allowed in it) is the same structure in each application.
None of the copending claim sets recites inhibiting an LPA gene, the instantly claimed region on claimed SEQ ID NO 1632, or the claimed SEQ ID NOs, but those would have been obvious in view of the prior art:
App063 teaches (§Abstract, ¶6/Pro779 ¶6, Table 2,, ¶231 and Pro779 ¶202; Fig. 1, ¶125-130/Pro779 ¶90-95, ¶7-8, ¶22, ¶97, ¶110, ¶132-133, ¶143/Pro779 ¶22, ¶63, ¶76, ¶97-98, ¶108, ¶26, ¶170-181/Pro779 ¶26, ¶135-146, ¶179-180/Pro779 ¶143, ¶109/Pro779 ¶75, ¶24/Pro779 ¶24, ¶52/Pro779 ¶35, §starts at ¶152/Pro779 ¶117; ¶23/Pro779 ¶23; Fig. 10/Pro779 Fig. 10; ¶106/Pro779 ¶72, Figs. 10 Patterns M1-M3, ¶10-17/Pro779 ¶10-17, ¶125-130/Pro779 ¶90-95) SEQ ID NOs 71, 471, 467, and 871 (among others) that target that region on LPA, variations of them (including shortened variations), and shows (Fig. 1) sequences capable of reducing LPA gene expression.
WO731 teaches (§Abstract), pp. 2-4 L15-29, p. 16 L1-15, pp. 10-12, full pages, pp. 11-12 L15-26, pp. 12-13 L29-4, p. 13 L5-6, Table A [starts on p. 259; see also p. 258 L16-20]; p. 259, p. 260, p. 263, Table 10, p. 12 L27-28, p. 281 L1-5, Table 19 [starts on p. 286], Table 23 [starts on p. 291], p. 288 L3-25, p. 288 L3-25, Fig. 3, pp. 290-296 Example 5, Tables 23-25, Table 25 heading, p. 291 L1-10, Fig. 1) the exact modification patterns claimed and reasons to apply them to any sequence.
Vickers teaches (§Abstract, §Introduction ¶3-4) generic motivation to modify known RNAi sequences.
WO283 teaches (p. 84 L9-16, p. 112 L9-11, p. 131 L24-27, pp. 24-31 L1-35, p. 22 L4-15, pp. 31-32 L24-3, p. 35 L5-15, p. 29 L31-35) inverted nt and reasons to use them.
It would have been obvious for an artisan to use the formulas of the copending claims with the sequences that would have been obvious in view of App063 and Vickers for the benefit of optimizing LPA inhibition. One would have been motivated to do so with a reasonable expectation of success because App063 teaches (¶3-15) there are benefits to using their compounds to inhibit LPA expression and shows (Fig. 1) compounds that are capable of doing so but WO731 teaches RNAis can be further improved by incorporating modified nts. It would have been obvious to incorporate various modifications to the dsRNA, including the patterns of WO731 and/or the inverted nt of WO283 because WO731 teaches modifications improve in vivo targeting and their experiments indicate that the particular mod patterns of siRNA2-0 improve stability and persistence and WO283 teaches inverted bases improve stability. One would have made those modifications for the benefit of optimizing an LPA-targeting dsRNA.
It would have been a simple matter to use the modified nt of the copending claims in the LPA-targeting sequences that would have been obvious in view of App063, WO731, and Vickers. In fact, the modified nt of the copending claims are required to produce the LPA-targeting sequences that would have been obvious in view of App063, WO731, and Vickers. It would have a simple matter to apply the modifications and strategies for RNAi optimization as taught by App063, WO731, Vickers, and WO283, because LPA was a known target of interest and all the modifications were known, and the references teach such optimization strategies are routine and conventional. Doing so would have produced the invention of the instant claims.
This is a provisional nonstatutory double patenting rejection.
Potentially Allowable Subject Matter & Sequences Free of Prior Art of Record
The following sequences comprising specific modification patterns were searched and found nonobvious over the prior art of record:
SEQ ID NOs 708, 1007, 1231-1296, and 1429.
Although the target, sequences comprising portions of those SEQ ID NOs, and general modifications were known, each of those SEQ ID NOs requires a combination of specific nucleobase sequences and modification patterns that wouldn’t have been prima facie obvious in view of the prior art.
Claims 6 and 33 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Response to Arguments
Arguments that are no longer relevant are not addressed.
Claim objection
There is a typographical error in Claim 15.
Written Description
Applicant’s arguments, see pp. 16-17, filed 24 July 2026, with respect to the written description (WD) rejections have been fully considered and are persuasive as they pertain to the amended claims. The WD rejection is not applied to the amended claims because the prior art (App063) indicates that (¶6) LPA-targeting dsRNA routinely comprise sense and AS strands that have a region of complementarity that is at least 15 contiguous nt long. The written description rejections are withdrawn.
103 & NSDP
Applicant's arguments filed 24 July 2026, with respect to the 103 rejections have been fully considered. Those arguments are persuasive as they pertain to Claims 6 and 33 because, although the target was known and sequences comprising portions of the SEQ ID NOs were known, those two claims require a combination of the specific SEQ ID NOs and modification patterns that wouldn’t have been prima facie obvious in view of the prior art. However, the arguments are not persuasive as they pertain to the other claims.
103
Applicant argues against the 103 rejections on Remarks pp. 21-27. (References to ¶ # count ¶1 as the first full ¶ on a page. ¶0 refers to a first partial ¶.)
Applicant argues (pp. 21-23 ¶3-2) the claimed dsRNA are not taught or suggested by the cited references. That is not persuasive because App063 teaches LPA target nucleobase sequences and dsRNA nucleobase sequences that encompass the exact nucleobase sequences claimed (aside from the AS strand’s 3’terminal *dT*dT overhang and the sense strand’s 5’terminal IgT3-IgT3-IgT3). App063 also teaches instructions for shortening any of their LPA-targeting nucleobase sequences and one would have done so to produce cheaper dsRNA. Furthermore, the only portions of claimed nucleobase sequences SEQ ID NOs 1204 and 1221 that are not encompassed by teachings in App063 are merely the AS strand 3’terminal *dT*dT overhang and the sense strand’s 5’terminal IgT3-IgT3-IgT3. Those exact nucleobases are disclosed by WO731 as part of whole-strand modification patterns on WO731’s siRNA2-0. Incidentally, those are the same exact whole-strand modification patterns applied to SEQ ID NOs 1204 and 1221.
As discussed in the 103 rejection, WO731 teaches reasons to modify, including that IgT3 imparts certain benefits (improved persistence and stability). The rejection explains that WO731 used siRNA siRNA2-0 as their negative control, indicating those patterns impart stability. The rejection explains that an artisan would have found it obvious to try applying those modification patterns to a dsRNA intended to knock down a target and it would have been a simple matter to apply known modification patterns (including the additional nucleobases 5’ terminal IgT3-IgT3-IgT3 and 3’ terminal *dT*dT) to sequences that would have been obvious in view of App063 SEQ ID NO 71.
Contrary to Applicant’s arguments, the nucleobase sequences are generally taught as well as explicitly suggested because App063 discloses the nucleobase targets, how to shorten them, and WO731 discloses the exact mod patterns, benefits of some of those patterns, and a person of ordinary skill would have perceived further benefits due to the fact that WO731’s siRNA2-0 was used as a negative control in a long-term experiment.
Regarding Applicant’s arguments that WO283 fails to teach anything about LPA-targeting sequences, that isn’t persuasive because WO283 was applied only to explain why the inverted nt would have been obvious and the rejection explains that WO283 teaches inverted nt provide stability.
Then Applicant argues that (p. 23 ¶0-1) since App063’s siRNA were already effective, an artisan wouldn’t have been motivated to further modify them.
That isn’t found persuasive because the rejection explains that App063 teaches shorter and (¶145/Pro ¶110) slightly different versions of their sequences. In and of itself that indicates App063 anticipated improving their sequences. For example, App063 teaches (¶145) sequence alterations (i.e., mismatches) can improve or increase potency of the dsRNA; that includes mismatches at strand ends. Furthermore, an artisan would have wanted to determine if shorter sequences could be effective because a shorter nt sequence would be a less expensive nt sequence. In addition, WO731 teaches generically that (pp. 2-4 L15-29) modifications can improve on stability, delivery efficiency, and off-target effects in vivo, and (p. 16 L1-15) novel nt analogs can be incorporated into oligont to improve stability and duration of action in vivo. As discussed previously, WO731 discloses the exact modification patterns claimed for SEQ ID NOs 1204 and 1221 and the fact that those mod patterns were used on WO731’s negative control indicates they impart the benefits of increased stability and persistence. All of those reasons explain why it would have been both beneficial and desirable to modify the base sequences disclosed by App063: shorter and therefore cheaper dsRNA, and increase in stability and persistence. In making those changes, an artisan would have arrived at exactly the claimed subject matter.
Applicant argues that (p. 36 ¶2) Vickers doesn’t teach anything about an LPA-targeting dsRNA and Vickers doesn’t discuss the LPA-targeting nucleobase sequences and mod patterns of the claimed SEQ ID NOs. Those arguments aren’t found persuasive because Vickers wasn’t applied to teach anything about targeting LPA or any mod patterns. Vickers was applied because it generically teaches that mRNA secondary structure can affect hybridization efficiency and potency of RNAi, and that an optimal target site in a target mRNA cannot be predicted, so investigators typically employ oligowalks along a target. Vickers teaches those oligowalks change the sequence and base composition of an RNAi. A person of ordinary skill in the art would have readily recognized that they should synthesize Vickers’s generic teachings about RNAi and mRNA structure with App063’s teachings about producing shorter sequences because some sequences are more amenable to target silencing than others. Doing so would have produced the claimed nucleobase sequences.
Then Applicant argues their dsRNAs achieved surprising results (pp. 23-24 ¶2-2). Those arguments are also unpersuasive. In that §, Applicant discusses results summarized in Tables 5-7 and 10. The results shown in Tables 5-6 don’t show siLPA#307 (which comprises exactly Claimed SEQ ID NOs 1204 and 1221, see Table 3 on Spec. p. 53) which is the only claimed compound currently deemed obvious. As for Table 7, the results it shows for siLPA#307 aren’t found particularly unexpectedly good. The compounds siLPAs #300, #305, and #306 all appear to have Imax and IC50 values that are similar to siLPA#307, and all of those compounds perform consistently well across all three species. Therefore , the results shown for siLPA#307 in Table 7 appear to meet expectations; they are not deemed unexpected.
As discussed above, an artisan would have expected the mod pattern of WO731’s siRNA2-0 to be stabler and more persistent than other mod patterns. The rationale underlying that has been explained above.
The results shown in Table 10 aren’t found persuasive of unexpectedly good results because that table compares the parent molecule siLPA#307 with siLPAs #317 to #382 (which comprise sense strand SEQ ID NOs 1231-1296). Most of the child compounds have a half-life of 72 hr while the parent LPA#307 has a half-life of 48 hr. The child compounds claimed have been indicated allowable since the combination of nucleobase sequence and mod pattern wasn’t found in the art. However, the parent’s 48 hr half-life is used as a basis for comparison with the child compounds. Therefore, by Applicant’s own rationale, it cannot be considered an improvement over them. In addition, Table 9 shows many compounds have a 48 hr half-life. Therefore, those arguments aren’t found persuasive.
Altogether, none of Applicant’s arguments are found persuasive and the 103 rejections are maintained.
NSDP
Applicant argues against the NSDP rejection over US911 on p. 27 ¶3. The arguments against the App063, WO731, Vickers, and WO283 references as applied to the NSDP rejections are not found persuasive because the arguments against the those references as applied to the 103 rejection are not found persuasive.
The NSDP rejection over App219 is withdrawn since the application is abandoned.
Applicant has asked that the other NSDP rejections be held in abeyance, so they are maintained for the time being.
Conclusion
No claim is allowed. Claims 6 and 33 are potentially allowable but they depend from a rejected claim.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636
Prosecution Insights