DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s election without traverse of group I and the species nucleotides 143-463 of SEQ ID NO: 1181, SEQ ID NOs: 13, 227, 441, 655, 858, and 1020 in the reply filed on 12/12/25 is acknowledged.
Claims 35, 36, and 40-42 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/12/25.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 2, 4, 9, 11, 12, 15, 17-22, 30, 31, and 34 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are directed to dsRNA of any length up to 30 nucleotides that inhibit the expression of a human ANGPTL3 gene, wherein the dsRNA comprises a sense and an antisense strand, wherein the sense strand comprises a sense sequence and the antisense strand comprising an antisense sequence, wherein the sense sequence is at least 90% identical to nucleotides 143-163 of SEQ ID NO: 1181.
The species of the specification of siRNAs are not representative of any dsRNA wherein the sense and antisense strand have varying degrees of complementarity between them (no specified amount in claim 1) and wherein the sense and antisense strands have length limitations of 30 nucleotides but the sense and antisense sequences within them are of any shorter length (i.e. 4 nt) that would have the function as claimed. The specification does not adequately describe the structure required for the recited function.
The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated:
"A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
The claims are rejected under the written description requirement for failing to disclose adequate species to represent the claimed genus, the genus being dsRNAs of any length that comprise a shorter sense sequence that is at least 90% identical to nucleotides 143-163 of SEQ ID NO: 1181 and have the function of inhibiting the expression of a human ANGPTL3 gene.
The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing.
To achieve the desired function, it appears that the structure is required to be of a shorter length than the claimed genus which has no length limitation. With respect to siRNAs, as single species of dsRNAs, Elbashir et al. (The EMBO Journal, Vol. 20, No. 23, pages 6877-6888, 2001) teaches that duplexes of 21-23 nt RNAs are the sequence specific mediators of RNAi and that even single mismatches between the siRNA duplex and the target mRNA abolish interference (abstract and page 6888).
Thus, having analyzed the claims with regard to the Written Description guidelines, it is clear that the specification does not disclose a representative number of species for dsRNAs within the instant enormous genus that are inhibitory of the target as claimed. Thus, one skilled in the art would be led to conclude that Applicant was not in possession of the claimed invention at the time the application was filed.
Response to Arguments
Applicant respectfully submits that the specification as filed provides a representative number of exemplary dsRNA species falling within the scope of amended claim 1 and sufficient description of the structure of the claimed dsRNAs required for the recited function. For example, Table 1 at pages 22 and 29, Table 2 at pages 32, 58, and 59, and Table 3 at pages 70-78 provide a number of exemplary dsRNA sequences falling within the scope of amended claim 1, with or without chemical modifications. These exemplary dsRNAs comprise a sense strand and an antisense strand that each has a length of no more than 30 nucleotides as presently claimed. As another example, paragraphs [0063], [0065]-[0073], [0084], [0085], and [0122] of the instant specification provide extensive teachings of the length of dsRNAs having the function of inhibiting the expression of a human ANGPTL3 gene.
Contrary to applicant’s arguments, the species of siRNAs of the specification are not representative of the entire claimed genus of dsRNAs having sense and antisense strands up to 30 nucleotides in length (i.e. 8 nt or 30 nt) wherein the strands have shorter sense and antisense sequences, respectively (i.e. 4 or 10 nt), within the strands, and function as claimed.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1, 2, 4, 9, 11, 12, 17-19, and 34 is/are rejected under 35 U.S.C. 102(a)(1) or (a)(2) as being anticipated by Bettencourt et al. (WO 2012/177784 A2).
Bettencourt et al. teach dsRNAs targeting ANGPTL3 (abstract). Bettencourt et al. teach a siRNA (instant claim 19) comprising a sense and an antisense strand, wherein the sense strand is 100% identical to the target sequence and wherein the target sequence is nucleotides 140-162 of ANGPTL3 NM_014495.2 (see AD-52656.1 on page 168) (instant claim 1). Bettencourt et al. teach a siRNA (instant claim 19) comprising a sense and an antisense strand, wherein the sense strand is 100% identical to the target sequence and wherein the target sequence is nucleotides 147-165 of ANGPTL3 NM_014495.2 (see AD-45909.1 on page 132) (instant claim 1).
Bettencourt et al. teach a siRNA (instant claim 19) comprising a sense and an antisense strand, wherein the sense strand is 100% identical to the target sequence and wherein the target sequence is nucleotides 143-161 of ANGPTL3 NM_014495.2 (see AD-45903.1 on page 133) (instant claim 1).
Bettencourt et al. teach a siRNA (instant claim 19) comprising a sense and an antisense strand, wherein the sense strand is 100% identical to the target sequence and wherein the target sequence is nucleotides 144-162 of ANGPTL3 NM_014495.2 (see AD-15838.1 on page 134) (instant claim 1).
Regarding AD-52656.1, Each strand is not more than 30 nucleotides in length and the strands are complementary to each other over 21 contiguous nucleotides (instant claim 2).
The sense sequence comprises instant SEQ ID NO: 13 (nucleotides 3-21) and the antisense sequence comprises instant SEQ ID NO: 227 (nucleotides 3-21) (instant claim 4).
Bettencourt et al. teaches that the siRNA can comprise one or more 2’-O-methyl modifications (page 3) (instant claim 9).
Table 3 (page 135) of Bettencourt et al. demonstrate modification patterns incorporating 2’-O-methyl modifications and phosphorothioate linkages in both strands.
Bettencourt et al. teaches that at least one strand of the siRNA comprises a 3’-overhang of at least 1 or 2 nucleotides (page 3) (instant claims 11 and 12).
Bettencourt et al. teaches that the siRNA comprises a ligand that is conjugated to the 3’-end, wherein the ligand is N-acetylgalactosamine (page 3) (instant claims 17 and 18).
Bettencourt et al. teaches that the siRNA comprises a phosphorothioate group (page 3) (instant claim 30).
Bettencourt et al. teach that provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier (instant claim 34).
Therefore, the claims are anticipated by Bettencourt et al.
Response to Arguments
Applicant argues that the positions of the target sequences of the siRNA sequences of Bettencourt are provided relative to the sequence of NM_014495.2, whereas the nucleotide positions referred to in the present application are based on NM_014495.3 (SEQ ID NO: 1181). Applicant respectfully notes that the target sequences disclosed in Bettencourt are different sequences from nucleotides 143-161 of SEQ ID NO: 1181, as recited in instant claim 1. As such, the siRNAs of Bettencourt referenced by the Office actually target entirely different sequences from those targeted by the presently claimed dsRNA. For example, AD-52656.1 of Bettencourt, which allegedly targets nucleotides 140-162 of NM_014495.2, has a sense strand sequence of CCAGAGCCAAAAUCAAGAUUU. Thus, the sense strand sequence of AD-52656.1 of Bettencourt is not at least 90% identical to the target sequence recited in claim 1, i.e., nucleotides 143-161 of SEQ ID NO: 1181, which has the sequence of AGACAAUUCAUCAUUUGAU.
Contrary to applicant’s arguments, the sequences of Bettencourt et al. meet the instant structural limitations. The antisense sequence of AD-52656.1 (AAAUCUUGAUUUUGGCUCUGGAG) is less than 30 nucleotides in length and comprises an antisense sequence at nucleotides 3-21 that is 100% identical to instant SEQ ID NO: 227, as required in instant claim 4, which necessarily anticipates the base claim. The instant claims are directed to antisense strands comprising antisense sequences. The full antisense strand of Bettencourt et al. can be interpreted as comprising a smaller fragment antisense sequence that is 100% identical to instant SEQ ID NO: 227.
Bettencourt et al. is not required to teach the entire full length sequence as identical to instant SEQ ID NO: 1181, but is rather required to teach a dsRNA that meets the instant structural limitations.
Applicant argues that none of the sense strand sequences of other siRNAs of Bettencourt referenced by the Office, including AD-45909.1, AD-45903.1, and AD- 15838.1, are at least 90% identical to the target sequence recited in instant claim 1. Applicant is arguing limitations that are not claimed because the instant claims do not require for the antisense strand to be 90% identical to nucleotides 143-161 of SEQ ID NO: 1181 over its full length and in fact do not require even the fragment (antisense sequence) to be 90% identical to nucleotides 143-161 of SEQ ID NO: 1181 over its full length.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1, 2, 4, 9, 11, 12, 15, 17-22, 30, 31, and 34 is/are rejected under 35 U.S.C. 103 as being unpatentable over Bettencourt et al. (WO 2012/177784 A2) as applied to claims 1, 2, 4, 9, 11, 12, 17-19, and 34 above, and further in view of Nair et al. (J. Am. Chem. Soc. 2014, 136, 16958−16961).
Bettencourt et al. teach dsRNAs targeting ANGPTL3 (abstract). Bettencourt et al. teach a siRNA (instant claim 19) comprising a sense and an antisense strand, wherein the sense strand is 100% identical to the target sequence and wherein the target sequence is nucleotides 140-162 of ANGPTL3 NM_014495.2 (see AD-52656.1 on page 168) (instant claim 1). Bettencourt et al. teach a siRNA (instant claim 19) comprising a sense and an antisense strand, wherein the sense strand is 100% identical to the target sequence and wherein the target sequence is nucleotides 147-165 of ANGPTL3 NM_014495.2 (see AD-45909.1 on page 132) (instant claim 1).
Bettencourt et al. teach a siRNA (instant claim 19) comprising a sense and an antisense strand, wherein the sense strand is 100% identical to the target sequence and wherein the target sequence is nucleotides 143-161 of ANGPTL3 NM_014495.2 (see AD-45903.1 on page 133) (instant claim 1).
Bettencourt et al. teach a siRNA (instant claim 19) comprising a sense and an antisense strand, wherein the sense strand is 100% identical to the target sequence and wherein the target sequence is nucleotides 144-162 of ANGPTL3 NM_014495.2 (see AD-15838.1 on page 134) (instant claim 1).
Regarding AD-52656.1, Each strand is not more than 30 nucleotides in length and the strands are complementary to each other over 21 contiguous nucleotides (instant claim 2).
The sense sequence comprises instant SEQ ID NO: 13 (nucleotides 3-21) and the antisense sequence comprises instant SEQ ID NO: 227 (nucleotides 3-21) (instant claim 4).
Bettencourt et al. teaches that the siRNA can comprise one or more 2’-O-methyl modifications (page 3) (instant claim 9).
Table 3 (page 135) of Bettencourt et al. demonstrate modification patterns incorporating 2’-O-methyl modifications and phosphorothioate linkages in both strands.
Bettencourt et al. teach: In certain embodiments of the invention, the dsRNAs comprise at least one modified nucleotide. In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a 2'-0-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group. In another embodiment, the modified nucleotide is selected from the group consisting of a 2'- deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2' -amino-modified nucleotide, a 2' -alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide (page 3).
Bettencourt et al. teach incorporation of 5’ and/or 3’ inverted terminal bases including dT.
Bettencourt et al. teaches that at least one strand of the siRNA comprises a 3’-overhang of at least 1 or 2 nucleotides (page 3) (instant claims 11 and 12).
Bettencourt et al. teaches that the siRNA comprises a ligand that is conjugated to the 3’-end, wherein the ligand is N-acetylgalactosamine (page 3) (instant claims 17 and 18).
Bettencourt et al. teaches that the siRNA comprises a phosphorothioate group (page 3) (instant claim 30).
Bettencourt et al. teach that provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier (instant claim 34).
Although Bettencourt et al. teach conjugation to Gal-NAc (pages 4 and 50), Bettencourt et al. do not teach conjugation via the structure recited in instant claims 20-22. However, the broad genus of possible structures of instant claims 20-22 encompasses GalNAc-based ligands that were known in the art for the delivery of siRNA. The ligand-linker scaffold is evidenced by Nair et al. (page 16959), wherein the vertex of the ring of Nair et al. has only two bonds and no substituent, representing the oxygen. Nair et al. incorporate the 6-membered ring, O, same OH pattern, and same anomeric linkage. Therefore, it would have been obvious to utilize the known GalNAc conjugate structure to conjugate the GalNAc of Bettencourt et al. with a reasonable expectation of success given that Nair et al. teach that the conjugation optimizes systemic stability and improved pharmacokinetics (page 16959).
Although Bettencourt et al. teach incorporation of 2’-O-methyl, 2’-F, phosphorothioate, morpholino modifications, and inverted 3’ and 5’ bases, as well as combinations of the modifications including alternating 2’-O-methyl and 2’-F in combination with PS and GalNAc (page 125 and Table 8), Bettencourt et al. do not teach the specific modification patterns of SEQ ID NOs:441, 655, 858, or 1020 (instant claims 15 and 31).
Instant SEQ ID NO: 441
ccaagacaau ucaucauuug aut
Me Me Me F Me F Me F Me F Me F Me F Me F Me F Me F Me F
Inverted nucleotide
Instant SEQ ID NO: 655
aucaaaugau gaauugucut t
F F Me F Me F Me F Me F Me F Me F Me F Me F Me dT dT
Instant SEQ ID NO: 858
tttagacaau ucaucauuug au
GalNAc-morpholino
GalNAc-morpholino
GalNAc-morpholino
M M M M F M F F F M M M M M M M M PS M
Instant SEQ ID NO: 1020
aucaaaugau gaauugucua a
M PS F PS M M M F M M M M M M M F M F M M M PS M PS M
Given that Bettencourt et al. teach incorporation of each of the instantly recited types of modifications and teaches combinations of the modifications on both strands with 100% of the positions modified, the instant modification patterns are considered to be a result of routine combinations of known chemical modifications of siRNAs. It is noted that the dsRNAs of the instant claims do not have a length limitation and therefore read upon dsRNAs of varying lengths comprising the instantly recited sequences/patterns rather than a closed static compound that has demonstrated an unexpected property. It is routine in the siRNA art to combine the same types of modifications as instantly claimed in varying positions and quantities. It would have been obvious to try to combine the same types of modifications as instantly claimed in varying positions and quantities with a reasonable expectation of success. It was routine in the art to routinely optimize siRNAs via incorporating the known modifications at various positions and quantities. There are a finite set of options and the modification types were known to be combinable and compatible, as evidenced by Bettencourt et al. Because each modification had a predictable effect, a skilled artisan would reasonably expect that combining them would yield siRNAs with improved overall properties. Adjustment to the number or placement of each modification would involve routine screening and optimization.
Response to Arguments
Applicant argues that the positions of the target sequences of the siRNA sequences of Bettencourt are provided relative to the sequence of NM_014495.2, whereas the nucleotide positions referred to in the present application are based on NM_014495.3 (SEQ ID NO: 1181). Applicant respectfully notes that the target sequences disclosed in Bettencourt are different sequences from nucleotides 143-161 of SEQ ID NO: 1181, as recited in instant claim 1. As such, the siRNAs of Bettencourt referenced by the Office actually target entirely different sequences from those targeted by the presently claimed dsRNA. For example, AD-52656.1 of Bettencourt, which allegedly targets nucleotides 140-162 of NM_014495.2, has a sense strand sequence of CCAGAGCCAAAAUCAAGAUUU. Thus, the sense strand sequence of AD-52656.1 of Bettencourt is not at least 90% identical to the target sequence recited in claim 1, i.e., nucleotides 143-161 of SEQ ID NO: 1181, which has the sequence of AGACAAUUCAUCAUUUGAU.
Contrary to applicant’s arguments, the sequences of Bettencourt et al. meet the instant structural limitations. The antisense sequence of AD-52656.1 (AAAUCUUGAUUUUGGCUCUGGAG) is less than 30 nucleotides in length and comprises an antisense sequence at nucleotides 3-21 that is 100% identical to instant SEQ ID NO: 227, as required in instant claim 4, which necessarily anticipates the base claim. The instant claims are directed to antisense strands comprising antisense sequences. The full antisense strand of Bettencourt et al. can be interpreted as comprising a smaller fragment antisense sequence that is 100% identical to instant SEQ ID NO: 227.
Bettencourt et al. is not required to teach the entire full length sequence as identical to instant SEQ ID NO: 1181, but is rather required to teach a dsRNA that meets the instant structural limitations.
Applicant argues that none of the sense strand sequences of other siRNAs of Bettencourt referenced by the Office, including AD-45909.1, AD-45903.1, and AD- 15838.1, are at least 90% identical to the target sequence recited in instant claim 1. Applicant is arguing limitations that are not claimed because the instant claims do not require for the antisense strand to be 90% identical to nucleotides 143-161 of SEQ ID NO: 1181 over its full length and in fact do not require even the fragment (antisense sequence) to be 90% identical to nucleotides 143-161 of SEQ ID NO: 1181 over its full length.
Applicant argues that results of specific siRNAs that are not claimed. The siRNA of Bettencourt et al. comprises the instant sequence of claim 4 and would be expected to be inhibitory of the target.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636