DETAILED ACTION
This action replaces the action mailed on 3-9-2026. This action is being mailed to correct the length of the shortened statutory period for reply on the PTO-326.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election with traverse of the following Species:
I. ACTA2 expression inhibition;
II. wet AMD;
III. siRNA; and
IV. SEQ ID NO: 3
in the reply filed on 12-26-2025 is acknowledged.
The traversal is on the grounds that the reference of ALARCON-MARTINEZ, L. et al. merely demonstrates that capillary constriction caused by retinal ischemia can be inhibited by suppressing the expression of a-SMA (ACTA2), which applicants argue is clearly distinguishable
from the instant invention, which is: an ACTA2 inhibitor may inhibit the proliferation and distribution of vascular smooth muscle cells, increase the distribution of pericytes, and suppress the dilation and leakage of choroidal vessels, thereby providing therapeutic effects for the retinal or choroidal disease.
This argument is not persuasive because the above cited phenotypes are a consequence of administration of an ACTA2 inhibitor to treat retinal or choroidal disease. As per spec pg. 16. 2nd to the last para, retinal or choroidal disease may be a vascular permeability-related retinal or choroidal disease, but is not limited thereto. Therefore, the reference applied is within the scope of instant invention.
Regarding the specific sequences with SEQ ID Nos., Examiner has extended the search to include all sequences recited.
Applicants also cite MPEP § 803. Respectfully, MPEP § 803 is a consideration for non-PCT applications.
Therefore, the species requirement is considered proper and maintained. As previously conveyed, upon allowability of one species, all other species will be considered for their patentability.
Claims 3, 7, and 9 withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 12/26/2025.
Status of Claims
Claims 1-2, 4-6, 8 and 10-14 are under consideration.
Claim Interpretation
retinal or choroidal disease
The spec on pg. 16. 2nd to the last para defines retinal or choroidal disease as a vascular permeability-related retinal or choroidal disease, but is not limited thereto. Therefore, retinal or choroidal diseases are being interpreted to mean disorder of ocular vascularization that could be retinal or choroidal. See abstract, Campochiaro, Progress in Retinal and Eye Research, Volume 49, November 2015, Pages 67-81.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 13 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 13 depends from claim 12, claim 12 requires a composition that further comprises an anti-VEGF agent, but claim 13 requires the composition to be administered sequentially. Since the composition already comprises at least two agents, it cannot be administered sequentially.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 4, 6, 8 and 10-14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Scope of the Invention
Claim 1 is directed to a method for treating a retinal or choroidal disease with a ACTA2 inhibitor, and dependent claim 2 is directed to an ACTA2 inhibitor, which is either an ACTA2 activity inhibitor or an expression inhibitor.
The broadest reasonable interpretation of the claimed method is a ACTA2 inhibitor to treat a retinal or choroidal disease which is accomplished in one of two ways:
1. by inhibiting ACTA2 expression.
2. by inhibiting the function of ACTA2.
The end-goal is to achieve:
3. treatment of a retinal or choroidal disease in a subject.
Regarding #1: The BRI of an ACTA2 expression inhibitor is: one or more inhibitors selected from the group consisting of an antisense nucleotide, RNAi, siRNA, miRNA, shRNA, and a ribozyme, which complementarily bind to the mRNA of an ACTA2 gene, but is not limited thereto (instant specification pg. 5 lines 16 -19). However, this list is not limiting. Therefore, an expression inhibitor could even be an inhibitor of translation of ACTA2.
Regarding #2: Such a functional definition of a chemical compound covers all compounds possessing the activity or effect specified in the claims. Such compounds could be a compound, a peptide, a peptidomimetic, a substrate analogue, an aptamer and an antibody, which specifically bind to an ACTA2 protein small molecules (instant specification, pg. 5). However, this list is not limiting. Therefore, one of skill in the art could even think of functional inhibitors of ACTA2 as nucleic acid molecules, polypeptides, etc., that bind to any interacting partner of ACTA2.
Regarding #3: Applicants disclose in pg. 27: subject “is not limited to vertebrates, but specifically may be applied to a human, a mouse, a rat, a guinea pig, a rabbit, a monkey, a pig, a horse, a cow, a sheep, an antelope, a dog, a cat, a fish and a reptile”.
Disclosure of a Complete or Partial structure
Table 1 on pg. 30 provides a list of recited ACTA2 siRNA sequences and one commercially available miRNA mimic sequence.
Regarding the end-goal: The specification and Figures disclose results of knocking down ACTA2 with the listed siRNAs or miRNA mimic. Specifically, FIG. 3 illustrates the ACTA2 expression level as a result of treating mouse choroid tissue with ACTA2 siRNA according to an exemplary embodiment of the present invention. FIG. 4 illustrates downstream effects on pericyte and smooth muscle cells as a result of injecting ACTA2 siRNA into the vitreous body of aged mice. FIG. 5 illustrates downstream effects on smooth muscle cells in the retina and choroid as a result of injecting ACTA2 siRNA and miRNA into the vitreous body of aged mice; FIG. 6-7 illustrates drusen-suppressing effects through injection of ACTA2 siRNA and miRNA into the vitreous body of a dry age-related macular degeneration ( dAMD) mouse; FIG. 8-9 illustrates the distributions of choroidal neovascularization, pericytes and smooth muscle cells as a result of injection of ACTA2 siRNA and miRNA into the vitreous body of a wet age-related macular degeneration (wAMD) mouse model and a diabetic mouse model respectively. FIG. 10 - 11 illustrates the effect of suppressing the microaneurysms of the retina and the effect of reducing the dilation and leakage of choroidal vessels, respectively as a result of injecting ACTA2 siRNA and miRNA into the vitreous body of a diabetic mouse model. FIG. 12 illustrates the effect of alleviating choroidal inflammation through confirmation of aggregation of microglia as a result of injecting ACTA2 siRNA and miRNA into the vitreous body of a diabetic mouse model.
Thus, Applicant provides written description for a nucleic acid inhibitor, which is an siRNA that comprises a sequence that is complementary to a mouse ACTA2 nucleotide sequence. Applicant also provides written description for a miRNA mimic, which is a double-stranded RNA which mimics mature endogenous miRNAs after transfection into cells. Applicant also provides written description for treating retinal and choroidal disease in a mouse with the above inhibitors.
Species not Disclosed
On pg. 5 Applicants disclose: various inhibitors (species) that specifically bind to ACTA2.
However, simply listing these species does not provide written support for the types of functional inhibitors as required by #1 or #2 above.
Each of the instantly disclosed genus of inhibitors is targeted to a specific sequence, although the claims are drawn to any inhibitor. Further, the genus of inhibitors as recited, includes substantially different sequences. For e.g., SEQ ID NO: 3 does not overlap with SEQ ID NO: 5. For example, Fig. 3 shows the three siRNAs that showed ACTA2 mRNA reduction in vitro compared to negative control and pooled siRNAs. However, even for the three siRNAs, substantial variation in function is seen within the genus (mRNA knockdown varies from 22% to 53%). Thus efficiency of knock down is unpredictable. Since it is unpredictable in vitro, it would be unpredictable in vivo, which is what is claimed (treating a subject).
Regarding #3 above, although the specification discloses “specific” subjects, the specification does not describe agents directed to any other sequence of possible ACTA2 sequences (e.g., other species). Further, the few species disclosed in the specification cannot represent the substantial structural variations (nucleotide sequences) of the nucleic acid inhibitors against ACTA2, wherein the protein is disclosed as corresponding to SEQ ID NO:1. SEQ ID NO:1 is disclosed as corresponding to NP_001135417.1, which is human ACTA2.
The drawback of not including inhibitors to “other species” could be overcome by disclosing homology between SEQ ID NO: 1 and the other variants or species sequences. However, no homology between SEQ ID NO: 1 and other sequences is disclosed. Further, the specification on pg. 12, lines 19-20, states: a gene encoding the ACTA2 protein may include a base sequence represented by SEQ ID NO: 2 but is not limited thereto. However, the identity of SEQ ID NO: 2 is not disclosed. This is significant because for e.g., one would not know if an siRNA designed to be complementary to any region of SEQ ID NO: 2 would still be complementary to human ACTA2. The skilled artisan would not be able to readily envision which sequences are necessarily included or excluded from being a target sequence.
Given the breadth of inhibitors, and for nucleic acid inhibitors specifically, the breath of sequences embraced in the instantly claimed genus, one could not envision the member agents that target such a broad genus.
Knowledge from the art
SEQ ID NO: 3 – 8 show 100% complementarity with Mus musculus Acta2 mRNA (NM_007392.3) but less than 75% identity with Homo sapiens Acta2 mRNA (NM_001406467.1). An Examiner conducted alignment of Acta2 between human and 2 mouse species using Multiple Comparative Genome Viewer shows considerable divergence between mouse and human acta2 sequences (Retrieved from the United States NCBI webpage on the internet <https://www.ncbi.nlm.nih.gov/mcgv/browse/epo33/NC_000010.11/88921009/89005403/1c_/identity/on> [retrieved on 4 Mar 2026], 1 pg.). In view of the variation, it means that the inhibitor targeting mouse (SEQ ID NO: 3 - 8) may not work for any other species, specifically not for humans.
Structure/Function Correlation
Aptamers, antisense oligonucleotides, siRNA and shRNA have a different structure and/or mechanism of action compared to other types of inhibitors or even other nucleic acid molecules. There is no essential structure of record required for ACTA2 inhibitors to treat retinal or choroidal disease in a subject that would support written description for the genus of inhibitors. The skilled artisan cannot envision small molecules, peptides, CRISPR RNA, aptamers and ribozymes having the desired biological activity (treat retinal or choroidal disease in a subject by reducing ACTA2 expression) based on the nucleic acid inhibitors described in the specification. Other than generically contemplating these molecules, the specification does not provide adequate written description of the small molecules, peptides, CRISPR RNA, aptamer, ribozyme itself. See MPEP 2163, Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017). While it is acknowledged that it is routine and conventional to prepare these molecules, in view of MPEP 2163, adequate written description of ACTA2 inhibitors requires more than just generically contemplating the species of inhibitors. In view of the lack of description for these species, it is evident that Applicant was not in possession of the full breath of the claimed inhibitors for treating a subject.
Method of Treatment
To demonstrate possession of a method of treatment that requires a compound and the compound belongs to a broad genus of compounds, one must provide substantially more than the description of compounds having said activity, in combination with a hypothesis that the administration of any compound having that activity to an individual suffering from a particular disease or disorder might produce a beneficial effect. What is required is an established nexus between the genus of such compounds and a beneficial result consequent thereto.
As stated in MPEP 2163(II)(A)(3), a specification may describe an actual reduction to practice by showing that the inventor constructed an embodiment or performed a process that met all the limitations of the claim and determined that the invention would work for its intended purpose. Cooper v. Goldfarb, 154 F.3d 1321, 1327, 47 USPQ2d 1896, 1901 (Fed. Cir. 1998). See also UMC Elecs. Co. v. United States, 816 F.2d 647, 652, 2 USPQ2d 1465, 1468 (Fed. Cir. 1987) (“[T]here cannot be a reduction to practice of the invention ... without a physical embodiment which includes all limitations of the claim.”); Estee Lauder Inc. v. L’Oreal, S.A., 129 F.3d 588, 593, 44 USPQ2d 1610, 1614 (Fed. Cir. 1997) (“[A] reduction to practice does not occur until the inventor has determined that the invention will work for its intended purpose.”); Mahurkar v. C.R. Bard, Inc., 79 F.3d 1572, 1578, 38 USPQ2d 1288, 1291 (Fed. Cir. 1996) (determining that the invention will work for its intended purpose may require testing depending on the character of the invention and the problem it solves).
The instant specification, however, fails to describe the product adequately. If the product is not described, a method of using that product cannot be adequately described.
In addition, the prior art and the as-filed specification do not provide written description for a compound that targets ACTA2 expression/activity in a cell of one species can be expected to do the same for any other species.
Conclusion of Written Description
The written description requirement for the claimed genus of inhibitors is not satisfied through sufficient description of a representative number of species. A representative number of species are not adequately described to be considered representative of the entire genus. There is substantial variation within the genus of agents that are ACTA2 inhibitors, and the applicant does not describe a sufficient variety of species to reflect the variation within the genus. See Enzo Biochem., 323 F.3d at 966, 63 USPQ2d at 1615; Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004)(“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). See also MPEP §2163.
In view of the foregoing, it is clear that the instant specification fails to convey that the inventors had possession of the genus of ACTA2 inhibitors in claims 1-2 or methods of modulating ACTA2 expression, as of the effective filing date sought in the instant case. Only methods of treating by decreasing expression of ACTA2 comprising siRNA that have substantial complementarity to select target regions within ACTA2 gene known in the prior art in the form of Mus musculus Genbank entry for Acta2, and a miRNA mimic, and not the full breadth of the claims, is supported by Applicant’s disclosure.
Dependent claims 4, 6, 8, and 10-14 are also rejected because they depend on Claim 1 and 2 and do not remedy the issues of lack of written description as discussed above.
Examiner Suggestion: Amend the claims to recite the structure of an inhibitor or recite publicly available or deposited clones expressing the same, and a definite target, a subject, and a precise method such as increasing/decreasing activity or expression for which there is adequate written description support in the disclosure or prior art.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1-2, 4 and 14 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by ALARCON-MARTINEZ (ALARCON-MARTINEZ, L. et al., Acta Neuropathologica Communications (2019) 7:134; cited on IDS).
ALARCON-MARTINEZ teach capillary constriction caused by retinal ischemia can be inhibited by suppressing the expression of a-SMA (ACTA2) (see the abstract; knocking down α-SMA expression with RNA interference also significantly suppressed ischemia-induced capillary constrictions, page 11 last line; and figure 2). ALARCON-MARTINEZ further teach the correlation of diabetic retinopathy, retinal artery occlusion, microvascular pericyte contraction and a-SMA (corresponding to ACTA2) expression inhibition, and indicates that capillary contraction caused by retinal ischemia is inhibited by inhibiting the expression of a-SMA (conclusion para on pg. 18).
Regarding claims 2 and 4, the inhibitor of ACTA2 used in the method of claim 1 is an siRNA (pg. 5, first para titled: Short interfering RNA (siRNA) in vivo knockdown), that is a custom-designed siRNA to ACTA2.
Regarding claim 14, ALARCON-MARTINEZ teaches inhibition of Acta2 has various effects on vascularization. For e.g., SMA inhibition results in inhibition of vascular leakage (because pericyte dysfunction promotes blood-retina barrier leakiness as well as disruption of the blood-brain and cochlear blood-intrastrial fluid barrier, Conclusion para).
Thus, ALARCON-MARTINEZ anticipate instant claims 1-2, 4 and 14.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2, 4, 8 and 10-14 are rejected under 35 U.S.C. 103 as being unpatentable over Chen (Chen et al., PLOS ONE, May 13, 2016) in view of Campochiaro (Progress in Retinal and Eye Research, Volume 49, November 2015, Pages 67-81).
Regarding claims 1-2 and 4, Chen teaches the correlation of structural proteins like smooth muscle-alpha actin (SMA, recited as ACTA2 in instant) in regulating smooth muscle cells (SMC) proliferation and migration by elucidating molecular mechanisms that connect the two (introduction paragraph). Chen utilize an siRNA inhibitor to SMA and provide the sequence (see para titled, “treatment of SMCs with siRNA, pg. 3). The siRNA results in significant knock-down of SMA expression (Fig 5).
Regarding claim 14, Chen teaches SMA regulates arterial contractility and demonstrates other effects on vascularization. Specifically, inhibition of SMA in carotid SMCs results in inhibition of proliferation and migration of SMCs (last line of introduction).
Chen does not teach an active ingredient in the treatment of retinal or choroidal disease is an inhibitor to ACTA2 (claim 1) nor that the disease that can be treated is wet AMD (claim 8) nor the specific sequences of siRNA (claims 5-6) nor any of the limitations of remaining claims (claims 10-13).
However, before the effective filing date of instant invention, Campochiaro had taught abnormalities of ocular vascularization are key features of retinal or choroidal diseases (Fig. 2).
Regarding the treatment of claim 1, Campochiaro teach various therapies are directed to inhibiting vascularization (Neutralization of VEGF is currently the first line therapy …, but new treatments directed at some of the other molecular targets, …, are likely to provide additional benefit for subretinal/choroidal NV (neovascularization) and macular edema, abstract; Endogenous antiangiogenic proteins are appealing candidates for treatment of ocular NV, pg. 76, para 5.7.2).
Therefore, Campochiaro indicate that a method of treating vascular disorders would be a method of treating retinal or choroidal diseases.
Regarding claim 8, Campochiaro teach various abnormalities of Bruch's membrane cause RPE dysfunction; diffuse thickening of Bruch's membrane and focal deposits called drusen occur in patients with age-related macular degeneration (AMD) and large drusen increase risk of both forms of advanced AMD, choroidal neovascularization (CNV) and geographic atrophy (GA) age-related macular degeneration (AMD) (pg. 70, para 4). Therefore, Campochiaro indicate that a method of treating vascular disorders would be a method of treating AMD.
Regarding claims 10 and 11, Campochiaro teach current methods of treating AMD are intravitreal administration (prolonged intravitreous injections in patients with choroidal NV due to AMD, pg. 79, para 9.2).
Regarding claim 12, Campochiaro teach current methods of treating AMD are intravitreal administration of VEGF inhibitors. However, anti-VEGF inhibitors as a single agent is fraught with problems. Therefore, Campochiaro advocate combination therapy. For e.g., Campochiaro teach, selective blockade of PDGF-B causes mild suppression of choroidal NV at Bruch's membrane rupture sites and has an additive suppressive effect when combined with a VEGF antagonist (bridging pgs. 73 and 74). Campochiaro teach that VEGF antagonists alone are unable to eliminate macular edema in some patients and the need for prolonged treatment to control edema is problematic and urge the reader to identify other contributors to macular edema that can be targeted (pg. 79, para 9.2). Therefore, Campochiaro teaches that treatment be carried out with a composition that comprises an anti-VEGF agent and another agent.
Regarding claim 13, it is evident that if two agents are to be delivered, they can be delivered either simultaneously or sequentially, as there are no other ways.
It would have been prima facie obvious to an artisan of ordinary skill in the art before the effective filing date of the claimed invention to have combined the siRNA of inhibiting ACTA2 as taught by Chen into a method of treating ocular vascular disorders such as retinal or choroidal diseases because Campochiaro had indicated that methods of treating ocular vascular disorders work by relieving the pathological effects of abnormal vascularization and Chen demonstrated that vascular abnormalities are caused by aberrant Acta2 expression. One would be motivated to do so for the advantage of obtaining a treatment that Campochiaro indicate is much needed in the field of ocular treatments. All of the claimed elements were disclosed by Chen, specifically that an siRNA to ACTA2 works at inhibiting ACTA2, and one skilled in the art could have incorporated these prior art elements in to a method of treating as taught by Campochiaro. The combination would have worked as predicted with a reasonable expectation of success, because the combined elements would be working with no change in the respective functions exhibited before combination. See MPEP 2143 I.(A) and MPEP 2144.
Thus, Chen in view of Campochiaro make obvious instant claims 1-2, 4, 8, and 10-14.
Claims 5-6 are rejected under 35 U.S.C. 103 as being unpatentable over Chen (Chen et al., PLOS ONE, May 13, 2016) in view of Campochiaro (Progress in Retinal and Eye Research, Volume 49, November 2015, Pages 67-81) as applied to claims 1-2, 4, 8, and 10-14 above and further in view of GenBank (NM_007392.3, Mus musculus actin, alpha 2, smooth muscle, aorta (Acta2), mRNA NCBI Reference Sequence, retrieved from <https://www.ncbi.nlm.nih.gov/nuccore/440309867?sat=48&satkey=124635688>, revision October 10 2020, retrieved Mar 3 2026, 5 pgs.), Fakhr (Fakhr, E., Zare, F. & Teimoori-Toolabi, L. Cancer Gene Ther 23, 73–82 (2016).
The teachings Chen and Campochiaro as applied above for claims 1-2, 4, 8, and 10-14 are incorporated here.
Regarding claims 5 and 6, Chen teaches SMA sense siRNA is: CAGAGACUCUCUUCCAGCCAUCUUU and antisense SMA siRNA is: AAAGAUGGCUGGAAGAGAGUCUCUG (see para titled, “treatment of SMCs with siRNA, pg. 3).
Alignment shows that Chen’s sense sequence is 100% complementary to its target sequence; i.e., Mus musculus Acta2 mRNA. Chen teaches that such a complementary siRNA results in significant knock-down of Acta2 expression (Fig 5). Thus, Chen evidences that gene knockdown via siRNA requires 100% complementary of the oligonucleotide to its target RNA sequence.
The primary references do not teach use of Applicant’s SEQ ID NO: 3-8 within an siRNA composition of claim 1 that targets the Acta2 gene. As seen by alignment, Applicant’s SEQ ID NO: 3-8 target the mouse Acta2 gene. For e.g., SEQ ID NO: 3 aligned with NM_007392. 3 Mus musculus ALPHA2 ACTA2 mRNA is shown below:
RESULT 1
US-18-249-036-3
Query Match 0.7%; Score 19; DB 1; Length 19;
Best Local Similarity 84.2%;
Matches 16; Conservative 3; Mismatches 0; Indels 0; Gaps 0;
Qy 2076 CGTACACAAGACTCTCACA 2094
||:|||||||||:|:||||
Db 1 CGUACACAAGACUCUCACA 19
GenBank teaches the NM_007392. 3 mRNA transcript known in the art.
Fakhr teaches applying known cellular pathways of RNA interference for efficient siRNA design using automated tools, software, and algorithms (abstract and Fig 1). Fakhr teaches -efficiency of siRNA molecule design depends on known factors including target availability, secondary structures of mRNA, position of matching and intrinsic characteristics of siRNA and mRNA (pg. 73 para 4). Fakhr teaches detailed basic criteria for designing efficient siRNA for gene expression inhibition which includes target site factors, length of siRNA, specificity checking, and nucleotide content (pg. 73 para 5 and Table 1). Fakhr teaches efficient siRNA length of 19 as well as longer siRNAs ranging from 21 to 29 nucleotides with very good results (pg. 74 para 1). Fakhr teaches asymmetrical nucleotide content in the duplex for increasing targeting, with more G/C content at the 5′-end of the sense strand and more A/U at the 3′-end (pg. 75 para 4). Fakhr teaches other available known and effective siRNA design programs including AsiDesigner, siDesign and RNAi codex, Oligowalk (Table 2 pg. 77). Fakhr further teaches a scoring system for enhanced siRNA design to optimize gene targeting (pg. 79, Fig 3). Therefore, one of skill in the art would try to design siRNA sequences given the Genbank availability of the Acta2 mRNA sequence.
One of skill in the art knows that trial and error procedure is still required to identify potent siRNA candidates, further establishing the need to “try” the designed sequences to find optimal candidates.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to try an siRNA sufficiently similar to Applicant’s SEQ ID NO: 3-8 using the siRNA design system of Fakhr and 100% complementarity evidenced by Chen along with the GenBank mRNA sequence in order to target ACTA2 because siRNA designing was an art-recognized methodology as evidenced by Chen. Before the effective filing date of Applicant’s invention, Fakhr taught a design need for nucleic acid sequences which can influence target gene expression in multiple species. SiRNA targeting systems rely on a finite number of identified parameters such as target length, limited RNA nucleotides, combinations of nucleotides, and nucleotide length less than 30nt but ideally between 19 and 25nt, with a finite number of identified, predictable sequences. The length of Genbank evidenced ACTA2 mRNA is ~2572 nucleotides long and siRNAs vary between 19-25 nucleotides. Thus, there are ~2553 possible 19-mers that can target siRNA with 100% identity. As such, there are finite number of identified solutions evidenced by the GenBank sequences. The large, but finite number of possible solutions becomes much smaller and their function even more predictable once the skilled artisan makes use of the known screening tools taught in Fakhr. It would have been obvious to try siRNA oligonucleotides from SEQ ID NO: 3-8 to target a ACTA2 because Fakhr demonstrates that given a known target, siRNA sequences can be generated within their design system to influence gene expression with a measured and predictable outcome. Thus, one of ordinary skill in the art would have pursued the finite number of options, thereby arriving at the instantly claimed subject matter of pairs of sense and antisense RNA with a reasonable expectation of success. See MPEP 2144 II and 2143 I (E).
Thus, Chen and Campochiaro in view of Genbank and Fakhr make obvious instant claims 5-6.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Conclusion
No claims are allowed.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SHABANA S MEYERING/Examiner, Art Unit 1635
/SHABANA S MEYERING/Examiner, Art Unit 1636
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637