DETAILED ACTION
Final Rejection
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
2. Applicant’s election without traverse of Group I claims 1-10 in the reply filed on 01/08/2026 is acknowledged, and the election of Group I is made final.
Status of Claims
3. Claims 1-10 as per claim listing filed on 01/08/2026 are pending and under examination in this office action.
4. Applicant cancelled claims 11-12, and 15-16 on 01/08/2026 without prejudice.
Priority
5. Acknowledgment is made of applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified copy has been filed in parent Application No. EP20203373.4, filed on 10/22/2020.
Claim Interpretation
6. The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art.
Claim 1: The instant claim 1 is interpreted to be directed to a baculovirus expression vector capable of recombinantly expressing a Foot and mouth disease virus (FMDV) capsid precursor protein under control of a promoter, the expression vector comprising: (i) a nucleic acid sequence encoding the FMDV capsid precursor protein, (ii) a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence (i) encoding the FMDV capsid precursor protein, and (iii) a translational enhancer P10UTR, located within the 3'UTR of the nucleic acid sequence (i) encoding the FMDV capsid precursor protein. The scope of the claim is interpreted to comprise increased yield production of FMDV empty capsid particles or FMDV VLPs or FMDV chimeric VLPs comprising capsid proteins from different FMDV types using a baculovirus vector comprising a translational enhancer Syn21 and P10UTR.
Claims 2-10: The instant claims 2-10 are interpreted to be directed to construction of a baculovirus expression vector (DNA vector) comprising nucleotide sequences a translational enhancer Syn21 and P10UTR, FMDV capsid precursor protein under the control of a polyhedrin promoter for high yield rescue or high yield production of FMDV type A or type O empty capsid particles or the VLPs. The claims 2-10 may also broadly comprise FMDV chimeric VLPs comprising capsid proteins from different FMDV types using a baculovirus vector comprising a translational enhancer Syn21 and P10UTR.
Withdrawn Objection to Specification
7. The objection to specification is withdrawn as applicant deleted embedded hyperlink
as per amendment filed on 06/23/2026.
Claim Rejections - 35 USC § 103 (Maintained)
8. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
9. Claim 1 is rejected under 35 U.S.C. 103 as being unpatentable over Charleston et al 2012 (US20120258133A1, published 11/10/2012), above, and further in view of Pfeiffer et al 2012 (Proc Natl Acad Sci U S A. 2012 Apr 24;109(17):6626-31) and Liu et al 2015 (Biotechnol Lett. 2015 Sep;37(9):1765-71).
Claim 1: Charleston et al 2012 (US20120258133A1) is in the art and teaches instant claim 1 by disclosing a baculovirus expression vector capable of recombinantly expressing a Foot and mouth disease virus (FMDV) capsid precursor protein under control of a promoter, the expression vector comprising, (i) a nucleic acid sequence encoding the FMDV capsid precursor protein, the nucleic acid sequence (i) encoding the FMDV capsid precursor protein. Charleston et al 2012 teaches the baculovirus transfer vector pOPINE5949 encodes the FMDV capsid precursor protein P1 followed by the FMDV 3C protease connected by a short spacer region (2A-3B3) under control of the strong p10 baculovirus promoter (FIG. 1). Most of the remainder of the FMDV genome is missing. When used to generate a recombinant baculovirus, the theoretical outcome is the expression of a P1-2A-3B3-3C fusion protein which would self-cleave to produce the mature capsid proteins VP1-4 (encoded by P1) and assemble into virus capsids (See, para [0168]-[0169], abstract, para [0001], claim 1, claim 10, para [0016]-[0017], Example 1 para [0168], para [0013]-[0014], para [0041], para [0054], [0106], [0108]-[0109]).
Charleston et al 2012 (US20120258133A1) does not teach claim 1 limitations (ii) a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence, and (iii) a translational enhancer P10UTR, located within the 3'UTR of the nucleic acid sequence.
Pfeiffer et al 2012 is in the baculovirus expression art and teaches expression of green fluorescent protein (GFP) in insect cells using the translational enhancers, Syn21 in the 5′-UTR (See, nucleotide sequence as SEQ ID NO: 1 of the present application, see page 6627 Figure 1 nucleotide sequence syn21 (bold face nucleotide sequence), page 6626 col 2 Results and Discussion para 1) and P10-3'UTR (See, page 6626 col 1 para 3, col 2 para ). Syn21 increased expression of GFP by a factor of 7.4 ± 0.3 (n = 3); the p10 3'-UTR increased expression by a factor of 16.9 ± 0.9 (n = 3); and, in combination, Syn21 and the p10 3'-UTR increased expression by a factor of 22.4 ± 4.3 (n = 3). These results are consistent with those obtained by quantitative microscopy and confirm that the p10 3'-UTR can increase protein expression by more than a factor of 10 on its own and by a factor of 20 when in combination with the 5'-UTR element Syn21. Thus, both elements showed in the assays described above an additive effect when combined in the same baculovirus expression vector in enhancing GFP protein yield in Drosophila. Thus, Pfeiffer et al 2012 demonstrates substantially increased production of GFP using a baculovirus expression vector construct (comprising nucleotide sequences Syn21 and P10UTR) and therefore teaches claim 1 limitations (ii) a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence, and (iii) a translational enhancer P10UTR, located within the 3'UTR of the nucleic acid sequence (See, Pfeiffer et al 2012, page 6626, col 1, para 2).
Liu et al 2015 is in the virology and VLP art and teaches enhanced production of porcine circovirus type 2 (PCV2) virus-like particles using baculovirus expression in Sf9 cells by comprising translational enhancers P10UTR (the 3’-untranslated region from the baculovirus p10 gene), Syn21 (a synthetic AT-rich 21-bp sequence) and P10UTR/Syn21 synergy increased the yield of PCV2 VLPs by 4.1 fold (45 lg/106 cells) compared with standard baculovirus vector (See, page 1765 abstract, Fig. 2-3, entire article).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Charleston et al 2012 (US20120258133A1) to combine with additional teachings of Pfeiffer et al 2012 on a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence, and a translational enhancer P10UTR, located within the 3'UTR of the nucleic acid sequence and the motivational suggestions/teachings by Liu et al 2015 showing synergistically increased yield of the PCV VLP using a baculovirus vector comprising P10UTR/Syn21 to arrive at the invention of claim 1. The motivation would be to develop a baculovirus expression vector that produce substantially increased expression of a heterologous gene (similar to that of increased GFP production taught by Pfeiffer et al 2012, as recited supra) and similar to the PCV VLPs taught by Liu et al 2015 that is reasonably applicable to an increased production of FMDV capsid precursor protein to form empty capsids (virus-like particles, VLPs) in insect cells for commercial success. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claim 1. There would have been a reasonable expectation of success to arrive at the inventions of claim 1 given the applied prior arts. Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), See MPEP § 2143, example of rationales A-G.
10. Claims 2-10 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Charleston et al 2012 (US20120258133A1, published 11/10/2012), Pfeiffer et al 2012 (Proc Natl Acad Sci U S A. 2012 Apr 24;109(17):6626-31), Liu et al 2015 (Biotechnol Lett. 2015 Sep;37(9):1765-71) as applied to claim 1 above, and further in view of Merten et al 2012 (US8993317B2, 03/31/2015 with an earlier priority date of 06/14/2012 to published application US20120149010A1), and Li et al 2016 (published Vet Microbiol. 2016 Feb 1; 183:92-6).
The combined prior art teachings of Charleston et al 2012 (US20120258133A1), Pfeiffer et al 2012 and Liu et al 2015 rendered obvious claim 1 as recited supra and the teachings are incorporated here in its entirety.
Pfeiffer et al 2012 additionally teaches Syn21 sequence as recited below.
Claim 2: Pfeiffer et al 2012 (See, Fig. 1, Syn21 sequence) teaches added limitations of instant claim 2, wherein the translational enhancer Syn21 has a nucleic acid sequence corresponding to the nucleic acid sequence of SEQ ID NO. 1.
SEQ ID NO: 1 1 AACTTAAAAAAAAAAATCAAA 21
|||||||||||||||||||||
Pfeiffer et al 2012 1 AACTTAAAAAAAAAAATCAAA 21
Claim 3. Pfeiffer et al 2012 does not expressly teach added limitation of instant claim 3, wherein the translational enhancer P10UTR has a nucleic acid sequence corresponding to the nucleic acid sequence of SEQ ID NO: 2.
Merten et al 2012 (US8993317B2, 03/31/2015 with an earlier priority date of 06/14/2012 to published application US20120149010A1) is directed to methods for the production of biopharmaceuticals implementing a baculovirus-based system. Recites an exemplary expression control sequences may be chosen among promoters, enhancers and teaches SEQ ID NO: 1 (Db) that has 100% sequence query and sequence identity with SEQ IF NO: 2 (Qy) of instant claim 3.
Query Match 100.0%; Score 666; Length 133894;
Best Local Similarity 100.0%;
Matches 666; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGAATCGTTTTTAAAATAACAAATCAATTGTTTTATAATATTCGTACGATTCTTTGATT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119124 ATGAATCGTTTTTAAAATAACAAATCAATTGTTTTATAATATTCGTACGATTCTTTGATT 119183
Qy 61 ATGTAATAAAATGTGATCATTAGGAAGATTACGAAAAATATAAAAAATATGAGTTCTGTG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119184 ATGTAATAAAATGTGATCATTAGGAAGATTACGAAAAATATAAAAAATATGAGTTCTGTG 119243
Qy 121 TGTATAACAAATGCTGTAAACGCCACAATTGTGTTTGTTGCAAATAAACCCAGTATTATT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119244 TGTATAACAAATGCTGTAAACGCCACAATTGTGTTTGTTGCAAATAAACCCAGTATTATT 119303
Qy 181 TGATTAAAATTGTTGTTTTCTTTGTTCATAGACAATAGTGTGTTTTGCCTAAACGTGTAC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119304 TGATTAAAATTGTTGTTTTCTTTGTTCATAGACAATAGTGTGTTTTGCCTAAACGTGTAC 119363
Qy 241 TGCATAAACTCCATGCGAGTGTATAGCGAGCTAGTGGCTAACGCTTGCCCCACCAAAGTA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119364 TGCATAAACTCCATGCGAGTGTATAGCGAGCTAGTGGCTAACGCTTGCCCCACCAAAGTA 119423
Qy 301 GATTCGTCAAAATCCTCAATTTCATCACCCTCCTCCAAGTTTAACATTTGGCCGTCGGAA 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119424 GATTCGTCAAAATCCTCAATTTCATCACCCTCCTCCAAGTTTAACATTTGGCCGTCGGAA 119483
Qy 361 TTAACTTCTAAAGATGCCACATAATCTAATAAATGAAATAGAGATTCAAACGTGGCGTCA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119484 TTAACTTCTAAAGATGCCACATAATCTAATAAATGAAATAGAGATTCAAACGTGGCGTCA 119543
Qy 421 TCGTCCGTTTCGACCATTTCCGAAAAGAACTCGGGCATAAACTCTATGATTTCTCTGGAC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119544 TCGTCCGTTTCGACCATTTCCGAAAAGAACTCGGGCATAAACTCTATGATTTCTCTGGAC 119603
Qy 481 GTGGTGTTGTCGAAACTCTCAAAGTACGCAGTCAGGAACGTGCGCGACATGTCGTCGGGA 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119604 GTGGTGTTGTCGAAACTCTCAAAGTACGCAGTCAGGAACGTGCGCGACATGTCGTCGGGA 119663
Qy 541 AACTCGCGCGGAAACATGTTGTTGTAACCGAACGGGTCCCATAGCGCCAAAACCAAATCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119664 AACTCGCGCGGAAACATGTTGTTGTAACCGAACGGGTCCCATAGCGCCAAAACCAAATCT 119723
Qy 601 GCCAGCGTCAATAGAATGAGCACGATGCCGACAATGGAGCTGGCTTGGATAGCGATTCGA 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119724 GCCAGCGTCAATAGAATGAGCACGATGCCGACAATGGAGCTGGCTTGGATAGCGATTCGA 119783
Qy 661 GTTAAC 666
||||||
Db 119784 GTTAAC 119789
Claim 4: The baculovirus expression vector according to claim 1, wherein the FMDV is of the A serotype. Pfeiffer et al 2012 teaches many commercially available FMD vaccines are multivalent to provide cover against the different FMD serotypes. The vaccine of the present invention may comprise a plurality of vaccinating entities, each directed at a different serotype and/or different subtypes within a given serotype. Pfeiffer et al 2012 recites FMDV serotype A (See, para [0152], [0005], [0086], [0173], see entire prior art).
Claim 5. Pfeiffer et al 2012 teaches added limitation of claim 5, wherein the FMDV is of the O serotype (See, para [0152], [0004]- [0005]).
Li et al 2016 discloses production of a novel chimeric virus-like particle (VLP) comprising VP1 protein of FMDV type O and segments of viral capsid proteins from serotype Asia 1 using a baculovirus vectors expression. The full-length chimeric P1-2A and 3C cDNA was commercially synthesized based on the VP2, VP3, VP4, and 3C cDNA sequences of the FMDV Asia 1 (Asia1/HNK/CHA/05 strain) and the VP1 cDNA sequence of the FMDV type O (O/CHA/99 strain) under a polyhedrin promoter (See, abstract, page 93, col 1, para 2.2, entire article)
Claim 6. Pfeiffer et al 2012 teaches added limitation of claim 6, wherein the capsid precursor protein comprises the capsid precursor P1 (See, claim 11, para [0013], [0028], [0041], [0085]).
Claims 7-8: Pfeiffer et al 2012 teaches added limitation of claims 7 and 8, wherein the vector further comprises: (iv) a nucleic acid sequence encoding a protease capable of cleaving the capsid precursor protein into one or more capsid proteins (instant claim 7 limitation); wherein the capsid precursor protein comprises the capsid precursor P1 and the 2A peptide and the protease is 3C (instant claim 8 limitation) by disclosing recombinant baculovirus expressing the intact coding regions of P1-2A and 3C (See, para [0013]- [0014], Example 1 para [0168]-[0169]), abstract, claim 1).
Claims 9-10: Pfeiffer et al 2012 teaches added limitation of claims 9-10, a host cell comprising the baculovirus expression vector according to claim 1 (instant claim 9 limitation); which is an insect cell (instant claim 10 limitation), (See, para [0014], [0031], [0108], [0121], claim 18).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Charleston et al 2012 (US20120258133A1), Pfeiffer et al 2012, and Liu et al 2015 as applied to instant claim 1 with additional teachings of Pfeiffer et al 2012, Merten et al 2012, and Li et al 2016, as recited supra to arrive at the invention of claims 2-10. The motivation would be to develop a baculovirus expression vector that produce substantially increased expression of FMDV type A or type O capsid precursor protein to form empty capsids (virus-like particles, VLPs) in insect cells for developing a safe and efficacious VLP vaccine and assays to quantify immune response via anti-FMDV antibodies in animals and for commercial success. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claims 2-10. There would have been a reasonable expectation of success to arrive at the inventions of claims 2-10 given the applied prior arts. Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), See MPEP § 2143, example of rationales A-G.
Response to Arguments
11. Applicant's arguments filed on 06/23/2026 have been fully considered but they are not persuasive.
Applicant’s argument 1:
Rejections under 35 U.S.C. § 103
(1) Claim 1 is rejected under 35 U.S.C. § 103 as allegedly obvious over Charleston et al 2012 (US20120258133A1) and in view of Pfeiffer et al 2012 (Proc Natl Acad Sci U S A. 2012 Apr. 24; 109(17):6626-31) and in view of Liu et al 2015 (Biotechnol Lett. 2015 Sep; 37(9):1765- 71. While the Examiner acknowledges that Charleston fails to teach or suggest the two translational enhancers (i) Syn21 at the 5'UTR and (ii) P10UTR at the 3' UTR, the Examiner relies on Peiffer and Liu allegedly for these teachings, and contends that it would be obvious to one of ordinary skill to modify the teachings of Charleston with the two translational enhancers at their claimed positions from Peiffer and Liu.
Applicant respectfully disagrees and traverses the rejection for the reasons set forth below.
The claims are directed to a unique expression construct to express a unique protein,
namely a FMDV capsid precursor protein, where the combination of expression elements are a specific combination and configuration which is not disclosed nor suggested in the combination of the cited prior art. Specifically, claim 1 requires a specific structural configuration:
- Syn21 located in the 5' UTR of P1OUTR located in the 3' UTR of the same nucleic acid sequence.
A key aspect of the present claims are directed to recombinant expression of an FMDV capsid precursor protein, which requires coordinated translation, protease-mediated cleavage, and assembly into capsid structures. These biological processes differ fundamentally from expression of simple reporter proteins, and are not obvious in view of the cited references as discussed in more below.
I. Charleston is directed to addressing low yield by reducing toxicity by Protease modifications.
Charleston, at most, is directed to constructs for producing FMDV capsids and focuses on regulating protease expression and toxicity to improve FMDV capsid production. Specifically, Charleston identifies low yield issues and attributes these limitations to improper protease expression levels and toxicity, and proposes solutions directed to protease control (e.g., frameshifting elements, protease mutations).
Importantly, Charleston does not disclose or suggest modifying translational efficiency using any 5' UTR and/or 3' UTR enhancer element, nor does it teach or suggest using Syn21 or P1 OUTR translation elements to address the low yield issues. Accordingly, Charleston provides no teaching or motivation to modify its system using translational enhancer engineering. Rather, Charleston directs the skilled artisan to an entirely different mechanistic solution-namely, controlling protease expression thereby teaching away from translational-level optimization.
Therefore, Charleston does not disclose or teach any translational enhancer elements, nor suggest the claimed baculovirus expression vector construct comprising (i) a nucleic acid sequence encoding the FMDV capsid precursor protein, (ii) a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence (i) encoding the FMDV capsid precursor protein, and (iii) a translational enhancer P1 OUTR, located within the 3'UTR of the nucleic acid sequence. Pfeiffer alone, or in combination with Liu does not remedy this deficiency. Rather, Pfeiffer at most, discloses enhancer elements for expression of reporter of the nucleic acid encoding the FMDV capsid precursor; and genes and only in unrelated Drosophila expression systems, and Liu evaluates enhancer combinations empirically and does not generalize their applicability to FMDV systems.
II. Pfeiffer Is Limited to Drosophila Transgene Expression and Does Not Extend to BE VS or Viral Capsid Systems
While Pfeiffer, at most, discloses certain 5' and 3' untranslated region (UTR) elements can increase expression of reporter proteins (e.g., GFP) in Drosophila systems, there is no teaching or suggestion in Pfeiffer that the UTR elements would function in baculovirus expression vector systems (BEVS), nor does it address if they would be effective for expressing a proprotein expression that needed proteolytic processing, such as needed for expression of a capsid proprotein. Thus, as Drosophila expression systems are simple expression systems with fundamentally different biological expression processes, one could not simply inert a 3'UTR and/or 5'UTR region of a Drosophila expression system in a baculovirus expression and expect it to work.
Thus, Pfeiffer provides at most a generalized teaching of translational enhancement, but does not provide any reasonable basis to conclude that such elements would function in, or be applicable to, FMDV capsid production in baculovirus systems.
Thus, even if, assuming arguendo, which applicants do not, one were to use the 5' and 3' UTR regions in Pfeiffer, without the benefit of hindsight of the instant application, there would not be a reasonable expectation of success that they would work in an baculovirus expression vector systems, let alone be able to express effectively a proprotein capsid protein. Thus, while Pfeiffer provides at best, a generalized teaching of using UTRs for translational enhancement, it fails to provide any reasonable basis to conclude that such elements would function in, or be applicable to, FMDV capsid production in baculovirus systems. As such, even if one were to use a UTR elements from Pfeiffer in the system of Charleston, without more, there would not be a reasonable expectation of success that the construct would work to effectively express the FMDV capsid protein. Liu does not remedy this deficiency.
III. Liu Confirms Unpredictability and Requires Empirical Screening
At most, while Liu investigates the effect of translational enhancers in a baculovirus
expression system, it explicitly recognizes that their applicability was uncertain, and states that prior to their study, it was unknown whether translational enhancers such as Syn21 and P10UTR "would function" in the relevant baculovirus system. Moreover, Liu conducts experimental evaluation of multiple constructs comprising different enhancer combinations, thereby demonstrating that successful enhancement was not predictable; and identification of an effective combination required empirical screening rather than routine substitution. Therefore, Liu supports the fact that non-routine experimentation in an unpredictable system is needed, supporting the finding of non-obviousness.
Liu further demonstrates such effects only in the context of PCV2 capsid protein
expression, which is structurally and mechanistically distinct from FMDV precursor protein.
Even if, assuming arguendo, Peiffer and Liu were used to supply the recited translation elements - Syn21 or P1 OUTR, there is (i) no motivation in the cited references to use both these translation elements , and in the specific recited order, and (ii) even if one of ordinary skill were to do so, there would not be a reasonable expectation of success that the claimed construct would work in baculovirus expression vector. To assert otherwise is to apply impermissible hindsight.
IV. No Reasonable Expectation of Success in FMDV Capsid Production
Even if, arguendo, the cited references were combined, a person of ordinary skill in the art would not have a reasonable expectation of success in applying Syn21 and P1 OUTR to FMDV capsid production. This is because FMDV capsid formation involves three specific steps
(i) expression of a polyprotein precursor (P1 or P1-2A); (ii) protease-mediated cleavage of the precursor protein into structural proteins; and (iii) assembly into virus-like particles.
Charleston demonstrates that even modest perturbations of expression conditions,
particularly protease activity, can significantly impair capsid protein production. Given this complexity, increasing translation globally (as contemplated by translational enhancers) would not have been expected to improve outcomes. To the contrary, a skilled artisan could reasonably expect that increased translation may disrupt any of: (i) stoichiometric balance between capsid precursor and protease;(ii) proper cleavage efficiency; or (iii) assembly into capsid structures.
Thus, the art does not provide a reasonable expectation that translational enhancers identified in unrelated systems-would improve FMDV capsid production.
In Response:
In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007).
In this case, Charleston et al teaches instant claim 1 limitations as recited supra in the non-final rejection office action of 02/23/2026 Charleston et al also teaches (see, para [0006]) translation of the single-stranded RNA yields a polyprotein that is subsequently processed by virus-encoded proteases to produce the structural and non-structural proteins required for virus assembly and replication. The Leader (L) protease cleaves itself in cis or in trans at its C terminus from the P1-2A capsid precursor. The 2A protease cleaves itself at its C terminus to release P1-2A from P2. Processing of the P1-2A is effected by the 3C protease to produce the capsid proteins 1AB (also known as VP0), 1C (VP3) and 1D (VP1). In the virion, cleavage of 1AB occurs to produce 1A (VP4) and 1B (VP2).
Charleston et al fails to teach the two translational enhancers (i) Syn21 at the 5'UTR and (ii) P10UTR at the 3' UTR.
However, Peiffer and Liu teach the claimed two translational enhancers (i) Syn21 at the 5'UTR and (ii) P10UTR at the 3' UTR as recited supra in the non-final rejection office action of 02/23/2026.
Charleston et al, Peiffer and Liu are in the protein expression art. Therefore, to enhance protein expression it would be obvious to one of ordinary skill to modify the teachings of Charleston with the two translational enhancers at their claimed positions from Peiffer and Liu.
There would have been a reasonable expectation of success to arrive at the inventions of claim 1 given the applied combined prior art teachings as recited in the office action. Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Examples of rationales that may support a conclusion of obviousness include:
(A) Combining prior art elements according to known methods to yield predictable results: The (i) Syn21 at the 5'UTR and (ii) P10UTR at the 3' UTR successfully increased translation and expression/production of GFP protein (See, Peiffer), and enhanced expression of GFP or PCV Cap protein (See Liu, Fig 1 and Fig 2 with legends, entire prior art).
(B) Simple substitution of one known element for another to obtain predictable results: The findings of Peiffer on GFP expression and or Liu on GFP and PCV Cap protein expression can be applied and substituted with FMDV capsid precursor protein based on primary reference Charleston et al to enhance the translation, expression and yield of the claimed FMDV capsid precursor protein to arrive at the claim 1.
(C) Use of known technique to improve similar devices (methods, or products) in the same way: The prior art references Charleston et al, Peiffer and Liu are in the field of protein expression method. Although the GFP, PCV Cap protein and FMDV capsid precursor protein are not same protein, the enhanced GFP or PCV Cap protein translation/expression method taught by Peiffer and Liu is applicable to Charleston et al and the instant claimed FMDV capsid precursor protein. In addition, Charleston et al teaches FMDV polyprotein processing (see, Charleston et al para [0006]).
(D) Applying a known technique to a known device (method, or product) ready for improvement to yield predictable results: It would be obvious to one of the ordinary skills to apply teachings of Peiffer or Liu to modify the Charleston et al for improvement to yield of instant claim 1 FMDV polyprotein as predictable results.
(E) "Obvious to try" – choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success;
(F) Known work in one field of endeavor may prompt variations of it for use in either the same field or a different one based on design incentives or other market forces if the variations are predictable to one of ordinary skill in the art;
(G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention.
See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), See MPEP § 2143, example of rationales A-G.
In response to applicant's argument that the examiner has combined an excessive number of references, reliance on a large number of references in a rejection does not, without more, weigh against the obviousness of the claimed invention. See In re Gorman, 933 F.2d 982, 18 USPQ2d 1885 (Fed. Cir. 1991).
In response to applicant's argument of nonanalogous art, it has been held that a prior art reference must either be in the field of the inventor’s endeavor or, if not, then be reasonably pertinent to the particular problem with which the inventor was concerned, in order to be relied upon as a basis for rejection of the claimed invention. See In re Oetiker, 977 F.2d 1443, 24 USPQ2d 1443 (Fed. Cir. 1992). In this case, the combined prior art references Charleston et al, Peiffer and Liu are in protein expression. Both Peiffer and or Liu teaches enhanced protein expression by incorporating two translational enhancers (i) Syn21 at the 5'UTR and (ii) P10UTR at the 3' UTR.
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
In response to applicant's argument supra, the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981).
Thus, the applied prior art provides a reasonable expectation that translational enhancers identified in Peiffer and or Liu as recited supra would improve FMDV capsid production as claimed in the instant claim 1 in view of combined prior art teachings of Charleston et al, Peiffer and Liu as recited in the maintained office action supra.
Applicant’s Argument 2:
VII. Unexpected Results Further Support Non-Obviousness
In addition to the absence of any teaching or reasonable expectation of success in the
prior art, the present application provides objective evidence of unexpected results arising from the claimed configuration.
The specification demonstrates that incorporation of the claimed translational enhancer configuration outperforms and leads to improved production of FMDV-related proteins relative to a standard baculovirus expression vector, as evidenced in Examples 1-3, describing comparative Western blot analysis, and "suggests that the Opt] version of the baculovirus vector performs slightly better than the standard one in terms of yield of FMDV-related proteins." (see e.g., [0078], [0083] and [0087] of the published application). This significant increase in protein yield is directly attributable to the claimed structural configuration namely, the Syn21 translational enhancer within the 5' UTR, and the P1 OUTR element within the 3' UTR and the nucleic acid encoding the FMDV capsid precursor, as recited in claim 1. Given this complexity, the observed improvement in yield is not a predictable consequence of general translational enhancement, but instead reflects a system-specific and non-trivial optimization.
Thus, the Examples provide data establishing that the specific combination and positional arrangement of Syn21 and P1 OUTR in an FMDV baculovirus expression construct results in improved production of FMDV-related proteins, which was greater than the well established and commercially available TopBac baculovirus expression system - which was not able to successfully express the FMDV capsid precursor protein to such high levels - this would not have been reasonably expected by a person of ordinary skill in the art.
The unexpected nature of these results is further confirmed when considered relative to the cited art: Charleston attributes low yield in FMDV systems to protease toxicity and processing balance, not translational limitations, and does not suggest translational enhancement strategies. Liu explicitly recognizes that it was previously unknown whether translational enhancers such as Syn21 and P1 OUTR would function in baculovirus expression systems, and relies on empirical screening to identify effective configurations. Pfeiffer demonstrates enhancer activity only in unrelated Drosophila transgene expression systems.
Accordingly, the improved yield demonstrated in the specification constitutes objective evidence of unexpected results with a clear nexus to the claimed invention, and provides further support for the non-obviousness of the claimed subject matter.
Thus, while a skilled person, desiring to increase the yield of the FMDV capsid precursor protein in the baculovirus expression system may have chosen the Syn21 / P1 OUTR translational enhancer, but there is no evidence in Charleston, in view of Pfeiffer and Liu, that there would be a reasonable expectation that it would lead to successful of a precursor protein in baculovirus, or even improved expression. Thus outcome is simply totally unpredictable and as in any biological system, involves a high chance of failure.
In view of the above, Applicants respectfully request the § 103 rejection of claim 1 over Charleston and in view of Pfeiffer and in view of Liu et al 2015 be withdrawn.
In Response: The combined teachings of the applied prior arts by Charleston et al, Peiffer and Liu rendered obvious instant claim 1 that was examined in the non-final action 01/20/2026. Therefore, the results as shown in example(s) in the specification and drawings that the applicant argues as “unexpected” are reasonably expected results consistent with the applied combined prior art teaching as recited in the office action. Because the teachings of Peiffer and or Liu independently teaches effects of translational enhancer (i) Syn21 at the 5'UTR and (ii) P10UTR at the 3' UTR successfully increased translation and expression/production of GFP protein (See, Peiffer), and enhanced expression of GFP or PCV Cap protein (See Liu, Fig 1 and Fig 2 with legends, entire prior art). Modification of Charleston et al reference to incorporate teachings of Peiffer and Liu on translational enhancer (i) Syn21 at the 5'UTR and (ii) P10UTR at the 3' UTR successfully increased translation and expression/production of GFP protein would have been expected to have similar enhanced translational effects to increase the yield of the FMDV capsid precursor protein.
Rebuttal evidence and arguments can be presented in the specification, In re Soni, 54 F.3d 746, 750, 34 USPQ2d 1684, 1687 (Fed. Cir. 1995), by way of an affidavit or declaration under 37 CFR 1.132, e.g., Soni, 54 F.3d at 750, 34 USPQ2d at 1687; In re Piasecki, 745 F.2d 1468, 1474, 223 USPQ 785, 789-90 (Fed. Cir. 1984). However, arguments presented by applicants cannot take the place of factually supported objective evidence. See, e.g., In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965); In re De Blauwe, 736 F.2d 699, 705, 222 USPQ 191, 196 (Fed. Cir. 1984).
A mere attorney argument or statement made by an applicant’s representative cannot take the place of evidence in the record.
Not Evidence: Arguments presented in a response or brief do not count as factual evidence of non-obviousness, unexpected results, or technical features unless they qualify as an admission.
Requirement for Support: When traversing a rejection (such as an obviousness rejection under 35 U.S.C. 103), an attorney's assertions about technical capabilities or "design choice" must be backed by the record, specification evidence, or an affidavit/declaration under 37 CFR 1.132.
See, MPEP 2145.
Thus, the Applicant's arguments regarding unexpected results further support non-obviousness of instant claim 1 (unexpected results secondary considerations) have been fully considered but they are not persuasive. The 35 USC 103 obviousness rejection of claim 1 over Charleston and in view of Pfeiffer and in view of Liu et al 2015 is maintained.
Applicant’s Argument 3:
(2) Claims 2-10 are rejected under 35 U.S.C. § 103 as allegedly obvious over Charleston et al 2012 (US20120258133A1) and in view of Pfeiffer et al 2012 (Proc Natl Acad Sci U S A. 2012 Apr. 24; 109(17):6626-31) and in view of Liu et al 2015 (Biotechnol Lett. 2015 Sep; 37(9):1765-71) as applied to claim 1 above, and further in view of Merten et al 2012 (US8993317 B2) and in view of Li et al 2016 (Vet Microbiol. 2016 Feb. 1; 183:92-6). The Examiner relies on Merten to allegedly teach methods of production of biopharmaceuticals implementing the baculovirus-based expression system, and relies on Li to allegedly teach production of VLPs comprising VP1 of FMDV type O and from subtype Asia 1 using a baculovirus vector expression, and contends that it would be obvious to achieve the claimed expression vector.
Applicants respectfully disagree and traverse this rejection for at least the reasons set forth above with respect to claim 1. Because claims 2-10 depend, directly or indirectly, from claim 1, each of claims 2-10 incorporates the same structural limitations that distinguish the claimed baculovirus expression vector from the cited combination, including the requirement for Syn21 located within the 5' UTR of the nucleic acid sequence encoding the FMDV capsid precursor protein and P1OUTR located within the 3' UTR of that same nucleic acid sequence. The additional reliance on Merten and Li does not remedy the deficiencies of Charleston, Pfeiffer, and Liu.
Merten is relied upon merely for the general proposition that baculovirus-based expression systems may be used for production of biopharmaceuticals. That general teaching does not supply the missing claimed configuration of translational enhancer elements, does not identify Syn21 positioned in the 5' UTR together with P1OUTR positioned in the 3' UTR of an FMDV capsid precursor coding sequence, and does not address the particular challenges associated with expression, protease processing, and assembly of an FMDV capsid precursor protein. Thus, Merten does not provide a teaching, suggestion, or motivation to modify Charleston in the manner required by the claims, nor does it provide a reasonable expectation that such a modification would successfully improve FMDV capsid precursor expression. Li likewise does not cure the deficiencies of the primary combination. Although Li is cited as teaching production of FMDV virus-like particles using a baculovirus expression vector, Li does not disclose or suggest the claimed use of Syn21 in the 5' UTR and P1OUTR in the 3' UTR of the same nucleic acid sequence encoding an FMDV capsid precursor protein. Nor does Li teach that the addition of these particular translational enhancer elements, in the claimed positions, would predictably improve expression of an FMDV capsid precursor or preserve the coordinated protease cleavage and assembly steps required for productive capsid formation.
At most, Merten and Li confirm that baculovirus systems and FMDV VLP production were generally known. But general knowledge of baculovirus expression or FMDV VLP production is not enough to establish obviousness of the specific claimed expression vector. The rejection still lacks an articulated reason why a skilled artisan would have selected the particular Syn21/P10UTR enhancer combination, placed those elements in the claimed 5' and 3' UTR positions relative to the FMDV capsid precursor coding sequence, and reasonably expected that of doing so would improve production of an FMDV capsid precursor protein in view of the unpredictable processing and assembly requirements discussed above.
Accordingly, the additional references cited against dependent claims 2-10 are cumulative with respect to the general use of baculovirus expression systems and FMDV VLP production, but they do not supply the missing claim limitations, do not cure the absence of a motivation to combine the references in the claimed manner, and do not establish a reasonable expectation of success.
For at least these reasons, Applicants respectfully submit that claims 2-10 are patentable over Charleston in view of Pfeiffer and Liu, further in view of Merten and Li, and respectfully request the withdrawal of this § 103.rejection.
In Response:
The Applicant’s arguments regarding rejection of claims 2-10 under 35 U.S.C. § 103 over the combined prior arts as applied to claim 1 rejection (Charleston et al and other prior arts), and further in view of Merten et al and Li et al 2016 have been considered but are not persuasive.
The prior art teachings of Merten et al and Li et al 2016 in combination with prior arts applied to claim 1 render obvious the claims 2-10 as recited in the office action of 02/23/2026. To address the arguments, the relevant prior art teachings and obviousness analysis as applied to render obvious claims 2-10 in the office action of 02/23/2026 are incorporated here.
In response to applicant's argument that the examiner has combined an excessive number of references, reliance on a large number of references in a rejection does not, without more, weigh against the obviousness of the claimed invention. See In re Gorman, 933 F.2d 982, 18 USPQ2d 1885 (Fed. Cir. 1991).
In response to applicant's argument of nonanalogous art, it has been held that a prior art reference must either be in the field of the inventor’s endeavor or, if not, then be reasonably pertinent to the particular problem with which the inventor was concerned, in order to be relied upon as a basis for rejection of the claimed invention. See In re Oetiker, 977 F.2d 1443, 24 USPQ2d 1443 (Fed. Cir. 1992). In this case, the combined prior art references Charleston et al, Peiffer and Liu are in protein expression. Both Peiffer and or Liu teaches enhanced protein expression by incorporating translational enhancers (i) Syn21 at the 5'UTR and (ii) P10UTR at the 3' UTR.
In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007).
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
Therefore, the rejection of claims 2-10 under 35 U.S.C. 103 is maintained.
The Applicant's arguments filed on 06/23/2026 have been fully considered but they are not persuasive and the prior art rejections of claims 1-10 are maintained.
12. Relevant Prior Arts:
Liu et al 2017. Surface displaying of swine IgG1 Fc enhances baculovirus-vectored vaccine efficacy by facilitating viral complement escape and mammalian cell transduction. Vet Res. 2017 May 12;48(1):29.
Li et al 2011. FMD subunit vaccine produced using a silkworm-baculovirus expression system: protective efficacy against two type Asia1 isolates in cattle. Vet Microbiol. 2011 Apr 21;149(1-2):99-103.
Subramanian et al 2012. Development of foot-and-mouth disease virus (FMDV) serotype O virus-like-particles (VLPs) vaccine and evaluation of its potency. Antiviral Res. 2012 Dec;96(3):288-95.
Limphong et al 2019. (US20190002906A1, 01/03/2019). Synthesis and structure of high potency RNA therapeutics.
Alexandrov et al 2012 (US20120084885A1, 04/05/2012). Promoter, promoter control elements, and combinations, and uses thereof.
Conclusion
12. No claim is allowed.
13. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
14. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAMADHAN JAISING JADHAO/Examiner, Art Unit 1672
/BENNETT M CELSA/Primary Examiner, Art Unit 1600
Prosecution Insights