DETAILED ACTION
Non-Final Rejection
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
2. Applicant’s election without traverse of Group I claims 1-10 in the reply filed on 01/08/2026 is acknowledged, and the election of Group I is made final.
Status of Claims
3. Claims 1-10 as per claim listing filed on 01/08/2026 are pending and under examination in this office action.
4. Applicant cancelled claims 11-12, and 15-16 on 01/08/2026without prejudice.
Priority
5. Acknowledgment is made of applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified copy has been filed in parent Application No. EP20203373.4, filed on 10/22/2020.
Claim Interpretation
6. The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art.
Claim 1: The instant claim 1 is interpreted to be directed to a baculovirus expression vector capable of recombinantly expressing a Foot and mouth disease virus (FMDV) capsid precursor protein under control of a promoter, the expression vector comprising: (i) a nucleic acid sequence encoding the FMDV capsid precursor protein, (ii) a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence (i) encoding the FMDV capsid precursor protein, and (iii) a translational enhancer P10UTR, located within the 3'UTR of the nucleic acid sequence (i) encoding the FMDV capsid precursor protein. The scope of the claim is interpreted to comprise increased yield production of FMDV empty capsid particles or FMDV VLPs or FMDV chimeric VLPs comprising capsid proteins from different FMDV types using a baculovirus vector comprising a translational enhancer Syn21 and P10UTR.
Claims 2-10: The instant claims 2-10 are interpreted to be directed to construction of a baculovirus expression vector (DNA vector) comprising nucleotide sequences a translational enhancer Syn21 and P10UTR, FMDV capsid precursor protein under the control of a polyhedrin promoter for high yield rescue or high yield production of FMDV type A or type O empty capsid particles or the VLPs. The claims 2-10 may also broadly comprise FMDV chimeric VLPs comprising capsid proteins from different FMDV types using a baculovirus vector comprising a translational enhancer Syn21 and P10UTR.
Specification
7. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Instant specification page 12 recites: https://wellcomeopenresearch.org/articles/3-88
Claim Rejections - 35 USC § 103
8. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
9. Claim 1 is rejected under 35 U.S.C. 103 as being unpatentable over Charleston et al 2012 (US20120258133A1, published 11/10/2012), above, and further in view of Pfeiffer et al 2012 (Proc Natl Acad Sci U S A. 2012 Apr 24;109(17):6626-31) and Liu et al 2015 (Biotechnol Lett. 2015 Sep;37(9):1765-71).
Claim 1: Charleston et al 2012 (US20120258133A1) is in the art and teaches instant claim 1 by disclosing a baculovirus expression vector capable of recombinantly expressing a Foot and mouth disease virus (FMDV) capsid precursor protein under control of a promoter, the expression vector comprising, (i) a nucleic acid sequence encoding the FMDV capsid precursor protein, the nucleic acid sequence (i) encoding the FMDV capsid precursor protein. Charleston et al 2012 teaches the baculovirus transfer vector pOPINE5949 encodes the FMDV capsid precursor protein P1 followed by the FMDV 3C protease connected by a short spacer region (2A-3B3) under control of the strong p10 baculovirus promoter (FIG. 1). Most of the remainder of the FMDV genome is missing. When used to generate a recombinant baculovirus, the theoretical outcome is the expression of a P1-2A-3B3-3C fusion protein which would self-cleave to produce the mature capsid proteins VP1-4 (encoded by P1) and assemble into virus capsids (See, para [0168]-[0169], abstract, para [0001], claim 1, claim 10, para [0016]-[0017], Example 1 para [0168], para [0013]-[0014], para [0041], para [0054], [0106], [0108]-[0109]).
Charleston et al 2012 (US20120258133A1) does not teach claim 1 limitations (ii) a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence, and (iii) a translational enhancer P10UTR, located within the 3'UTR of the nucleic acid sequence.
Pfeiffer et al 2012 is in the baculovirus expression art and teaches expression of green fluorescent protein (GFP) in insect cells using the translational enhancers, Syn21 in the 5′-UTR (See, nucleotide sequence as SEQ ID NO: 1 of the present application, see page 6627 Figure 1 nucleotide sequence syn21 (bold face nucleotide sequence), page 6626 col 2 Results and Discussion para 1) and P10-3'UTR (See, page 6626 col 1 para 3, col 2 para ). Syn21 increased expression of GFP by a factor of 7.4 ± 0.3 (n = 3); the p10 3'-UTR increased expression by a factor of 16.9 ± 0.9 (n = 3); and, in combination, Syn21 and the p10 3'-UTR increased expression by a factor of 22.4 ± 4.3 (n = 3). These results are consistent with those obtained by quantitative microscopy and confirm that the p10 3'-UTR can increase protein expression by more than a factor of 10 on its own and by a factor of 20 when in combination with the 5'-UTR element Syn21. Thus, both elements showed in the assays described above an additive effect when combined in the same baculovirus expression vector in enhancing GFP protein yield in Drosophila. Thus, Pfeiffer et al 2012 demonstrates substantially increased production of GFP using a baculovirus expression vector construct (comprising nucleotide sequences Syn21 and P10UTR) and therefore teaches claim 1 limitations (ii) a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence, and (iii) a translational enhancer P10UTR, located within the 3'UTR of the nucleic acid sequence (See, Pfeiffer et al 2012, page 6626, col 1, para 2).
Liu et al 2015 is in the virology and VLP art and teaches enhanced production of porcine circovirus type 2 (PCV2) virus-like particles using baculovirus expression in Sf9 cells by comprising translational enhancers P10UTR (the 3’-untranslated region from the baculovirus p10 gene), Syn21 (a synthetic AT-rich 21-bp sequence) and P10UTR/Syn21 synergy increased the yield of PCV2 VLPs by 4.1 fold (45 lg/106 cells) compared with standard baculovirus vector (See, page 1765 abstract, Fig. 2-3, entire article).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Charleston et al 2012 (US20120258133A1) to combine with additional teachings of Pfeiffer et al 2012 on a translational enhancer Syn21 located within the 5' untranslated region (UTR) of the nucleic acid sequence, and a translational enhancer P10UTR, located within the 3'UTR of the nucleic acid sequence and the motivational suggestions/teachings by Liu et al 2015 showing synergistically increased yield of the PCV VLP using a baculovirus vector comprising P10UTR/Syn21 to arrive at the invention of claim 1. The motivation would be to develop a baculovirus expression vector that produce substantially increased expression of a heterologous gene (similar to that of increased GFP production taught by Pfeiffer et al 2012, as recited supra) and similar to the PCV VLPs taught by Liu et al 2015 that is reasonably applicable to an increased production of FMDV capsid precursor protein to form empty capsids (virus-like particles, VLPs) in insect cells for commercial success. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claim 1. There would have been a reasonable expectation of success to arrive at the inventions of claim 1 given the applied prior arts. Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), See MPEP § 2143, example of rationales A-G.
10. Claims 2-10 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Charleston et al 2012 (US20120258133A1, published 11/10/2012), Pfeiffer et al 2012 (Proc Natl Acad Sci U S A. 2012 Apr 24;109(17):6626-31), Liu et al 2015 (Biotechnol Lett. 2015 Sep;37(9):1765-71) as applied to claim 1 above, and further in view of Merten et al 2012 (US8993317B2, 03/31/2015 with an earlier priority date of 06/14/2012 to published application US20120149010A1), and Li et al 2016 (published Vet Microbiol. 2016 Feb 1; 183:92-6).
The combined prior art teachings of Charleston et al 2012 (US20120258133A1), Pfeiffer et al 2012 and Liu et al 2015 rendered obvious claim 1 as recited supra and the teachings are incorporated here in its entirety.
Pfeiffer et al 2012 additionally teaches Syn21 sequence as recited below.
Claim 2: Pfeiffer et al 2012 (See, Fig. 1, Syn21 sequence) teaches added limitations of instant claim 2, wherein the translational enhancer Syn21 has a nucleic acid sequence corresponding to the nucleic acid sequence of SEQ ID NO. 1.
SEQ ID NO: 1 1 AACTTAAAAAAAAAAATCAAA 21
|||||||||||||||||||||
Pfeiffer et al 2012 1 AACTTAAAAAAAAAAATCAAA 21
Claim 3. Pfeiffer et al 2012 does not expressly teach added limitation of instant claim 3, wherein the translational enhancer P10UTR has a nucleic acid sequence corresponding to the nucleic acid sequence of SEQ ID NO: 2.
Merten et al 2012 (US8993317B2, 03/31/2015 with an earlier priority date of 06/14/2012 to published application US20120149010A1) is directed to methods for the production of biopharmaceuticals implementing a baculovirus-based system. Recites an exemplary expression control sequences may be chosen among promoters, enhancers and teaches SEQ ID NO: 1 (Db) that has 100% sequence query and sequence identity with SEQ IF NO: 2 (Qy) of instant claim 3.
Query Match 100.0%; Score 666; Length 133894;
Best Local Similarity 100.0%;
Matches 666; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGAATCGTTTTTAAAATAACAAATCAATTGTTTTATAATATTCGTACGATTCTTTGATT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119124 ATGAATCGTTTTTAAAATAACAAATCAATTGTTTTATAATATTCGTACGATTCTTTGATT 119183
Qy 61 ATGTAATAAAATGTGATCATTAGGAAGATTACGAAAAATATAAAAAATATGAGTTCTGTG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119184 ATGTAATAAAATGTGATCATTAGGAAGATTACGAAAAATATAAAAAATATGAGTTCTGTG 119243
Qy 121 TGTATAACAAATGCTGTAAACGCCACAATTGTGTTTGTTGCAAATAAACCCAGTATTATT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119244 TGTATAACAAATGCTGTAAACGCCACAATTGTGTTTGTTGCAAATAAACCCAGTATTATT 119303
Qy 181 TGATTAAAATTGTTGTTTTCTTTGTTCATAGACAATAGTGTGTTTTGCCTAAACGTGTAC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119304 TGATTAAAATTGTTGTTTTCTTTGTTCATAGACAATAGTGTGTTTTGCCTAAACGTGTAC 119363
Qy 241 TGCATAAACTCCATGCGAGTGTATAGCGAGCTAGTGGCTAACGCTTGCCCCACCAAAGTA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119364 TGCATAAACTCCATGCGAGTGTATAGCGAGCTAGTGGCTAACGCTTGCCCCACCAAAGTA 119423
Qy 301 GATTCGTCAAAATCCTCAATTTCATCACCCTCCTCCAAGTTTAACATTTGGCCGTCGGAA 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119424 GATTCGTCAAAATCCTCAATTTCATCACCCTCCTCCAAGTTTAACATTTGGCCGTCGGAA 119483
Qy 361 TTAACTTCTAAAGATGCCACATAATCTAATAAATGAAATAGAGATTCAAACGTGGCGTCA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119484 TTAACTTCTAAAGATGCCACATAATCTAATAAATGAAATAGAGATTCAAACGTGGCGTCA 119543
Qy 421 TCGTCCGTTTCGACCATTTCCGAAAAGAACTCGGGCATAAACTCTATGATTTCTCTGGAC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119544 TCGTCCGTTTCGACCATTTCCGAAAAGAACTCGGGCATAAACTCTATGATTTCTCTGGAC 119603
Qy 481 GTGGTGTTGTCGAAACTCTCAAAGTACGCAGTCAGGAACGTGCGCGACATGTCGTCGGGA 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119604 GTGGTGTTGTCGAAACTCTCAAAGTACGCAGTCAGGAACGTGCGCGACATGTCGTCGGGA 119663
Qy 541 AACTCGCGCGGAAACATGTTGTTGTAACCGAACGGGTCCCATAGCGCCAAAACCAAATCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119664 AACTCGCGCGGAAACATGTTGTTGTAACCGAACGGGTCCCATAGCGCCAAAACCAAATCT 119723
Qy 601 GCCAGCGTCAATAGAATGAGCACGATGCCGACAATGGAGCTGGCTTGGATAGCGATTCGA 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 119724 GCCAGCGTCAATAGAATGAGCACGATGCCGACAATGGAGCTGGCTTGGATAGCGATTCGA 119783
Qy 661 GTTAAC 666
||||||
Db 119784 GTTAAC 119789
Claim 4: The baculovirus expression vector according to claim 1, wherein the FMDV is of the A serotype. Pfeiffer et al 2012 teaches many commercially available FMD vaccines are multivalent to provide cover against the different FMD serotypes. The vaccine of the present invention may comprise a plurality of vaccinating entities, each directed at a different serotype and/or different subtypes within a given serotype. Pfeiffer et al 2012 recites FMDV serotype A (See, para [0152], [0005], [0086], [0173], see entire prior art).
Claim 5. Pfeiffer et al 2012 teaches added limitation of claim 5, wherein the FMDV is of the O serotype (See, para [0152], [0004]- [0005]).
Li et al 2016 discloses production of a novel chimeric virus-like particle (VLP) comprising VP1 protein of FMDV type O and segments of viral capsid proteins from serotype Asia 1 using a baculovirus vectors expression. The full-length chimeric P1-2A and 3C cDNA was commercially synthesized based on the VP2, VP3, VP4, and 3C cDNA sequences of the FMDV Asia 1 (Asia1/HNK/CHA/05 strain) and the VP1 cDNA sequence of the FMDV type O (O/CHA/99 strain) under a polyhedrin promoter (See, abstract, page 93, col 1, para 2.2, entire article)
Claim 6. Pfeiffer et al 2012 teaches added limitation of claim 6, wherein the capsid precursor protein comprises the capsid precursor P1 (See, claim 11, para [0013], [0028], [0041], [0085]).
Claims 7-8: Pfeiffer et al 2012 teaches added limitation of claims 7 and 8, wherein the vector further comprises: (iv) a nucleic acid sequence encoding a protease capable of cleaving the capsid precursor protein into one or more capsid proteins (instant claim 7 limitation); wherein the capsid precursor protein comprises the capsid precursor P1 and the 2A peptide and the protease is 3C (instant claim 8 limitation) by disclosing recombinant baculovirus expressing the intact coding regions of P1-2A and 3C (See, para [0013]- [0014], Example 1 para [0168]-[0169]), abstract, claim 1).
Claims 9-10: Pfeiffer et al 2012 teaches added limitation of claims 9-10, a host cell comprising the baculovirus expression vector according to claim 1 (instant claim 9 limitation); which is an insect cell (instant claim 10 limitation), (See, para [0014], [0031], [0108], [0121], claim 18).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Charleston et al 2012 (US20120258133A1), Pfeiffer et al 2012, and Liu et al 2015 as applied to instant claim 1 with additional teachings of Pfeiffer et al 2012, Merten et al 2012, and Li et al 2016, as recited supra to arrive at the invention of claims 2-10. The motivation would be to develop a baculovirus expression vector that produce substantially increased expression of FMDV type A or type O capsid precursor protein to form empty capsids (virus-like particles, VLPs) in insect cells for developing a safe and efficacious VLP vaccine and assays to quantify immune response via anti-FMDV antibodies in animals and for commercial success. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claims 2-10. There would have been a reasonable expectation of success to arrive at the inventions of claims 2-10 given the applied prior arts. Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), See MPEP § 2143, example of rationales A-G.
11. Relevant Prior Arts:
Liu et al 2017. Surface displaying of swine IgG1 Fc enhances baculovirus-vectored vaccine efficacy by facilitating viral complement escape and mammalian cell transduction. Vet Res. 2017 May 12;48(1):29.
Li et al 2011. FMD subunit vaccine produced using a silkworm-baculovirus expression system: protective efficacy against two type Asia1 isolates in cattle. Vet Microbiol. 2011 Apr 21;149(1-2):99-103.
Subramanian et al 2012. Development of foot-and-mouth disease virus (FMDV) serotype O virus-like-particles (VLPs) vaccine and evaluation of its potency. Antiviral Res. 2012 Dec;96(3):288-95.
Limphong et al 2019. (US20190002906A1, 01/03/2019). Synthesis and structure of high potency RNA therapeutics.
Alexandrov et al 2012 (US20120084885A1, 04/05/2012). Promoter, promoter control elements, and combinations, and uses thereof.
Conclusion
12. No claim is allowed.
13. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAMADHAN JAISING JADHAO/ Examiner, Art Unit 1672
/BENNETT M CELSA/ Primary Examiner, Art Unit 1600