DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim(s) 1, 4-6, 8-17, 19, and 22-26 are pending.
Preliminary Amendment
Applicant’s preliminary amendment filed on 04/08/2023 is acknowledged. The specification was amended to update priority and governmental support clause information. The claims have been amended to (1) cancel claims 2, 3, 7, 18, 20, and 21, and (2) to amend claims 1, 4-6, 11-13, 19, 22, and 24.
Applicant’s preliminary amendment filed on 03/04/2026 is acknowledged. The claims have been amended to (1) withdraw claims 14, 16-17, 19, and 22-26, and (2) to amend claims 1, 5-6, 8, and 12-13.
Election/Restrictions
Applicant’s election without traverse of Group I in the reply filed on 03/04/2026 is acknowledged.
During a telephone conversation with Gautam Thatte on 03/23/2026 at 12:56PM, a provisional election was made without traverse to consider the species of SEQ ID NO: 5 (reading on claims 9 and 10) and Dexamethasone (reading on claim 15) of the invention of Group I. Affirmation of this election must be made by applicant in replying to this Office action.
Claim(s) 19 and 22-26 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention of Group II, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 03/04/2026.
Claim(s) 14 and 16-17 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to the nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 03/04/2026.
Claim(s) 1, 4-6, 8-13, and 15 are under consideration.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 112(a)
as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Application No. 63/110, 931, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
Accordingly, claim(s) 1, 4-5, 11-13, and 15 are not entitled to the benefit of the prior application because of compliance with 35 U.S.C 112(a) – Written Description, for the genus “variant thereof”. See rejection below for more details.
Claim 15 is not entitled to the benefit of the prior application because each species of anti-inflammatory agent lacks written description, e.g., the list can be found in the associated at paragraph [0013] of the instant specification, however, not in the provisional application anywhere:
“In some embodiments, the therapeutic system further comprises one or more additional therapeutic agents loaded to the nanobowl, wherein the one or more additional therapeutic agents are selected from the group consisting of an antiviral agent, an anti-inflammatory agent, an antimalaria agent, and a biological agent. … In some embodiments, the anti-inflammatory agent is selected from the group consisting of ruxolitinib, baricitinib, dapagliflozin, eicosapentaenoic acid (EPA), tocilizumab, sarilumab, ravulizumab, losmapimod, pacritinib, bucillamine, tradipitant, lenzilumab, acalabrutinib, otilimab, abivertinib maleate, selinexor, brequinar, ibudilast, apilimod dimesylate, gimsilumab, dociparastat sodium, itolizumab, pemziviptadil, prednisolone, dexamethasone, reparixin, brensocatib, emapalumab, and anakinra…”.
Thus, claim(s) 1, 4-5, 11-13, and 15 have the effective filing date of the 371 filed as PCT/US2021/05853 on 11/05/2021.
Claim(s) 6 and 8-10 have the effective filing date of the provisional application filed as 63/110, 931 on 11/06/2020.
Information Disclosure Statement
Receipt of the information disclosure statement(s) on 06/20/2025 is acknowledged. The signed and initialed PTO-1449 form(s) has/have been mailed with this action.
Specification
The disclosure is objected to because of the following informalities:
In paragraph [0048] Applicant is describing the sub panels of Fig 31 however Fig. 31A was used to describe four separate panels. It would be remedial to amend to recite in order (and corresponding to the drawings), Fig. 31A-G. See page 39 and 40 of the drawings for guidance on labeling.
Use of color descriptors for explaining figure panels:
FIG. 3C on page 5, uses “right y-axis, red”;
FIG. 5A on page 6, uses “amine-functionalized nanobowls (red).”;
FIG. 5B on page 6, uses “differential of weight loss (red)”;
FIG. 6A on page 6, uses “…(red circles and block dotted line).”;
FIG. 6B on page 7, uses “… loading efficiency (red)… Red and black traces…”;
FIG. 9F on page 8, uses “HEK cell viability (red)…”;
FIG. 24A on page 12, uses “.. The red spot on the mice represents…”;
FIG. 24C on page 12, uses “… the magnetic vectored MNBs (green)… Actin for red, DNA (dapi) for blue, and FITC marker for green…”;
FIG. 25A on page 12, uses “ shows MNBs (green)… ; nuclei (red)…”;
FIG. 28 on page 13, uses “… and photoacoustic (red) imaging…”;
FIG. 29 on page 13, uses “… asymptotic exponential fit (red)…”;
Page 44, FIG.3C uses color descriptors for explaining a graph, i.e., “red circles” and “red squares”;
Page 46, FIG. 9F uses “red trace”;
Page 48, FIG. 14A uses “red symbols”; and
Page 49-50, FIG. 17B, 17D, and 17E uses “(green trace)” or “(green)” or “(blue trace)” or “(blue)”;
It would be remedial to amend these colors to recite a “shade”, e.g., grey or black, that better describes the discloses black and white figures.
Appropriate correction is required.
The use of the term(s):
Lipofectamine 2000 [0029], [0119], [0148], and [0151];
OneTaq [0114];
Qubit [0014], [0015], and [0120];
Opti-MEM [0117], [0118], [0119], [0120], and [0125];
Vybrant [0118];
Nucleospin [0120];
Formvar [0121];
Excel [0197]; and
Graphpad Prism [0197]
which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim(s) 1, 4-5, 11-13, and 15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, Applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117.
Claim 1 is drawn to a genus of “variant thereof” regarding “one or more nucleic acids targeting SARS-CoV or SARS-CoV2”. The rejected claims thus comprise a genus of “one or more nucleic acids targeting any/all variants of SARS-CoV and/or SARS-CoV-2” and must be capable of targeting SARS-CoV, SARS-CoV-2, or a variant thereof, and that must be capable of being used as a therapeutic.
To satisfy the written description requirement, MPEP §2163 states, in part “… a patent
specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention.” Moreover, the written description requirement for a genus may be satisfied through sufficient description of a representative number of species by “… disclosure of relevant, identifying characteristics, i.e.,
structure or other physical and/or chemical properties, by functional characteristics coupled with
a known or disclosed correlation between functional and structure, or by a combination of such
identifying characteristics, sufficient to show the applicant was in possession of the claimed genus.”
The specification envisions “nucleic acids”:
“In some embodiments, the nanobowl-based therapeutic system of the present technology comprises one or more nucleic acids targeting the genome of a virus, including a coronavirus, such as the SARS-CoV-2 virus or a variant thereof. The one or more nucleic acids may target the same virus or different viruses, respectively. In some embodiments, the nucleic acids may be DNA or RNA molecules. In some embodiments, the nucleic acids may be circular or linear. In some embodiments, the nucleic acids may be short interfering RNAs (siRNAs). SiRNAs, also known as silencing RNAs, are a class of double-stranded RNAs (dsRNAs) typically 19-27 base pairs in length and operating within the RNA interference (RNAi) pathway for gene silencing based on sequence complementarity. In some embodiments, the siRNAs of the present technology can be a dsRNA comprising a hairpin structure, or alternatively, a dsRNA without the hairpin structure. In some embodiments, the siRNAs of the present technology may be 19-27 base pairs in length, for example, 19-20 base pairs in length. “, (see paragraphs [0083] – [0084]).
The specification envisions the “variants thereof”:
“In some embodiments, the virus is a coronavirus. Non-limiting examples of disease-causing coronaviruses include SARS-CoV, MERS-CoV, and SARS-CoV-2, and variants thereof. In some embodiments, the coronavirus is the SARS-CoV-2 coronavirus or its variants, including, for example, the alpha variant (B.1.1.7), and beta variant (B.1.351), the gamma variant (P.1), the delta variant (B.1.617.2), the lambda variant (C.37), the mu variant (B.1.621), the kappa variant (B.1.617.1), the iota variant (B.1.526), the eta variant (B.1.525), the epsilon variant (B.1.427/B.1.429), the zeta variant (P.2), and the theta variant (P.3).”, (see paragraph [0076]).
“In some aspects, the nanobowl-based therapeutic system may be used in the treatment and/or prevention of infections and/or diseases caused by RNA viruses (e.g., coronaviruses) or amelioration of one or more symptoms associated thereof in a subject. Non-limiting examples of infections and/or diseases caused by coronaviruses include SARS (caused by the SARS-CoV virus), MERS (caused by the MERS-CoV virus), and COVID-19 (caused by the SARS-CoV-2 virus and variants thereof). In some embodiments, the infections and/or diseases are caused by the SARS-CoV-2 virus or its variants, including, for example, the alpha variant (B.1.1.7), and beta variant (B.1.351), the gamma variant (P.1), the delta variant (B.1.617.2), the lambda variant (C.37), the mu variant (B.1.621), the kappa variant (B.1.617.1), the iota variant (B.1.526), the eta variant (B.1.525), the epsilon variant (B.1.427/B.1.429), the zeta variant (P.2), and the theta variant (P.3). In some embodiments, the treatment and/or prevention of infections and/or diseases comprise prevention or inhibition of viral replication or multiplication.”, (see paragraph [0095]).
The specification contains siRNA in Table 4, of SEQ ID NOs: 1-7 targeting the plus strand of the coronavirus. In this table, the siRNA targets the Orf1ab (one mutation), S (zero mutations), Orf3a (zero mutations), M (two mutations), and N (zero mutations).
Even if one accepts that the examples described in the specification at paragraphs [0076] and [0095] meet the claim limitations of the rejected claims in regard to structure and function, the examples are only representative of twelve variants. As well as, even if one accepts the structure of the nucleic acids in table 4 as adequately described, these seven sequences are only representative of three variants (i.e., number of mutations), and these results are not necessarily predictive of all “nucleic acids” that must be capable of targeting SARS-CoV, SARS-CoV-2, or a variant thereof, and that must be capable of being used as a therapeutic.
Thus, it is impossible for one to extrapolate from the three examples of nucleic acids described herein that the nucleic acids targeting SARS-CoV and/or SARs-CoV-2 variants thereof would necessarily meet the structural/functional characteristics of the rejected claims.
The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of “one or more nucleic acids” that must be capable of targeting SARS-CoV, SARS-CoV-2, or a variant thereof, and that must be capable of being used as a therapeutic.
Looking to the art for nucleic acid therapeutics for targeting the viral genome, Zhou et al (Potential therapeutic targets and promising drugs for combating SARS-CoV-2, BJP, Volume 177, Issue 14, pages 3147-3161, published June 24th, 2020) disclose:
“With the publication of the RNA genome sequence of SARS-CoV-2 (GenBank: MN908947), one strategy could aim to target the viral RNA genome itself for degradation, in addition to targeting the surface proteins and viral replicases. Therefore, using small interfering RNAs (siRNAs), RNA aptamers or antisense oligonucleotides (ASOs) against the SARS-CoV RNA genome may provide important insights and promising therapeutic targets for SARS-CoV-2 treatment (Ahnet al., 2009; Asha et al., 2018; Qureshi, Tantray, Kirmani, &Ahangar, 2018; Shum & Tanner, 2008).”, (see page 3154, column 1, section Targeting the viral genome and promising drugs).
Regarding dsRNA that target SARS-CoV:
“Recent studies have shown that two double-stranded RNAs (dsRNAs) specifically bind to two separate regions of the mRNA of SARS-CoV protein M, which was described in the patent application CN101173275. siRNA-M1 binds to the 220-241 position in the nucleic acid sequence of protein M mRNA, corresponding to two chemical substance registration numbers (CAS RNs), 1023405-01-7and 1023405-02-8, while siRNA-M2 binds to the 460-480 position, corresponding to 1023405-03-9 and 1023405-04-0.”, (see page 3154, column 1, paragraph 4).
Regarding aptamers targeting SARS-CoV:
“Two patents in Korea present the use of RNA aptamers for inhibiting SARS-CoV. One (KR2009128837) showed that RNA aptamers can combine with the helicase of SARS-CoV to inhibit the unwinding of double-stranded DNA. The other one (KR2012139512) indicated the potential therapeutic value of RNA aptamers with unique affinity for the SARS-CoV nucleocapsid.”, (see page 3154, column 2, paragraph 2).
Regarding hybrid ASOs targeting SARS-CoV:
“Before the occurrence of SARS-CoV-2, a patent application submitted by Ionis Pharmaceuticals (WO2005023083) showed hybrid DNA/RNA ASOs designed for disrupting the pseudoknot in the site of the SARS-CoV RNA frame shift.”, (see page 3154, column 2, paragraph 3).
Lastly, Zhou et al discloses, “In addition, nucleoside analogues (such as EIDD-1931 and EIDD-2801) should be considered as a class of biological agents with potential antiviral effects. Although the viral genome may be a potential target of siRNAs, RNA aptamers, ASOs, and nucleoside analogues for SARS-CoV-2, as was observed for SARS-CoV, this approach present several challenges. One of the most important challenges is the delivery of oligonucleotides into the lungs (Youngren-Ortiz, Gandhi,Espana-Serrano, & Chougule, 2016). In addition, even if siRNAs, RNA aptamers, ASOs, and other biological resources are effective clinically, a further significant problem will be how to scale up the production of these biological agents to treat large numbers of infected patients (Liu & Gou 2020). Therefore, we have a long way to go to reach the goals for the production of these potential biological agents (siRNAs, RNA aptamers, and ASOs).”, (see page 3154, column 2, paragraph 4).
Looking to the art for a time-line of COVID-19 variants, Verywell Heath (COVID-19 Variants: Symptoms, Transmissibility, and more | Verywell health, Fact checked by Nick Blackmer, pages 1-20, updated on October 12, 2025) discloses:
C.37 (Lambda) was identified in December of 2020;
B.1.525 (Eta) was identified in December of 2020;
B.1.621, B.1.621.1 (Mu) were identified in January of 2021;
B.1.526 (Iota) was identified in February of 2021;
P.2 (Zeta) was identified in February of 2021;
B.1.617.2 (Delta) was identified in spring of 2021; and
B.1.1.529 (Omicron) was identified in November of 2021; with more Omicron subvariants identified after November of 2021 and continuing into 2024.
Looking to an article on SARS-CoV or SARs-CoV-2 variants, Velazquez (Coronavirus Mutations and Variants: What does it mean? Spokane Regional Health District; published April 1st, 2021) discloses the number of mutations and variants as of 2021:
“We know the coronavirus currently has 12,700 identified mutations, 12 main types of the virus (identified as 19 A, the original type, through 20 J), five strains and almost 4000 variants. The strains are known as L, the original strain, which mutated into the S strain followed by V and G (further mutating into GR, GH and GV, and several infrequent mutations collectively grouped together as O). The G strains are now the dominant strain around the world. SARS-CoV-2 variants with spike (S)-protein D614G mutations have become the most common variant. It is so named because one amino acid is changed from a D (aspartate) to a G (glycine) at position number 614 of the viral spike proteins. The spike protein mediates the binding to the target receptors and the fusion to the human cell membrane. The S protein extends from the viral membrane giving the virus surface a crown-like appearance, for which the virus is named; corona is crown in Latin. Most of the variants of concern contain mutations in the receptor-binding domain (RBD). It seems these mutations are responsible for increased viral infectivity, virulence, and immune evasion potency. It is known that the RBD is involved in viral recognition and cell receptor binding and interaction, thus any structural changes seem to be directly related to viral transmissibility and virulence. It has also been identified in numerous studies that antibodies developed against the RBD have been found to have maximum potency against the SARS-CoV-2.” (see page 3, paragraph 2).
Summarizing the art: Zhou et al, discloses (a) one siRNA targeting the 220-241 position in the nucleic acid sequence of protein M mRNA; (b) one siRNA targeting the 460-480 position sequence of protein M mRNA; (c) one aptamer in combination with a helicase to inhibit DNA unwinding for SARS-CoV; (d) one aptamer targeting the nucleocapsid of SARs-CoV; and (e) hybrid ASOs targeting the pseudoknot in the SARs-CoV RNA frameshift. Zhou et al suggests given the recent publication of the RNA genome of SARS-CoV-2 (GenBank: MN908947), one could aim to utilize these viral targeting nucleic acids. Verywell Heatlh discloses a timeline of key SARS-CoV-2 variants, where at least second of those variants were identified between November 2020 and before November 2021. Lastly, Velazquez discloses that there are over 4,000 variants and over 12,700 identified mutations.
Thus, the prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of “one or more nucleic acids” that must be capable of targeting SARS-CoV, SARS-CoV-2, or a variant thereof, and that must be capable of being used as a therapeutic. The types of nucleic acid molecules broadly encompassed by the claims and envisioned by the specification does not allow one of ordinary skill in the art to predictably design a therapeutic based on the SARS-CoV and/or SARS-Cov-2 virus or variants thereof. Moreover, the specification of the provisional application filed 11/06/2020 (63/110,931) lacks sufficient detail relating to the genus of one or more nucleic acids that must be capable of targeting SARS-CoV, SARS-CoV-2, or a variant thereof, and that must be capable of being used as a therapeutic. Variants of SARS-CoV-2 continued to be identified between the provisional application’s filing date of 11/06/2020 and the filing of the PCT application (PCT/US2021/058353) 11/05/2021. Thus, without sufficient detail relating to the genus, in the instant specification for nucleic acids and the provisional for nucleic acids and variants thereof, that must be capable of being used as a therapeutic, this description does not allow the skilled artesian to reasonably conclude that the Applicants were in possession of the claimed invention in claim(s) 1, 4-5, 11-13, and 15.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 4, 5, and 15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Madhura Som (Thesis: Development of a versatile gene delivery system using silica nanobowls; 2020, earliest public availability January 2021).
Of note: claim(s) 1, 4-5, 11-13, and 15 have an effective filing date of 11/05/2021.
Madhura Som discloses, “In this chapter, we will develop the NB system to co-deliver Covid19-relevant molecular (Dexamethasone) and nucleic acid-based (siRNA) therapeutics in a stimulus-controlled manner.”, (see page 145, paragraph 2).
Regarding claim(s) 1, 4, and 5, Madhura Som discloses, “Our work here lays the foundation of a magnetically triggered siRNA and drug nano-delivery system relevant in Covid19 or other therapeutics. Although we didn’t demonstrate actual silencing effect of siRNA-NB conjugate, the siRNA chosen in this study was a 22 base pair sequence designed to target the N-region of the SARS-Cov-2 genomic RNA.” More specifically, “Silencing RNA was purchased from Sigma Aldrich with a custom terminal amine functionality, di-sulfide group, and a fluorophore (Atto 590). AmC6 is -NH2 group. ThiC6 is -S-S- group. Sense strand: 5’ [Atto 590] UUGAAUACACCAAAAGAUCACAUU 3’. Anti sense strand: 5’ [AmC6][ThiC6] AAUGUGAUCUUUUGGUGUAUUCAA 3’. Silencing RNA was either physiosorbed or chemisorbed on NBs or magnetic NBs. ... For chemisorption, EDC-NHS conjugation chemistry was used similar to Chapter 5.1.”, (see siRNA loading on NBs on page 146).
Regarding claim 11, Madhura Som discloses, “Figure 6.1 shows the schematic of NB synthesis and subsequent preparation steps to attach superparamagnetic iron oxide particles (SPION) via EDC-NHS conjugation chemistry.”, (see page 149, paragraph 1, sentence 1; also see figure 6.1).
Regarding claim 12, Madhura Som discloses, “Next, we determined the drug loading capacity of the LNB system. For this study we chose a combination of DPPC and DOTAP as this combination is known to have a transition temperature around 40OC that would be applicable for heat triggered release of drugs.”, (see page 153, paragraph 2, sentence 1).
Regarding claim(s) 13 and 15, Madhura Som discloses, “To demonstrate drug loading, we chose a hydrophobic drug Dexamethasone (FITC fluorophore conjugated) which was mixed in with the DPPC/DOTAP mixture prior to lipid bilayer formation and subsequent hydration in buffered media. The liposomes were formed by sonication and subsequently coated onto the NBs.”, (see page 153, paragraph 2, sentence 2). More specifically, “Finally, we performed MTT viability assay in vitro on HEK cell cultures and determined the toxic exposure to cells at 24 and 48 hrs post treatment with Dex and siRNA co-loaded LNBs (Fig. 6.8 A) and magnetic LNBs (Fig. 6.8 B).”, (see page 159, paragraph 1, sentence 1).
Thus, claim(s) 1, 4-5, 11-13, and 15 are anticipated by Madhura Som.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim(s) 1, 4-6, and 8-11 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al (US 2023/0021431 A1; effective filing date of May 28th, 2020) in view of Keasberry et al (Mesoporous Silica Nanoparticles as a Carrier Platform for Intracellular Delivery of Nucleic Acids, Biochemistry (Moscow), Vol 82, Issue 6, pages 655-662, published March 6th, 2017).
Khvorova et al teaches siRNA targeting SARS-CoV-2 sequences.
Regarding claim(s) 1, 5-6, and 8, Khvorova et al teaches siRNAs targeting the genetic sequences of SARS-CoV-2, see Fig. 6A-6I. Fig.6B has siRNA targeting Orf1ab gene region; Fig. 6C has siRNA targeting the S gene region; Fig. 6F has siRNA targeting the M gene region; and Fig. 6I has siRNA targeting the N gene region.
PNG
media_image1.png
202
688
media_image1.png
Greyscale
Regarding claim(s) 9 and 10, Khvorova et al teaches SEQ ID NO: 658 (table 7, page 88), a genetic sequence of SARS-CoV-2, which is a 100% query match to SEQ ID NO: 5.
Lastly, Khvorova et al teaches, “The nucleic acid compositions of the invention can be unconjugated or can be conjugated to another moiety, such as a nanoparticle, to enhance a property of the compositions, e.g., a pharmacokinetic parameter such as absorption, efficacy, bioavailability and/or half-life. The conjugation can be accomplished by methods known in the art, e.g., using the methods of Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describes nucleic acids loaded to poly alkylcy anoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53 (1-3): 137-43 (1998) (describes nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describes nucleic acids linked to intercalating agents, hydrophobic groups, polycations or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describes nucleic acids linked to nanoparticles).”, (see paragraph [0272]).
Khvorova et al does not teach a (a) nanobowl-based therapeutic system, (b) where the nucleic acids are conjugated via disulfide bonds, and (c) further comprising iron oxide nanoparticles.
Keasberry et al teaches, “Silica nanoparticles have high biological stability and low toxicity, and the exposed silanol groups on their surface enable versatile functionalization and modifications [2]. Silica nanoparticles are divided into two major categories, solid and mesoporous silica nanoparticles (MSNs). The different types of silica nanoparticles, for example solid, mesoporous, shaped, etched, and hollow, are synthesized via different methods [3, 4]. MSNs show potential as bio molecule delivery vehicles because of their unique mesoporous structure and physical properties such as high surface area, large pore volume, tunable pore diameter, and narrow size distribution [5]. Importantly, MSNs have low immunogenicity, minimizing unfavorable inflammatory reactions [6].”, (see page 655, paragraph 1).
PNG
media_image2.png
536
596
media_image2.png
Greyscale
Regarding claim 1, Keasberry et al teaches Mesoporous silica nanoparticles (MSN) as a carrier for intracellular delivery of nucleic acids such as siRNA and the combination of siRNA and a drug, see Figure 1 below.
Regarding claim 4 and 5, “siRNAs can selectively knock down target genes by targeting specific mRNAs. Many studies of siRNA delivery with MSNs used cationic polymeric coatings, such as PEI, similar to those used in DNA delivery studies (Table 1).” Moreover, “AC-PEI coating enables controlled release of the siRNA inside cells via a GSH triggered disulfide bond cleavage of the ACPEI once inside the cytoplasm where GSH is present in much higher concentrations than outside the cell. This AC moiety provides a structural response to the intracellular microenvironment. In addition, it is auto fluorescent, enabling MSNs to be tracked intracellularly [47].”, (see page 657, column 2, lines 3-10).
Regarding claim 11, Keasberry et al teaches, “Several studies showed that, by synthesizing magnetic iron oxide cores with a mesoporous silica shell coated with PEI, successful intracellular siRNA delivery and efficient endosomal escape was achieved in HeLa [41], A549 [44], and KHOS [49] cells.”, (see page 659, column 2, paragraph 1).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date to modify the mesoporous silica nanoparticles (MSN) as taught by Keasberry et al with the SARS-CoV-2 siRNA targeting SEQ ID NO: 658 as taught by Khvorova et al, to yield the predictable result of lowering immunogenicity and minimizing unfavorable inflammatory reactions while allowing for controlled release of the siRNA, as taught by Keasberry et al. The combination of the SARS-CoV-2 siRNA and the MSN would have a reasonable expectation of success due to the fact that the exposed silanol groups on the MSN surface enable versatile functionalization and modifications. These exposed silanol groups allow for AC-PEI polymeric coatings which enables controlled release of the siRNA inside cells via a GSH triggered disulfide bond cleavage of the ACPEI once inside the cytoplasm where GSH is present in much higher concentrations than outside the cell.
Moreover, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to take the combined teachings of Khvorova et al and Keasberry et al, and modify the SARS-CoV-2 targeting siRNA-conjugated mesoporous silica nanoparticle (MSN) with iron oxide nanoparticles, as taught by Keasberry et al to yield the predictable results of achieving efficient endosomal escape and intracellular siRNA delivery.
Thus, claim(s) 1, 4-6, and 8-11 are unpatentable over Khvorova et al in view of Keasberry et al.
Claim 12 is rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al (US 2023/0021431 A1; effective filing date of May 28th, 2020) and Keasberry et al (Mesoporous Silica Nanoparticles as a Carrier Platform for Intracellular Delivery of Nucleic Acids, Biochemistry (Moscow), Vol 82, Issue 6, pages 655-662, published March 6th, 2017) as applied to claim 1 above, and further in view of Ashley et al (Delivery of Small Interfering RNA by Peptide-Target Mesoporous Silica Nanoparticle-Supported Lipid Bilayers, ACS Nano, Vol 6, Issue 3, Pages 2174-2188, published February 6th, 2012).
Khvorova et al and Keasberry et al do not teach the addition of a coating over the nanobowl containing siRNA.
Regarding claim 12, Ashley et al teaches, “Here we report that mesoporous silica nanoparticle-supported lipid bilayers (or “protocells”) exhibit multiple properties that overcome many of the limitations of existing delivery platforms. Protocells have a 10- to 100-fold greater capacity for siRNA than corresponding lipid nanoparticles and are markedly more stable when incubated under physiological conditions.”, (see abstract).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date to take the combined teachings of Khvorova et al and Keasberry et al, and modify the SARS-CoV-2 targeting siRNA-conjugated mesoporous silica nanoparticle (MSN) with a lipid coating as taught by Ashley et al, to yield the predictable results of increasing the capacity and the stability of the MSN for siRNA.
Thus, claim 12 is unpatentable over Khvorova et al and Keasberry et al in further view of Ashley et al.
Claim(s) 13 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al (US 2023/0021431 A1; effective filing date of May 28th, 2020) and Keasberry et al (Mesoporous Silica Nanoparticles as a Carrier Platform for Intracellular Delivery of Nucleic Acids, Biochemistry (Moscow), Vol 82, Issue 6, pages 655-662, published March 6th, 2017) as applied to claim 1 above, and further in view of Abrams et al (Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA nanoparticle: Effect of Dexamethasone Co-treatment, Molecular Therapy, Vol 18, Issue 1, pages 171-180, published January 2010).
Despite Keasberry et al teaching the capability of combining siRNA and a drug in a mesoporous silica nanoparticle, Keasberry et al and Khvorova et al do not explicitly teach the combination of siRNA and an anti-inflammatory agent, such as Dexamethasone.
Regarding claim(s) 13 and 15, Abrams et al teaches cotreatment of siRNA and dexamethasone in a lipid nanoparticle. More specifically, “Encapsulation of siRNA into liposomes is a promising option to overcome obstacles such as low stability in serum and inefficient internalization by target cells. However, a major liability of liposomes is the potential to induce an acute inflammatory response, thereby increasing the risk of numerous adverse effects. In this study, we characterized a liposomal siRNA delivery vehicle, LNP201, which is capable of silencing an mRNA target in mouse liver by over 80%. … Furthermore, we demonstrate that the glucocorticoid receptor (GR) agonist dexamethasone (Dex) inhibits LNP201-induced cytokine release, inflammatory gene induction, and mitogen-activated protein kinase (MAPK) phosphorylation in multiple tissues. These data present a possible clinical strategy for increasing the safety profile of siRNA-based drugs while maintaining the potency of gene silencing.”, (see abstract). Moreover, “In summary, this study provides proof-of-concept for the use of a common anti-inflammatory treatment to increase the safety margin of therapeutic siRNAs.”, (see page 178, column 1, paragraph 4).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date to take the combined teachings of Khvorova et al and Keasberry et al, and combine the SARS-CoV-2 targeting siRNA-conjugated mesoporous silica nanoparticle (MSN) with the drug, dexamethasone, as taught by Abrams et al and suggested by Keasberry et al, to yield the predictable results of increasing the safety profile of siRNA-based drugs while maintaining the potency of gene silencing.
Thus, claim(s) 13 and 15 unpatentable over Khvorova et al and Keasberry et al in further view of Abrams et al.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637