Prosecution Insights
Last updated: April 17, 2026
Application No. 18/251,235

SOLUBLE INTERLEUKIN-7 RECEPTOR (SIL7R) MODULATING THERAPY TO TREAT CANCER

Non-Final OA §102§112§DP
Filed
Apr 29, 2023
Examiner
HOLLAND, PAUL J
Art Unit
1656
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
unknown
OA Round
1 (Non-Final)
58%
Grant Probability
Moderate
1-2
OA Rounds
3y 1m
To Grant
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allow Rate
439 granted / 764 resolved
-2.5% vs TC avg
Strong +65% interview lift
Without
With
+65.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 1m
Avg Prosecution
55 currently pending
Career history
819
Total Applications
across all art units

Statute-Specific Performance

§101
8.0%
-32.0% vs TC avg
§103
31.6%
-8.4% vs TC avg
§102
18.6%
-21.4% vs TC avg
§112
29.5%
-10.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 764 resolved cases

Office Action

§102 §112 §DP
DETAILED CORRESPONDENCE Application Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 2. Applicants’ amendment to the claims filed on 01/29/2024 is acknowledged. This listing of claims replaces all prior listings of claims in the application. 3. Claims 12-16, 18-21 and 109-119 are pending. Priority 4. Acknowledgement is made of applicants’ claimed domestic priority to U.S. Provisional Application No. 63/107382, filed on 10/29/2020. Information Disclosure Statement 5. The information disclosure statement filed 04/29/2023 fails to comply with 37 CFR 1.98(a)(2), which requires a legible copy of each cited foreign patent document; each non-patent literature publication or that portion which caused it to be listed; and all other information or that portion which caused it to be listed. It has been placed in the application file, but the information referred to therein has not been considered. Nucleotide and/or Amino Acid Sequence Disclosures Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures 6. 37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted: 1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying: a. the name of the XML file b. the date of creation; and c. the size of the XML file in bytes; or 2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying: a. the name of the XML file; b. the date of creation; and c. the size of the XML file in bytes. SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS: Specific deficiency - Sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.831(c). Sequence identifiers for sequences (i.e., “SEQ ID NO:X” or the like) must appear either in the drawings or in the Brief Description of the Drawings. See Figure 1. Required response – Applicant must provide: Amended drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers (i.e., “SEQ ID NO:X” or the like) into the Brief Description of the Drawings, consisting of: • A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); • A copy of the amended specification without markings (clean version); and • A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 112(b) 8. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 9. Claims 12-16, 18-21 and 109-112 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “increases” in claim 12 is a relative term which renders the claim indefinite. The term “increases” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Further regarding claim 21, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d). 10. Claims 116 and 118-119 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “enhances” in claim 116 and 118-119 is a relative term which renders the claim indefinite. The term “enhances” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Claim Rejections - 35 USC § 102 11. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. 12. Claim(s) 12-16, 18-21 and 109-119 are is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Garcia-Blanco et al. (WO 2019/183570 A1; examiner cited). 13. Claims 12-21 and 109-112 are drawn to a composition comprising an oligonucleotide that binds to a sequence in pre-mRNAs of an interleukin 7 receptor (IL7R) that influences splicing of exon 6, wherein the oligonucleotide increases exclusion of exon 6 in IL7R pre-mRNAs and increases expression of the soluble form of IL7R (sIL7R). Claims 113-117 are drawn to a method of treating cancer, the method comprising administering a therapeutic amount of the composition of claim 12 to a subject. Claims 118-119 are drawn to a method of enhancing a response to a cancer treatment, the method comprising administering a therapeutic amount of the composition of claim 12 to a subject. 14. With respect to claim 12, Garcia-Blanco et al. teach a composition comprising an oligonucleotide that binds to a sequence in pre-mRNAs of an interleukin 7 receptor (IL7R) that influences splicing of exon 6, wherein the oligonucleotide decreases inclusion (interpreted as increases exclusion because decreasing inclusion would ultimately increase exclusion) of exon 6 in IL7R pre-mRNAs and increases expression of the soluble form of IL7R (sIL7R) [see Abstract; paragraph 0012]. With respect to claim 13, Garcia-Blanco et al. teach the composition wherein the oligonucleotide is an antisense oligonucleotide (ASO) or a splice-modulating antisense oligonucleotide (SM-ASO) [see paragraph 0012]. With respect to claim 14, Garcia-Blanco et al. teach wherein the oligonucleotide is selected from SEQ ID NO: 27 (it is known that uracil substitutes for thymine in RNA) or SEQ ID NO: 30 (it is known that uracil substitutes for thymine in RNA) or having at least 100% complementarity to SEQ ID NO: 64 or SEQ ID NO: 67 [see alignments attached as APPENDIX A; paragraph 0037]. With respect to claim 15, Garcia-Blanco et al. teach the composition wherein the composition is adapted for administration to treat a cancer [see Abstract; paragraphs 0012, 0019]. With respect to claim 16, Garcia-Blanco et al. teach the composition wherein the composition further comprises a pharmaceutically acceptable excipient, salts, or carrier [see paragraph 0012]. With respect to claim 18, Garcia-Blanco et al. teach the composition further comprising one or more active agents for the treatment of cancer [see paragraphs 0012, 0019]. With respect to claim 19, Garcia-Blanco et al. teach the composition wherein one or more of the ribose or other sugar units, the bases or the backbone of the oligonucleotide are modified [see paragraph 0019]. With respect to claim 20, Garcia-Blanco et al. teach the composition wherein the modifications comprising one or more phosphorothioate, phosphorodithioate, phosphodiester, methyl phosphonate, phosphoramidate, methyphosphonate, phosphotriester, phosphoroaridate, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, or alkylsilyl substitutions [see paragraph 0019]. With respect to claim 21, Garcia-Blanco et al. teach the composition wherein the sugar modification is 2’-O-methyl (2’-O-methylnucleotides), 2’-O-methyloxyethoxy (2’-O-MOE), a 2’-O-alkyl modified sugar moiety, a bicyclic sugar moiety and nucleotide mimetics [see paragraph 0019]. With respect to claim 109, Garcia-Blanco et al. teach the composition wherein the oligonucleotide is modified by a peptide or small molecule [see paragraphs 0012, 0019]. With respect to claim 110, Garcia-Blanco et al. teach the composition wherein the one or more active agents for treating cancer selected from immune check point inhibitors, therapeutic antibodies, chemotherapy agents, and therapeutic radiation [see paragraph 0019]. With respect to claim 111, Garcia-Blanco et al. teach the composition wherein the oligonucleotide has a sequence that is at least selected from SEQ ID NO: 27 (it is known that uracil substitutes for thymine in RNA) or SEQ ID NO: 30 (it is known that uracil substitutes for thymine in RNA) [see alignments attached as APPENDIX A; paragraph 0037]. With respect to claim 112, Garcia-Blanco et al. teach the composition wherein the oligonucleotide has at least 100% complementarity to SEQ ID NO: 64 or SEQ ID NO: 67 [see alignments attached as APPENDIX A; paragraph 0037]. With respect to claim 113, Garcia-Blanco et al. teach a method of treating cancer, the method comprising administering a therapeutic amount of the composition of claim 12 to a subject [see Abstract; paragraphs 0012 and 0019]. With respect to claim 114, Garcia-Blanco et al. teach the method wherein the cancer is hepatocellular carcinoma [see paragraph 0019]. With respect to claim 115, Garcia-Blanco et al. teach the method wherein the composition is administered with one or more active agents for treating cancer selected from immune check point inhibitors, therapeutic antibodies, chemotherapy agents, and therapeutic radiation [see paragraph 0019]. With respect to claims 116-117, Garcia-Blanco et al. teach the method wherein the composition enhances the activity or response rate of an immunotherapy, wherein the immunotherapy comprises administration of an immune checkpoint-inhibitor [see paragraph 0019]. With respect to claims 118-119, Garcia-Blanco et al. teach a method of treating cancer, the method comprising administering a therapeutic amount of the composition of claim 12 to a subject wherein the composition is administered with one or more active agents for treating cancer selected from immune check point inhibitors, therapeutic antibodies, chemotherapy agents, and therapeutic radiation [see Abstract; paragraphs 0012 and 0019]. Double Patenting 15. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. 16. Claims 12-16, 18-21 and 109-119 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-17 of U.S. Patent No. 11,118,186 in view of Garcia-Blanco et al. (WO 2019/183570 A1; examiner cited). Claims 1-17 of the ‘186 patent recite a composition comprising an oligonucleotide that is a splice-modulating antisense oligonucleotide that specifically binds to a sequence of the IL7R pre-mRNA that influences splicing of exon 6, wherein the SM-ASO increases inclusion of exon 6 in IL7R pre-mRNAs and decreases expression of the soluble isoform of IL7R. The dependent claims further limit to specific active agents and sequences that are identical to the present claims. Although claims 1-17 of the ‘186 do not explicitly recite “wherein the oligonucleotide increases exclusion of exon 6”, this modification would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention in view of Garcia-Blanco (which is the PCT version of the ‘186 patent) who teach a composition comprising an oligonucleotide that binds to a sequence in pre-mRNAs of an interleukin 7 receptor (IL7R) that influences splicing of exon 6, wherein the oligonucleotide decreases inclusion (interpreted as increases exclusion because decreasing inclusion would ultimately increase exclusion) of exon 6 in IL7R pre-mRNAs and increases expression of the soluble form of IL7R (sIL7R) [see Abstract; paragraph 0012]. It would have been obvious for one of ordinary skill in the art to modify the recitations of the ‘186 patent with the teachings of Garcia-Blanco because Garcia-Blanco explicitly teach compositions for both inclusion and exclusion of exon 6 in soluble IL7R mRNAs depending on the treatment method the compositions are utilized for. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. 17. Claims 12-16, 18-21 and 109-119 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-21 of U.S. Patent No. 11,807,853 in view of Garcia-Blanco et al. (WO 2019/183570 A1; examiner cited). Claims 1-21 of the ‘853 patent recite a method of treating a disease or disorder with elevated levels of a soluble isoform of an IL7R in a subject in need thereof, the method comprising: administering an effective amount of a composition comprising an oligonucleotide that is a splice-modulating antisense oligonucleotide that specifically binds to a sequence of the IL7R pre-mRNA that influences splicing of exon 6, wherein the SM-ASO increases inclusion of exon 6 in IL7R pre-mRNAs and decreases expression of the soluble isoform of IL7R. The dependent claims further limit to specific active agents and sequences that are identical to the present claims. Although claims 1-21 of the ‘853 do not explicitly recite “wherein the oligonucleotide increases exclusion of exon 6” and “method of treating cancer”, this modification would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention in view of Garcia-Blanco (which is the PCT version of the ‘853 patent) who teach a composition comprising an oligonucleotide that binds to a sequence in pre-mRNAs of an interleukin 7 receptor (IL7R) that influences splicing of exon 6, wherein the oligonucleotide decreases inclusion (interpreted as increases exclusion because decreasing inclusion would ultimately increase exclusion) of exon 6 in IL7R pre-mRNAs and increases expression of the soluble form of IL7R (sIL7R) [see Abstract; paragraph 0012] for the treatment of cancer [see Abstract; paragraphs 0012 and 0019]. It would have been obvious for one of ordinary skill in the art to modify the recitations of the ‘853 patent with the teachings of Garcia-Blanco because Garcia-Blanco explicitly teach compositions and methods for both inclusion and exclusion of exon 6 in soluble IL7R mRNAs depending on the treatment method the compositions are utilized for. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. 18. Claims 12-16, 18-21 and 109-119 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 and 17-20 of U.S. Patent No. 12,247,206 in view of Garcia-Blanco et al. (WO 2019/183570 A1; examiner cited). Claims 1-14 and 17-20 of the ‘206 patent recite a method of treating a disease or disorder with elevated levels of a soluble isoform of an IL7R in a subject in need thereof, the method comprising: administering an effective amount of a composition comprising an oligonucleotide that is a splice-modulating antisense oligonucleotide that specifically binds to a sequence of the IL7R pre-mRNA that influences splicing of exon 6, wherein the SM-ASO increases inclusion of exon 6 in IL7R pre-mRNAs and decreases expression of the soluble isoform of IL7R. The dependent claims further limit to specific active agents and sequences that are identical to the present claims. Although claims 1-14 and 17-20 of the ‘206 do not explicitly recite “wherein the oligonucleotide increases exclusion of exon 6” and “method of treating cancer”, this modification would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention in view of Garcia-Blanco (which is the PCT version of the ‘206 patent) who teach a composition comprising an oligonucleotide that binds to a sequence in pre-mRNAs of an interleukin 7 receptor (IL7R) that influences splicing of exon 6, wherein the oligonucleotide decreases inclusion (interpreted as increases exclusion because decreasing inclusion would ultimately increase exclusion) of exon 6 in IL7R pre-mRNAs and increases expression of the soluble form of IL7R (sIL7R) [see Abstract; paragraph 0012] for the treatment of cancer [see Abstract; paragraphs 0012 and 0019]. It would have been obvious for one of ordinary skill in the art to modify the recitations of the ‘206 patent with the teachings of Garcia-Blanco because Garcia-Blanco explicitly teach compositions and methods for both inclusion and exclusion of exon 6 in soluble IL7R mRNAs depending on the treatment method the compositions are utilized for. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. 19. Claims 12-16, 18-21 and 109-119 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 12,359,204 in view of Garcia-Blanco et al. (WO 2019/183570 A1; examiner cited). Claims 1-20 of the ‘204 patent recite a method of treating a disease or disorder with elevated levels of a soluble isoform of an IL7R in a subject in need thereof, the method comprising: administering an effective amount of a composition comprising an oligonucleotide that is a splice-modulating antisense oligonucleotide that specifically binds to a sequence of the IL7R pre-mRNA that influences splicing of exon 6, wherein the SM-ASO increases inclusion of exon 6 in IL7R pre-mRNAs and decreases expression of the soluble isoform of IL7R. The dependent claims further limit to specific active agents and sequences that are identical to the present claims. Although claims 1-20 of the ‘204 do not explicitly recite “wherein the oligonucleotide increases exclusion of exon 6” and “method of treating cancer”, this modification would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention in view of Garcia-Blanco (which is the PCT version of the ‘204 patent) who teach a composition comprising an oligonucleotide that binds to a sequence in pre-mRNAs of an interleukin 7 receptor (IL7R) that influences splicing of exon 6, wherein the oligonucleotide decreases inclusion (interpreted as increases exclusion because decreasing inclusion would ultimately increase exclusion) of exon 6 in IL7R pre-mRNAs and increases expression of the soluble form of IL7R (sIL7R) [see Abstract; paragraph 0012] for the treatment of cancer [see Abstract; paragraphs 0012 and 0019]. It would have been obvious for one of ordinary skill in the art to modify the recitations of the ‘204 patent with the teachings of Garcia-Blanco because Garcia-Blanco explicitly teach compositions and methods for both inclusion and exclusion of exon 6 in soluble IL7R mRNAs depending on the treatment method the compositions are utilized for. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Conclusion 20. Status of the claims: Claims 12-16, 18-21 and 109-119 are pending. Claims 12-16, 18-21, and 109-119 are rejected. No claims are in condition for an allowance. Any inquiry concerning this communication or earlier communications from the examiner should be directed to PAUL J HOLLAND whose telephone number is (571)270-3537. The examiner can normally be reached Monday to Friday from 8AM to 5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /PAUL J HOLLAND/Primary Examiner, Art Unit 1656 APPENDIX A Garcia-Blanco et al. with SEQ ID NO: 27 Query Match 100.0%; Score 15; Length 15; Best Local Similarity 66.7%; Matches 10; Conservative 5; Mismatches 0; Indels 0; Gaps 0; Qy 1 UUAGUAAUGUGGGCC 15 ::||:||:|:||||| Db 15 TTAGTAATGTGGGCC 1 Garcia-Blanco et al. with SEQ ID NO: 30 Query Match 100.0%; Score 19; Length 19; Best Local Similarity 57.9%; Matches 11; Conservative 8; Mismatches 0; Indels 0; Gaps 0; Qy 1 UUGCUUUUCAGUUAAGAGA 19 ::||::::|||::|||||| Db 19 TTGCTTTTCAGTTAAGAGA 1 Garcia-Blanco et al. with SEQ ID NO: 64 Query Match 100.0%; Score 25; Length 25; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGGUGACCUUCUUCAACUAAUAAAG 25 ||||||||||||||||||||||||| Db 1 AGGUGACCUUCUUCAACUAAUAAAG 25 Garcia-Blanco et al. with SEQ ID NO: 67 Query Match 100.0%; Score 15; Length 15; Best Local Similarity 100.0%; Matches 15; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 UCUCUGUCGCUCUGU 15 ||||||||||||||| Db 1 UCUCUGUCGCUCUGU 15
Read full office action

Prosecution Timeline

Apr 29, 2023
Application Filed
Jun 03, 2025
Response after Non-Final Action
Nov 14, 2025
Non-Final Rejection — §102, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595501
EXPRESSION OF PRODUCTS FROM NUCLEIC ACID CONCATEMERS
2y 5m to grant Granted Apr 07, 2026
Patent 12595496
Enzymatic Biosynthesis Of Lactones
2y 5m to grant Granted Apr 07, 2026
Patent 12565519
RECOMBINANT STRAINS AND MEDIUM FORMULATION FOR ENHANCING SECRETION TITER USING A TYPE III SECRETION SYSTEM
2y 5m to grant Granted Mar 03, 2026
Patent 12565668
USE OF BIOMAGNETISM FOR BIOGAS PRODUCTION
2y 5m to grant Granted Mar 03, 2026
Patent 12565665
COMPOSITIONS AND METHODS FOR CONTROLLED MRNA TRANSLATION AND STABILITY
2y 5m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+65.3%)
3y 1m
Median Time to Grant
Low
PTA Risk
Based on 764 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month