Prosecution Insights
Last updated: October 02, 2026
Application No. 18/253,652

Methods and Compositions for Generating Dominant Brachytic Alleles Using Genome Editing

Final Rejection §103§112
Filed
May 19, 2023
Priority
Nov 23, 2020 — provisional 63/117,225 +1 more
Examiner
ZHENG, LI
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Monsanto Technology LLC
OA Round
2 (Final)
84%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
96%
With Interview

Examiner Intelligence

Grants 84% — above average
84%
Career Allowance Rate
1069 granted / 1279 resolved
+23.6% vs TC avg
Moderate +13% lift
Without
With
+12.9%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
36 currently pending
Career history
1311
Total Applications
across all art units

Statute-Specific Performance

§101
2.9%
-37.1% vs TC avg
§103
17.2%
-22.8% vs TC avg
§102
20.8%
-19.2% vs TC avg
§112
50.5%
+10.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1279 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION 1. Claims 1-18, 20, 24, 26-29 and 32-44, 46-49, 71-72 and 129-134 are pending. Claims 42-44, 46-49 and 71-72 are withdrawn from consideration. 2. Applicant's amendments to claims 1-3, 13, 28-29, 33-34, 42, 49 and 71-72, and submission of new claims 129-134 in the reply filed on 4/22/2026 are acknowledged. 3. The rejections and objections not recited in this action are withdrawn. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Scope of Enablement 5. Claims 1-18, 20, 24, 26-29 and 32-41 remain and claims 129-134 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for dsRNA produced after gene editing with a first strand that comprises at least 21 contiguous nucleotides of SEQ ID NO: 1/50 and a second strand that is the complementary sequence of the first strand, does not reasonably provide enablement for any dsRNA or antisense RNA with any size. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims. The claimed invention is not supported by an enabling disclosure taking into account the Wands factors. In re Wands, 858/F.2d 731, 8 USPQ2d 1400 (Fed. Cir. 1988). In re Wands lists a number of factors for determining whether or not undue experimentation would be required by one skilled in the art to make and/or use the invention. These factors are: the quantity of experimentation necessary, the amount of direction or guidance presented, the presence or absence of working examples of the invention, the nature of the invention, the state of the prior art, the relative skill of those in the art, the predictability or unpredictability of the art, and the breadth of the claim. The claims are broadly drawn to antisense RNA being at least 85% complementary to at least 20 consecutive nucleotides of SEQ ID NO:1/50 The specification teaches using gene editing approach to insert an antisense sequence of at least 200 bp of SEQ ID NO:1/50 into the br2 locus such that an dsRNA was produced (specification, paragraph [0175]). However, the state of art teaches that the ability of any given gene target to confer toxicity through an RNAi approach cannot be predicted and can only be determined empirically (Narva et al. US Patent Application Publication No. 2015/0322456) (page 75, paragraph [0176]). Further, even if the dsRNA or antisense are intended to silencing the SEQ ID NO: 1, the specification does not enable any gene using fragment thereof of any size. Thomas et al. (2001, The Plant Journal 25(4):417-425) teach that the lower size limit required for targeting reporter transgene mRNA de novo using PTGS was 23 nucleotides of complete identity, a size corresponding to that of small RNAs associated with PTGS in plant and RNAi in animals (abstract). Therefore, all of the DNA segments smaller than 23 nucleotides in instant claims are not enabled for silencing a target gene. Still further, state of art indicates that using antisense RNA alone could produce unpredictable result. Yibrah et al. (1993, Hereditas 118:273-2890) teach that an antisense construct based on the first quarter of the coding sequence from the 5' end , or on the entire coding sequence did not inhibit the synthesis of nopaline whereas effective construct consisted of the 3' terminal sequence from373 to 1565 of the nopaline synthase gene (page 278, last paragraph of the left column). Therefore, given the claim breadth, lack of further guidance and additional working example, unpredictability of the art, undue experimentation would be required for a person skilled in the art to practice the invention. Applicants traverse in the paper filed 4/22/2026. Applicants’ arguments have been fully considered but were not found persuasive. Applicants argue that the teaching of Thomas is outdated and that at the time of filing for instant application, the state of art teaches that at least 20 nucleotides long RNAs were used in planta to effect silencing (response, page 17). The Office contends that the teachings of the references brought up by applicants are related to gene silencing using siRNA which is dsRNA whereas instant claims are drawn to using antisense strand alone for gene silencing. Further, even if only 20 nucleotide is needed, antisense RNA being at least 85% complementary to at least 20 consecutive nucleotides of SEQ ID NO:1/50 still reads on antisense strand with as less as 17 bp complementary to the gene to be silenced. Applicants argue that Yibrah reference is outdated and many references demonstrate that antisense technology works in plant (response, page 19). The Office contends that none of the references brought up by Applicants teaches gene silencing using antisense alone with as short as 20bp. Applicants further argue that even if additional experimentation is need, such experimentation would be routine not undue (response, pages 20-21). The Office contends that given that within the scope of instant claims, there are too many inoperable embodiments specially for the range of nucleotide size less than 23 bp in light the teaching Thomas. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 1-18, 20, 24, 26-29 and 32-41 remain and claims 129-134 are rejected under 35 U.S.C. 103 as being unpatentable over Johal et al (US Patent Application Publication No. 2002/0162142) in view of Barten et al. (published 28 June 2018 WO 2018/119225). Instant claims are drawn to modified corn plant, or plant part thereof, comprising a semi-dominant mutant allele of an endogenous Brachytic2 (br2) locus, wherein the mutant allele comprises a DNA segment inserted into the endogenous br2 locus, wherein the DNA segment encodes an antisense RNA sequence that is at least 85% complementary to at least 20 consecutive nucleotides of SEQ ID NOs: 1/50, and wherein the mutant allele of the endogenous br2 locus produces a RNA transcript comprising the antisense RNA sequence and wherein a wild type allele of br2 locus encodes a protein comprising SEQ ID NO:51 and wherein the modified corn plant exhibits an at least 2.5%/10%/15%/20%/25%/30% reduction in plant height at marutiry; or wherein the mutant allele of the endogenous br2 locus disrupt the function of a wild-type allele product of the endogenous br2 locus; or wherein RNA transcript further comprises one or more elements of 5’UTR or exon or intron or 3’UTR; or wherein the DNA segment corresponds to an inverted genomic fragment of the endogenous br2 locus; or wherein at least a portion of the antisense RNA sequence is at least 90% complementary to a corresponding endogenous sequence of the RNA transcript; or wherein the corresponding endogenous sequence of the RNA transcript is at least 90% identical to at least 20 consecutive nucleotides of SEQ ID NOs: 1/50; or wherein the antisense RNA sequence hybridizes to the corresponding endogenous sequence of the RNA transcript; or wherein the DNA segment is inserted near or adjacent to a corresponding endogenous DNA segment of the endogenous br2 locus; or wherein the antisense RNA sequence encoded by the inserted DNA segment hybridizes to a corresponding endogenous sequence of the RNA transcript encoded by the corresponding endogenous DNA segment; or wherein the antisense RNA sequence forms a stem-loop structure with the corresponding endogenous sequence of the RNA transcript; or wherein the inserted DNA segment and the corresponding endogenous DNA segment of the mutant allele are separated by an intervening DNA sequence; or wherein the intervening DNA sequence has a length of at least 2 consecutive nucleotides; or wherein the intervening DNA sequence has a length of at most 4000 consecutive nucleotides; or wherein the intervening DNA sequence encodes an intervening RNA sequence between the antisense RNA sequence and the corresponding endogenous sequence of the RNA transcript; or wherein the RNA transcript forms a stem-loop structure with the intervening RNA sequence forming the loop portion of the stem-loop structure; or wherein the stem loop secondary structure contains a perfect-complement stem with no mismatch; or wherein the intervening sequence does/does not contain an intron sequence; or wherein the inserted DNA segment is located upstream/downstream of the corresponding endogenous DNA segment; or wherein the DNA segment is inserted within a region selected from the group consisting of 5’ untranslated region (UTR), first exon, first intron, second exon, second intron, third exon, third intron, fourth exon, fourth intron, fifth exon, and 3' UTR of the endogenous br2 locus; or wherein the DNA segment is inserted at a genomic site recognized by a targeted editing technique to create a double-stranded break (DSB);or wherein the mutant allele further comprises a deletion of at least one portion of the endogenous br2 locus; or wherein the DNA segment comprising a sequence at least 80% to exon/UTR/exon-intron within br2 locus; or wherein the DNA segment comprising a sequence at least 80% to SEQ ID NO:1/50; or wherein corn plant is homozygous/heterozygous for the mutant allele at br2 locus; or wherein the DNA segment are 15-1000 nucleotides; or wherein the modified corn plant exhibits shorter plant height or improved lodging resistance to control plant; or wherein the plant height reduction is between 5% and 40%; or wherein the modified plant exhibits at least 2.5% reduction in plant height at maturity; or wherein modified corn plant exhibits essentially no reproductive abnormality; or wherein modified corn plant does not have any significant off-type in at least one female organ. Johal et al. teach a modified corn plant, or plant part thereof, comprising a DNA segment encodes an antisense RNA sequence for the P-glycoprotein genes, particularly the Br2 gene of maize (claim 4), and methods for their use to reduce plant height (claim 18-20). Johal et al. teach expression of at least 150 contiguous nucleotides of SEQ ID NO:1 or sequence at least 70% identical to SEQ ID NO:1 (claim 22). Alignment of SEQ ID NO:1 of Johal et al. and instant SEQ ID NO:1 indicates 97% sequence identity (see alignment below). Johal et al. teach nucleotide construct encompasses hairpins and stem-and -loop structures (paragraph [0067]). Johal et al. teach antisense construction having 85% identity to target sequence with size of at least 50/100/200 nucleotides (paragraph [0081]). Johal et al. does not specifically teach mutant allele of br2 locus wherein the mutant allele comprises a DNA segment inserted into the endogenous br2 locus, wherein the DNA segment encodes an antisense RNA. Barten et al. teach a method to product modified corn plant with reduced height by gene editing using Cas9/gRNA (paragraph [0322]) to introduce single T insert into Exon 5 of BR2 gene of maize(paragraph [0332]). Barten et al. teach wherein the mutant allele further comprises a deletion of at least one portion of the endogenous br2 locus (paragraph [098]). Barten et al. teach that any method known in the art for suppression of a target gene may be used to suppress BR gene(s) according to aspects of the present disclosure including expression of antisense RNAs, double stranded RNAs (dsRNAs) or inverted repeat RNA sequences, or via co- suppression or RNA intereference (RNAi) through expression of small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), trans-acting siRNAs (ta-siR As), or micro RNAs (miRNAs). Furthermore, sense and/or antisense RNA molecules may be used that target the non- coding genomic sequences or regions within or near a gene to cause silencing of the gene (paragraph [150]). Barten et al. teach heterologous corn with br2 mutation (paragraph [0244]). It would have obvious for skill in the art to use modify the teaching of Johal et al. by insert the antisense sequence targeting SEQ ID NO:1 into the Exon 5 of br2 gene resulting in instant invention with reasonable expectation for success. One would have been motivated to do given that both methods can be used to reduce the expression of br2 gene as taught by Barten et al. whereas combining two both gene disruption and gene silencing would ensure the reduction of br2 even in the heterologous maize line. The limitation that DNA segment is inserted at a genomic site recognized by a targeted editing technique to create a double-stranded break (DSB) would obviously was taught given the use of Cas9/gRNA system for gene editing. The teaching of Johl et al. of using sequence at least 70% identical to SEQ ID NO:1 would indicating that mismatches is allowed. Although the combined teachings do not teach br2 locus encodes a protein comprising SEQ ID NO:51, such limitation would have been obviously exhibited by the maize br2 locus of combined teaching. Although the combined teachings do not teach wherein the plant height reduction is between 5% and 40%; or wherein the modified plant exhibits at least 2.5%/10%/15%/20%/25%/30% reduction in plant height at maturity; or wherein modified corn plant exhibits essentially no reproductive abnormality; or wherein modified corn plant does not have any significant off-type in at least one female organ; those features would have been obvious exhibited by the modified corn plant with antisense sequence targeting SEQ ID NO:1 of Johal et al. inserted into the br2 locus according the method of Barten et al. given the teaching of Barten et al. that a single T insert into Exon 5 of BR2 gene of maize caused reduced height in the modified corn plant . Although the combined teachings do not mismatch of stem region and length of the loop, those are merely considered as obvious design choice. Alignment of SEQ ID NO:1 of Johal et al. and instant SEQ ID NO:1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 13549 bits(7337) 0.0 7875/8111(97%) 140/8111(1%) Plus/Plus Query 9 TAAGTTGAGTCGGGGGTAGATTCTCAAGGCTACAT-AAATAGttttttttCTAGAATGGA 67 ||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||| Sbjct 3 TAAGTTGAGTC-GGGGTAGA-TCTCAAGGCTACATAAAATAGTTTTTTTTCTAGAATGGA 60 Query 68 TGCATTTG-TTTAAGAGAAAAATGATGCACTTGG-ATGCATCAAGCAAAGGGATGTAAGA 125 |||||||| ||||||||||||||||||||||||| ||||||||||| |||||||| |||| Sbjct 61 TGCATTTGTTTTAAGAGAAAAATGATGCACTTGGAATGCATCAAGCGAAGGGATGCAAGA 120 Query 126 ATGTTGAAAAAACACATGA-CCCGTATCGGCGAGATGCTTATTTATCCATTCTTT-ATCA 183 |||||| |||||||||||| |||||||| |||||||||||||||| ||||||||| |||| Sbjct 121 ATGTTGGAAAAACACATGAACCCGTATC-GCGAGATGCTTATTTAGCCATTCTTTTATCA 179 Query 184 CAG-GGATGCATATGCAACAAAACCAAAACAGATGGTTAGCGAGTGACAGTATATAGAGA 242 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 180 CAGTGGATGCATATGCAACAAAACCAAAACAGATGGTTAGCGAGTGACAGTATATAGAGA 239 Query 243 TCTAAAGTTGTCCGACACTTCATCGGTaaaaaaaGCAGCA-TAACCGAGTGAATGNAAGA 301 ||||||| | |||||||||||||||||||||||||||||| |||||||||||||| |||| Sbjct 240 TCTAAAGAT-TCCGACACTTCATCGGTAAAAAAAGCAGCATTAACCGAGTGAATGGAAGA 298 Query 302 AAAACGAATTTCTCATA-TACACAGCAGGTTTTCTT-----AAAAAACGTTATATCGGTA 355 ||||||||||||||||| |||||| ||||||||||| ||||||||||| |||||| Sbjct 299 AAAACGAATTTCTCATATTACACAACAGGTTTTCTTAAAAAAAAAAACGTTACCTCGGTA 358 Query 356 -TTATATTAAGAAGAGNCCAAAATATGGTCCTGTCGAGAAAATTTNTAAACATTAGTTCT 414 ||||||||||||||| | |||||||||||| ||||||||||||| |||||| |||| | Sbjct 359 TTTATATTAAGAAGAGACTAAAATATGGTCCCGTCGAGAAAATTTCTAAACACTAGTCTT 418 Query 415 CATCACCAGTGAGCCGTCACCATCTAGTTTGCAACGGTCCAGTTAGAGTGCA-------- 466 |||||| |||||||||||||||||||||||||||||||||||| |||||||| Sbjct 419 CATCACTAGTGAGCCGTCACCATCTAGTTTGCAACGGTCCAGTCAGAGTGCAGGACATAA 478 Query 467 CTCAGGACT------C-G-C--AG--C---GAGAGAA-tttttttAATCAAGCCTAAAAT 510 ||||||||| | | | || | ||||||| |||||||||||||||||||||| Sbjct 479 CTCAGGACTCAAGAGCAGACGGAGCACGGTGAGAGAATTTTTTTTAATCAAGCCTAAAAT 538 Query 511 TCACTTTCGGACAAAT-----C--GAA------CTACTCATAAATATTAACCATGAGACC 557 |||| | ||||||||| | ||| ||||||||||||||||||||||||||| Sbjct 539 TCACCTCCGGACAAATTGAACCTGGAACGGGTGCTACTCATAAATATTAACCATGAGACC 598 Query 558 TTTTCGCCGCAGCAGGTTTTCTATCGGCCGTTAGATTTTAGTGACGATGAAAATGATAGA 617 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct 599 TTTTCGCCGCAGCAGGTTTTCTATCGGCAGTTAGATTTTAGTGACGATGAAAATGATAGA 658 Query 618 ACGCAACGTGCCGCATGCATCCATTCCCATTCGTTTTCCACAGTACATGTAGGAGTACTG 677 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 659 ACGCAACGTGCCGCATGCATCCATTCCCATTCGTTTTCCACAGTACATGTAGGAGTACTG 718 Query 678 TGCAAGTAGGGTCCGTACATTCAGTCTCTCTCACTAGTTGGATTCTTNTAATGCTACAAA 737 |||||||||||||||||||||||||||||||||| ||||||| |||| || ||||||||| Sbjct 719 TGCAAGTAGGGTCCGTACATTCAGTCTCTCTCACCAGTTGGACTCTTCTACTGCTACAAA 778 Query 738 GACATGAGCTGCCGGGAATGGGAACCGGAGGAGCGAGCGAGCCTGGCGGTCT--CACACA 795 ||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||| Sbjct 779 GACATGAGCTGCCTGGAATGGGAACCGGAGGAGCGAGCGAGCCTGACGGTCTCACACACA 838 Query 796 CACAGTCACACTCCCAAGCCAATTATTATAAGAGGGGAGATGAGCAACTCCAGCTCTTAA 855 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 839 CACAGTCACACTCCCAAGCCAATTATTATAAGAGGCGAGATGAGCAACTCCAGCTCTTAA 898 Query 856 NCCAATCCACTCCTCCTCCCTCTCCACCTCATATGCTTTGCTCTGCCACTCTGCTGAGGT 915 ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| Sbjct 899 -CCAATCCACTCCTCCTCCCTCTCCACCTCCTCTGCTTTGCTCTGCCACTCTGCTGAGGT 957 Query 916 GGGGGGCAGAGGAGctccccctccctcctctcccctcctcGCCATGTCTAGCAGCGACCC 975 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 958 GGGGGGCAGAGGAGCTCCCCCTCCCTCCTCTCCCCTCCTCGCCATGTCTAGCAGCGACCC 1017 Query 976 GGAGGAGATCAGGGCGCGCGTCGTCGTTCTCGGTTCGCCCCATGCCGACGGCGGCGACGA 1035 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1018 GGAGGAGATCAGGGCGCGCGTCGTCGTTCTCGGTTCGCCCCATGCCGACGGCGGCGACGA 1077 Query 1036 GTGGGCCCGGCCCGAGCTCGAGGCCTTCCATCTGCCGTCTCCCGCCCACCAGCCTCCTGG 1095 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1078 GTGGGCCCGGCCCGAGCTCGAGGCCTTCCATCTGCCGTCTCCCGCCCACCAGCCTCCTGG 1137 Query 1096 CTTCCTAGCCGGGCAACCGGAAGCAGCAGAGCAACCCACGCTCCCTGCTCCTGCTGGCCg 1155 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1138 CTTCCTAGCCGGGCAACCGGAAGCAGCAGAGCAACCCACGCTCCCTGCTCCTGCTGGCCG 1197 Query 1156 cagcagcagcagcagcaACACGCCTACTACATCTGCCGGTGGCGGCGCTGCTCCTCCTCC 1215 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1198 CAGCAGCAGCAGCAGCAACACGCCTACTACATCTGCCGGTGGCGGCGCTGCTCCTCCTCC 1257 Query 1216 TCCTTCTTCGCCTCCCCCTCCGCCGGCTTCTCTGGAGACCGAGCAGCCGCCCAATGCCAG 1275 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1258 TCCTTCTTCGCCTCCCCCTCCGCCGGCTTCTCTGGAGACCGAGCAGCCGCCCAATGCCAG 1317 Query 1276 GCCAGCCTCCGCCGGCGCCAATGACAGCAAGAAGCCCACCCCGCCCGCCGCCCTGCGCGA 1335 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1318 GCCAGCCTCCGCCGGCGCCAATGACAGCAAGAAGCCCACCCCGCCCGCCGCCCTGCGCGA 1377 Query 1336 CCTCTTCCGCTTCGCCGACGGCCTCGACTGCGCGCTCATGCTCATCGGCACCCTCGGCGC 1395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1378 CCTCTTCCGCTTCGCCGACGGCCTCGACTGCGCGCTCATGCTCATCGGCACCCTCGGCGC 1437 Query 1396 GCTCGTCCACGGGTGCTCGCTCCCCGTCTTCCTCCGCTTCTTCGCCGACCTCGTCGACTC 1455 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1438 GCTCGTCCACGGCTGCTCGCTCCCCGTCTTCCTCCGCTTCTTCGCCGACCTCGTCGACTC 1497 Query 1456 CTTCGGCTCCCACGCCGACGACCCGGACACCATGGTCCGCCTCGTCGTCAAGTACGCCTT 1515 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1498 CTTCGGCTCCCACGCCGACGACCCGGACACCATGGTCCGCCTCGTCGTCAAGTACGCCTT 1557 Query 1516 CTACTTCCTCGTCGTCGGAGCGGCAATCTGGGCATCCTCGTGGGCAGGTACGCTATCCCT 1575 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1558 CTACTTCCTCGTCGTCGGAGCGGCAATCTGGGCATCCTCGTGGGCAGGTACGCTATCCCT 1617 Query 1576 CCTCCTCCTGCCGCCCCAGCTTGTGTGCGTCGCGAATTGGCGGTCAATTTGGATTGGATG 1635 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1618 CCTCCTCCTGCCGCCCCAGCTTGTGTGCGTCGCGAATTGGCGGTCAATTTGGATTGGATG 1677 Query 1636 ACAAATCACGTCGGTCAGCCAATCGCCGTGGCTACAAACGAGATGTTCAAATCGTTCGCC 1695 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1678 ACAAATCACGTCGGTCAGCCAATCGCCGTGGCTACAAACGAGATGTTCAAATCGTTCGCC 1737 Query 1696 CCGCTCGCAAGAGATCTCTTGCTGGATGTGGACCGGCGAGCGGCAGTCGACGCGGATGCG 1755 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1738 CCGCTCGC-AGAGATCTCTTGCTGGATGTGGACCGGCGAGCGGCAGTCGACGCGGATGCG 1796 Query 1756 GATTCGGTACCTGGACGCGGCGCTGCGGCAGGACGTGTCCTTCTTCGACACCGACGTGCG 1815 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1797 GATCCGGTACCTGGACGCGGCGCTGCGGCAGGACGTGTCCTTCTTCGACACCGACGTGCG 1856 Query 1816 GGCCTCGGACGTGATCTACGCCATCAACGCGGACGCCGTGGTGGTGCAAGGACGCCATCA 1875 |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| Sbjct 1857 GGCCTCGGACGTGATCTACGCCATCAACGCGGACGCAGTGGTGGTGC-AGGACGCCATCA 1915 Query 1876 GCCAGAAACTGGGCAACCTCATCCACTACATGGCCACCTTCGTGGCCGGCTTCGTCGTGG 1935 || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1916 GCGAGAAGCTGGGCAACCTCATCCACTACATGGCCACCTTCGTGGCCGGCTTCGTCGTGG 1975 Query 1936 GGTTCACGGCCGCGTGGCAGCTGGCGCTGGTCACGCTGGCCGTGGTGCCGCTCATCGCCG 1995 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1976 GGTTCACGGCCGCGTGGCAGCTGGCGCTGGTCACGCTGGCCGTGGTGCCGCTCATCGCCG 2035 Query 1996 TCATCGGCGGGCTGAGCGCCGCCGCGCTCGCCAAGCTCTCGTCCCGCAGCCAGGACGCGC 2055 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2036 TCATCGGCGGGCTGAGCGCCGCCGCGCTCGCCAAGCTCTCGTCCCGCAGCCAGGACGCGC 2095 Query 2056 TCTCGGGCGCCAGCGGCATCGCGGAGCAGGCGCTCGCGCAGATACGGATCGTGCAGGCGT 2115 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2096 TCTCCGGCGCCAGCGGCATCGCGGAGCAGGCGCTCGCGCAGATACGGATCGTGCAGGCGT 2155 Query 2116 TCGTTGGCGAGGAGCGCGAGATGCGGGCCTACTCGGCGGCGCTGGCCGTGGCGCAGAGGA 2175 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2156 TCGTCGGCGAGGAGCGCGAGATGCGGGCCTACTCGGCGGCGCTGGCCGTGGCGCAGAGGA 2215 Query 2176 TCGGCTACCGCAGCGGCTTCGCCAAGGGGCTCGGCCTCGGCGGCACCTACTTCACCGTCT 2235 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct 2216 TCGGCTACCGCAGCGGCTTCGCCAAGGGTCTCGGCCTCGGCGGCACCTACTTCACCGTCT 2275 Query 2236 TCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCA 2295 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2276 TCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCA 2335 Query 2296 ACGGCGGGCTCGCCATCG-CACCATGTTCTCCGTCATGATCGGCGGACTGTAAGGCCCAC 2354 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 2336 ACGGCGGGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGGCGGACTGTAAGGCCCAC 2395 Query 2355 CACACCACGCACTCTCTCCTTCTGCTG-TCCTCGGCCGCCCCCGTCGTCATTGCTGCTGA 2413 ||||| |||||||||||||| ||| ||||||||| | |||||||||||||||||||| Sbjct 2396 CACAC----CACTCTCTCCTTCTCCTGCTCCTCGGCC-CGCCCGTCGTCATTGCTGCTGA 2450 Query 2414 CGGTATCTGTGGATCGCGTGCAGGGCCCTC-GGCAGTCGGCGCCGAGCATGGCCGCGTTC 2472 |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 2451 CGGTGTCTGTGGATCGCGTGCAGGGCCCTCGGGCAGTCGGCGCCGAGCATGGCCGCGTTC 2510 Query 2473 GCCAAGGCGCGTGTGGCGGCTGCCAAGATCTTCCGCATCATCGACCACAGGCCGGGCATC 2532 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2511 GCCAAGGCGCGTGTGGCGGCTGCCAAGATCTTCCGCATCATCGACCACAGGCCGGGCATC 2570 Query 2533 TCCTCGCGCGACGGCGCGGAGCCAGAGTCGGTGACGGGGCGGGTGGAGATGCGGGGCGTG 2592 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2571 TCCTCGCGCGACGGCGCGGAGCCAGAGTCGGTGACGGGGCGGGTGGAGATGCGGGGCGTG 2630 Query 2593 GACTTCGCGTACCCGTCGCGGCCGGACGTCCCCATCCTGCGCGGCTTCTCGCTGAGCGTG 2652 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2631 GACTTCGCGTACCCGTCGCGGCCGGACGTCCCCATCCTGCGCGGCTTCTCGCTGAGCGTG 2690 Query 2653 CCCGCCGGGAAGACCATCGCGCTGGTGGGCAGCTCCGGCTCCGGGAAGAGCACGGTGGTG 2712 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2691 CCCGCCGGGAAGACCATCGCGCTGGTGGGCAGCTCCGGCTCCGGGAAGAGCACGGTGGTT 2750 Query 2713 TCGCTCATCGAGAGATTCTACGACCCCAGCGCAGGTA---TACCTAGTACTGTTACTACT 2769 |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| Sbjct 2751 TCGCTCATCGAGAGGTTCTACGACCCCAGCGCAGGTATACTACCTAGTACTGTTACTACT 2810 Query 2770 TTTAGCGCATTAATCTGAGGATGTCCAGTTCGCTTGCTTGCCAATCGCCATTGCCATCGC 2829 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2811 TTTAGCGCATTAATCTGAGGATGTCCAGTTCGCTTGCTTGCCAATCGCCATTGCCATCGC 2870 Query 2830 AACAACAATACTTCGCCAACTGCCATTGCTGGGTAGA-T-------TAGTACAGTAGCAG 2881 ||||| | | || ||||||||||||||||||||||| | |||||||||||||| Sbjct 2871 AACAATAC-A-TT-GCCAACTGCCATTGCTGGGTAGACTAGTACTGTAGTACAGTAGCAG 2927 Query 2882 TTAGAAGAAGCCTCCACTGTACATTGCATTGCCAAACAAAAGTGAATTGTGCAGTAACTC 2941 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2928 TTAGAAGAAGCCTCCACTGTACATTGCATTGCCAAACAAAAGTGAATTGTGCAGTAACTC 2987 Query 2942 TGTACCACCACATTGACATGGAAATGAAGTGAATGCTTGGAGCATGCAGAGCTGGCCGGC 3001 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2988 TGTACCACCACATTGACATGGAAATGAAGTGAATGCTTGGAGCATGCAGAGCTGGCCGGC 3047 Query 3002 CTCATGGGCTGCTGCTACCTGCTAGCTAGCCAACCAGAACCAGCCATCCTCTTTCTTGCT 3061 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3048 CTCATGGGCTGCTGCTACCTGCTAGCTAGCCAACCAGAACCAGCCATCCTCTTTCTTGCT 3107 Query 3062 TTTCTTTTTACTTTCTTTGGTCGTGGCTGTTTGTGGTCATACATACATTCA--CGCAGAG 3119 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 3108 TTTCTTTTTACTTTCTTTGGTCGTGGCTGTTTGTGGTCATACATACATTCACGCGCAGAG 3167 Query 3120 CAGAAGAGCTAGCTAAGCTAGGTGGGTGTGCCTGCAACGCGGGACAAAGAAAACTATTTG 3179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3168 CAGAAGAGCTAGCTAAGCTAGGTGGGTGTGCCTGCAACGCGGGACAAAGAAAACTATTTG 3227 Query 3180 TTGCCTGGCAAGATGCTACTGTTGCCTAGCACATGCCTGCCATTGACCGACTGCTCAGTG 3239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3228 TTGCCTGGCAAGATGCTACTGTTGCCTAGCACATGCCTGCCATTGACCGACTGCTCAGTG 3287 Query 3240 AGAAGTGGTTCAGTTGTGCTGTTGACAGTATAGATAG--ATATATATAGTAGCCCTGTAG 3297 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 3288 AGAAGTGGTTCAGTTGTGCTGTTGACAGTATAGATAGATATATATATAGTAGCCCTGTAT 3347 Query 3298 Atttt-tttttCAGACaaaaaaaGAAGAAGAACGAGATGAAGTCTGCAATTCGGTTTTGG 3356 ||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||||| Sbjct 3348 ATTTTCTTTTTCAGACAAGAAAAAAAGAAGAACGAGATGAAGTCTGCAATTCGGTTTTGG 3407 Query 3357 CAGGGCAAATCCTGCTGGACGGGCACGACCTCAGGTCGCTGGAGCTGCGGTGGCTGCGGC 3416 ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| Sbjct 3408 CAGGGCAAATCCTGCTGGACGGGCACGACCTCAGGTCGCTGAAGCTGCGATGGCTGCGGC 3467 Query 3417 GGCAGATCGGGCTGGTGAGCCAGGAGCCGGCGCTGTTCGCGACGAGCATCAGGGAGAACC 3476 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3468 GGCAGATCGGGCTGGTGAGCCAGGAGCCGGCGCTGTTCGCGACGAGCATCAGGGAGAACC 3527 Query 3477 TGCTGCTGGGGCGGGACAGCCAGAGCGCGACGCTGGCGGAGATGGAGGAGGCGGCCAGGG 3536 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3528 TGCTGCTGGGGCGGGACAGCCAGAGCGCGACGCTGGCGGAGATGGAGGAGGCGGCCAGGG 3587 Query 3537 TGGCCAACGCCCACTCCTTCATCATCAAACTCCCCGACGGCTACGACACGCAGGTCCGTC 3596 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3588 TGGCCAACGCCCACTCCTTCATCATCAAACTCCCCGACGGCTACGACACGCAGGTCCGTC 3647 Query 3597 CCGTATAGCTAGCTCACTAGCTGCACTGCCACTTCTCTCGCTTGCTCCCCCACCGTTGCT 3656 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 3648 CCGTATAGCTAGCTCACTAGCTGCACTGCCACTTCTCTCGCTTGCT-CCCCACCGTTGCT 3706 Query 3657 GCCTGTTGCTCTCCAATCCACTTGTCGGTGTCTGGACCACACGTG-CTGCTTGCCTAGCT 3715 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 3707 GCCTGTTGCTCTCCAATCCACTTGTCGGTGTCTGGACCACACGTGCCTGCTTGCCTAGCT 3766 Query 3716 GCTCCACATCTGCTTTCCCTGTCCAACCTTATGCAACTCACTC--T-A----ATACTATA 3768 ||||||||||||||||||||||||||||||||||||||||||| | | |||||||| Sbjct 3767 GCTCCACATCTGCTTTCCCTGTCCAACCTTATGCAACTCACTCAGTCACTCTATACTATA 3826 Query 3769 TCAAATACATTTCTAGAGTTTAAAGCTTATCTTAGAATAAATGCATCTTTAGCTACGAGA 3828 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3827 TCAAATACATTTCTAGAGTTTAAAGCTTATCTTAGAATAAATGCATCTTTAGCTACGAGA 3886 Query 3829 CAACCTAACTTCAGTTGTTGTTGTTGttttttttACTTTCTCTCTTCTCACAAATACTAT 3888 ||||||||||||| |||||||||||||||||||||||||||||||||| |||||| | Sbjct 3887 CAACCTAACTTCA---GTTGTTGTTGTTTTTTTTACTTTCTCTCTTCTCAAAAATACATT 3943 Query 3889 GATTACGTCTTTACAGCGATCTTTTTTATTCCAAACCTAAAAATGCATGCACTCACTCTA 3948 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 3944 GATTACGTCTTTACAGCGATC-TTTTTATTCCAAACCTAAAAATGCATGCACTCACTCTA 4002 Query 3949 AAAGCGCAAAGGGAGCATCtttttttCCCCCATCATCTGCACGCAGCCTTTTCTTTTCCT 4008 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 4003 AAAGCGCAAAGGGAGCATCTTTTTT--CCCCATCATCTGCACGCAGCCTTTTCTTTTCCT 4060 Query 4009 CATGTCACGAAGGGACTGAAGGTGTGTATGCAGCGTCAAGTCATCCATCCGTTCCACTCC 4068 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4061 CATGTCACG-AGGGACTGAAGGTGTGTATGCAGCGTCAAGTCATCCATCCGTTCCACTCC 4119 Query 4069 ACTCACTCATGCGTCGCGCACTCTGCGCTCGTGCCTGCCCGGGGCTAAAGCTTTAGTAGC 4128 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4120 ACTCACTCATGCGTCGCGCACTCTGCGCTCGTGCCTGCCCGGGGCTAAAGCTTTAGTAGC 4179 Query 4129 TAGCCTCAGATCAGATACTGTTCGTGTTTGTTAGGCCGCGGCAGCTGCACATGAGCTCAT 4188 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 4180 TAGCCTCAGATCAGATACTGTTCGTGTTTGTTAGGCCGCGGCAGCGGCACATGAGCTCAT 4239 Query 4189 GACAGCCGGCAGCACCACCACCAACGCCATGGAAGAGGGGTCGGGGTCCATCACATAGAC 4248 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 4240 GACAGCCGGCAGCACCACCACCAACACCATGGAAGAGGGGTCGGGGTCCATCACATAGAC 4299 Query 4249 ATA-ATGCCTGTTGTAGACTA-GGACGGGAGGGCAATTGTTAGGCGCCTGTTGCCATCGC 4306 ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 4300 ATAGATGCCTGTTGTAGACTAGGGACGGGAGGGCAATTGTTAGGCGCCTGTTGCCATCGC 4359 Query 4307 ATTTGCTGCTGTGGGTTGCCAACAAGTAACATGCCAGGATGCTTTGCTATCACGCACAGG 4366 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4360 ATTTGCTGCTGTGGGTTGCCAACAAGTAACATGCCAGGATGCTTTGCTATCACGCACAGG 4419 Query 4367 AC---AGGAGAGGTCCTTTTTCTCGACACAAGCTCTACAGCCTCTACTAAACTAGCACTT 4423 || ||||||||||||||||||||||||||| | |||||||||||||||||| Sbjct 4420 ACAGGAGGAGAGGTCCTTTTTCTCGACACAAG----A-----TCTACTAAACTAGCACTT 4470 Query 4424 GCTGATGAGTGCAGAGGATGAATGGACGATGAACATCTAGAGTGAGAGAGaaaaaa-aTG 4482 ||||||||||||| |||||||||||| |||||||||||||||||||||||| |||| ||| Sbjct 4471 GCTGATGAGTGCATAGGATGAATGGATGATGAACATCTAGAGTGAGAGAGAGAAAATATG 4530 Query 4483 TTAATAATAATAAA-A--AGTA---GTAGC---AGGATTAAGAATCAACCTGGGGTACGT 4533 |||||||||||||| | |||| |||| ||||||||||||||||||||||||||| Sbjct 4531 TTAATAATAATAAAGAGTAGTAATAGTAGTAGTAGGATTAAGAATCAACCTGGGGTACGT 4590 Query 4534 AGGAAGAGGTACAATCCCTAGGAATCTAGAGTATGAGAAGTATGGGAGGAGTTGGGGGAG 4593 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 4591 AGGAAGAGGTACAATCCCTAGGAATCTAGAGTATGAGAAGTATGGGAGGAGTTGT--GAG 4648 Query 4594 TGAAACGGAACAAATTCCGAGTTGGTATTTTGTCGGGAATGTCAAGTTGATTTTTGATCC 4653 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4649 TGAAACGGAACAAATTCCGAGTTGGTATTTTGTCGGGAATGTCAAGTTGATTTTTGATCC 4708 Query 4654 TAGTGCAAGCAAGAATTATCAATCACTCAGACTCAGCCTGTCTGTGTCTGTCCACCCCAG 4713 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4709 TAGTGCAAGCAAGAATTATCAATCACTCAGACTCAGCCTGTCTGTGTCTGTCCACCCCAG 4768 Query 4714 CTCTTGCTACTCTACTTACTACTGTGCTACTAGTGGGTAGGGTAGGTATCTTACATAAAC 4773 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| Sbjct 4769 CTCTTGCTACTCTACTTACTACTGTGCTACTAGT-GGTAGGGTAGGTATCTTCCATAAAC 4827 Query 4774 TGTTATTATAAACTGTCATCTGAGAAAGAGAGCCAGTCAAACCCATGCTGCTGCTTA-TT 4832 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 4828 TGTTATTATAAACTGTCATCTGAGAAAGAGAGCCAGTCAAACCCATGCTGCTGCTTATTT 4887 Query 4833 TTAATCACTGTCAAATGGCAGGCAGGCAGGCAGTCTGGTTAGTTAATAACATCTGGGAAG 4892 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4888 TTAATCACTGTCAAATGGCAGGCAGGCAGGCAGTCTGGTTAGTTAATAACATCTGGGAAG 4947 Query 4893 GGTTTAATCAAACCAAATCAAATCAGACGAAATCTAGAGGCCACATGGGATGGGGCCATA 4952 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 4948 GGTTTAATCAAACCAAATCAAATCATACGAAATCTAGAGGCCACATGGGATGGGGCCATA 5007 Query 4953 TGTACTGTACTAGCATAACTAGCGGCTAGATTTTATTAGAACACGGACTCACACTCCCAT 5012 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 5008 TGTACTGTACTAGCATAAGTAGCGGCTAGATTTTATTAGAACACGGACTCACACTCCCAT 5067 Query 5013 AACTATAACTGAC-TTGATCATGATTCCTTGCCAAGCAATGCTCGCATGCCCATGCATGC 5071 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5068 AACTATAACTGACTTTGATCATGATTCCTTGCCAAGCAATGCTCGCATGCCCATGCATGC 5127 Query 5072 ATCATCCCTGGTCAAACTCAAACACTCTCCACCGTCAGGGAATAAGACttattattttat 5131 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5128 ATCATCCCTGGTCAAACTCAAACACTCTCCACCGTCAGGGAATAAGACTTATTATTTTAT 5187 Query 5132 taacaattcaatttttatttattaattaCGTCTGGACGAGGAGTACTGGTTTATTTGATG 5191 ||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||| Sbjct 5188 TAACAATTCCATTTTTATTTATTAATTACGGCTGGACGAGGAGTACTAGTTTATTTGATG 5247 Query 5192 AGAGACATGGCAGTCCAAGTCAAACTCGTTTGTCTGACCATGGCGGTGATGGCCGG-TGC 5250 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 5248 AGAGACATGGCAGTCCAAGTCAAACTCGTTTGTCTGACCATGGCGGTGATGGCCGGTTGC 5307 Query 5251 AGGTTGGGGAGCGCGGCCTGCAGCTCTCCGGTGGGCAGAAGCAGCGCATCGCCATCGCCC 5310 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5308 AGGTTGGGGAGCGCGGCCTGCAGCTCTCCGGTGGGCAGAAGCAGCGCATCGCCATCGCCC 5367 Query 5311 GCGCCATGCTCAAGAACCCCGCCATCCTGCTGCTGGACGAGGCCACCAGCGCGCTGGACT 5370 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5368 GCGCCATGCTCAAGAACCCCGCCATCCTGCTGCTGGACGAGGCCACCAGCGCGCTGGACT 5427 Query 5371 CCGAGTCTGAGAAGCTCGTGCAGGAGGCGCTGGACCGCTTCATGATGGGGCGCACCACCC 5430 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 5428 CCGAGTCTGAGAAGCTCGTGCAGGAGGCGCTGGACCGCTTCATGATCGGGCGCACCACCC 5487 Query 5431 TTGGTGATCGCGCAACAGGCTGTCCACCATCCGCAAAGGCCGACGTGGTGGCCGTGCTGC 5490 |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct 5488 -TGGTGATCGCGC-ACAGGCTGTCCACCATCCGC-AAGGCCGACGTGGTGGCCGTGCTGC 5544 Query 5491 AGGGCGGCGCCGTCTCCGAGATGAGCGCGCACGACGAGCTGATGGCCAAGGGCGAGAACG 5550 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 5545 AGGGCGGCGCCGTCTCCGAGATGGGCGCGCACGACGAGCTGATGGCCAAGGGCGAGAACG 5604 Query 5551 GCACCTACGCCAAGCTCATCCGCATGCAGGAGCAGGCGCACGAGGCGGCGCTCGTCAACG 5610 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5605 GCACCTACGCCAAGCTCATCCGCATGCAGGAGCAGGCGCACGAGGCGGCGCTCGTCAACG 5664 Query 5611 CCCGCCGCAGCAGCGCCAGGCCCTCCAGCGCCCGCAACTCCGTCAGCTCGCCCATCATGA 5670 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5665 CCCGCCGCAGCAGCGCCAGGCCCTCCAGCGCCCGCAACTCCGTCAGCTCGCCCATCATGA 5724 Query 5671 CGCGCAACTCCTCCTACGGCCGCTCCCCCTACTCCCGCCGCCTCTCCGACTTCTCCACCT 5730 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5725 CGCGCAACTCCTCCTACGGCCGCTCCCCCTACTCCCGCCGCCTCTCCGACTTCTCCACCT 5784 Query 5731 CCGACTTCACCCTCTCCATCCACGACCCGCACCACCACCACCGGACCATGGCGGACAAGC 5790 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5785 CCGACTTCACCCTCTCCATCCACGACCCGCACCACCACCACCGGACCATGGCGGACAAGC 5844 Query 5791 AGCTGGCGTTCCGCGCCGGCGCCAGCTCCTTCCTGCGCCTCGCCAGGATGAACTCGCCCG 5850 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5845 AGCTGGCGTTCCGCGCCGGCGCCAGCTCCTTCCTGCGCCTCGCCAGGATGAACTCGCCCG 5904 Query 5851 AGTGGGCCTACGCGCTCGCCGGCTCCATCGGCTCCATGGTCTGCGGCTCCTTCAGCGCCA 5910 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5905 AGTGGGCCTACGCGCTCGCCGGCTCCATCGGCTCCATGGTCTGCGGCTCCTTCAGCGCCA 5964 Query 5911 TCTTCGCCTACATCCTCAGCGCCGTGCTCAGCGTCTACTACGCGCCGGACCCGCGGTACA 5970 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5965 TCTTCGCCTACATCCTCAGCGCCGTGCTCAGCGTCTACTACGCGCCGGACCCGCGGTACA 6024 Query 5971 TGAAGCGCGAGATCGCAAAATACTGTTACCTGCTCATCGGCATGTCCTCCGCGGCGCTGC 6030 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 6025 TGAAGCGCGAGATCGCAAAATACTGCTACCTGCTCATCGGCATGTCCTCCGCGGCGCTGC 6084 Query 6031 TGTTCAACACGGTGCAGCACGTGTTCTGGGACACGGTGGGCGAGAACTTGACCAAGCGGG 6090 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 6085 TGTTCAACACGGTGCAGCACGTGTTCTGGGACACGGTGGGCGAGAACCTGACCAAGCGGG 6144 Query 6091 TGCGCGAGAAGATGTTCGCCGCCGTGTTCCGCAACGAGATCGCCTGGTTCGACGCGGACG 6150 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 6145 TGCGCGAGAAGATGTTCGCCGCCGTGCTCCGCAACGAGATCGCCTGGTTCGACGCGGACG 6204 Query 6151 AGAACGCCAGCGCGCGCGTGACCGCCAGGCTAGCGCTGGACGCCCAGAACGTGCGCTCCG 6210 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct 6205 AGAACGCCAGCGCGCGCGTGGCCGCCAGGCTAGCGCTGGACGCCCAGAACGTGCGCTCCG 6264 Query 6211 CCATCGGGGACCGCATCTCCGTCATCGTCCAGAACTCGGCGCTGATGCTGGTGGCCTGCA 6270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6265 CCATCGGGGACCGCATCTCCGTCATCGTCCAGAACTCGGCGCTGATGCTGGTGGCCTGCA 6324 Query 6271 CCGCGGGGTTCGTCCTCCAGTGGCGCCTCGCGCTCGTGCTCCTCGCCGTGTTCCCGCTCG 6330 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6325 CCGCGGGGTTCGTCCTCCAGTGGCGCCTCGCGCTCGTGCTCCTCGCCGTGTTCCCGCTCG 6384 Query 6331 TCGTGGGCGCCACCGTGCTGCAGAAGATGTTCATGAAGGGCTTCTCGGGGGACCTGGAGG 6390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6385 TCGTGGGCGCCACCGTGCTGCAGAAGATGTTCATGAAGGGCTTCTCGGGGGACCTGGAGG 6444 Query 6391 CCGCGCACGCCAGGGCCACGCAGATCGCGGGCGAGGCCGTGGCCAACCTGCGCACCGTGG 6450 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct 6445 CCGCGCACGCCAGGGCGACGCAGATCGCGGGCGAGGCCGTGGCCAACCTGCGCACCGTGG 6504 Query 6451 CCGCGTTCAACGCGGAGCGCAAGATCACGGGGCTGTTCGAGGCCAACCTGCGCGGCCCGC 6510 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6505 CCGCGTTCAACGCGGAGCGCAAGATCACGGGGCTGTTCGAGGCCAACCTGCGCGGCCCGC 6564 Query 6511 TCCGGCGCTGCTTCTGGAAGGGGCAGATCGCCGGCAGCGGCTACGGCGTGGCGCAGTTCC 6570 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6565 TCCGGCGCTGCTTCTGGAAGGGGCAGATCGCCGGCAGCGGCTACGGCGTGGCGCAGTTCC 6624 Query 6571 TGCTGTACGCGTCCTACGCGCTGGGGCTGTGGTACGCGGCGTGGCTGGTGAAGCACGGCG 6630 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6625 TGCTGTACGCGTCCTACGCGCTGGGGCTGTGGTACGCGGCGTGGCTGGTGAAGCACGGCG 6684 Query 6631 TGTCCGACTTCTCGCGCACCATCCGCGTGTTCATGGTGCTGATGGTGTCCGCGAACGGCG 6690 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6685 TGTCCGACTTCTCGCGCACCATCCGCGTGTTCATGGTGCTGATGGTGTCCGCGAACGGCG 6744 Query 6691 CCGCCGAGACGCTGACGCTGGCGCCGGACTTCATCAAAGGCGGGCGCGCGATGCGGTCGG 6750 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 6745 CCGCCGAGACGCTGACGCTGGCGCCGGACTTCATCAAGGGCGGGCGCGCGATGCGGTCGG 6804 Query 6751 TGTTCGAGACAATCGACCGCAAGACGGAGGTGGAGCCCCACGACGTGGACGCGGCGCCGG 6810 |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 6805 TGTTCGAGACGATCGACCGCAAGACGGAGGTGGAGCCCGACGACGTGGACGCGGCGCCGG 6864 Query 6811 TGCCGGA-CGGCCCAGGGGCGAAGGTGGAACTTAAGCACGTGGACTTTTTGTACCCGTCG 6869 ||||||| ||||| ||||||| ||||||| || |||||||||||||| | |||||||||| Sbjct 6865 TGCCGGAGCGGCCGAGGGGCG-AGGTGGAGCTGAAGCACGTGGACTTCTCGTACCCGTCG 6923 Query 6870 CGGCCGGACATCCAAGTGTTCCGCGACCTGAGCCTCCGTGCGCGCGCCGGAAAAACGTTG 6929 |||||||||||||| ||||||||||||||||||||||||||||| ||||| || ||| || Sbjct 6924 CGGCCGGACATCCAGGTGTTCCGCGACCTGAGCCTCCGTGCGCGGGCCGGGAAGACGCTG 6983 Query 6930 GCGCTGGTGGGGCCGAGCGGGTCCGGCAAGAGCTCGGTCCTGGCTCTGGTGCAGCGGTTC 6989 |||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||| Sbjct 6984 GCGCTGGTGGGGCCGAGCGGGTGCGGCAAGAGCTCGGTGCTGGCGCTGGTGCAGCGGTTC 7043 Query 6990 TACAAGCCCACGTCCGGGCGCGTGCTCTTGGACGGCAAGGACGTGCGCAAGTACAACCTG 7049 ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 7044 TACGAGCCCACGTCCGGGCGCGTGCTCCTGGACGGCAAGGACGTGCGCAAGTACAACCTG 7103 Query 7050 CGGGCGCTGCGGCGCGTGGTGGCGGTGGTACCGCAGGAGCCGTTCCTGTTCGCGGCGAGC 7109 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 7104 CGGGCGCTGCGGCGCGTGGTGGCGGTGGTGCCGCAGGAGCCGTTCCTGTTCGCGGCGAGC 7163 Query 7110 ATCCACGAGAACATcgcgtacgggcgcgagggcgcgacggaggcggaggtggtggaggcg 7169 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7164 ATCCACGAGAACATCGCGTACGGGCGCGAGGGCGCGACGGAGGCGGAGGTGGTGGAGGCG 7223 Query 7170 gcggcgcaggcgaacgcgcACCGGTTCATCGCGGCGCTGCCGGAGGGGTACCGGACGCAG 7229 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7224 GCGGCGCAGGCGAACGCGCACCGGTTCATCGCGGCGCTGCCGGAGGGGTACCGGACGCAG 7283 Query 7230 GTGGGCGAGCGCGGGGTGCAGCTGTCgggggggCAGCGGCAGCGGATCGCGATCGCGCGC 7289 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 7284 GTGGGCGAGCGCGGGGTGCAGCTGTCGGGAGGGCAGCGGCAGCGGATCGCGATCGCGCGC 7343 Query 7290 GCGCTGGTGAAGCAGGCGGCCATCGTGCTGCTGGACGAGGCGACCAGCGCGCTGGACGCC 7349 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7344 GCGCTGGTGAAGCAGGCGGCCATCGTGCTGCTGGACGAGGCGACCAGCGCGCTGGACGCC 7403 Query 7350 GAGTCGGAGCGGTGCGTGCAGGAGGCGCTGGAGCGCGCGGGGTCCGGGCGCACCACCATC 7409 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7404 GAGTCGGAGCGGTGCGTGCAGGAGGCGCTGGAGCGCGCGGGGTCCGGGCGCACCACCATC 7463 Query 7410 GTGGTGGCGCACCGGCTGGCCACGGTGCGCGGCGCGCACACCATCGCGGTCATCGACGAC 7469 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7464 GTGGTGGCGCACCGGCTGGCCACGGTGCGCGGCGCGCACACCATCGCGGTCATCGACGAC 7523 Query 7470 GGCAAGGTGGCGGAGCAGGGGTCGCACTCGCACCTGCTCAAGCACCATCCCGACGGGTGC 7529 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7524 GGCAAGGTGGCGGAGCAGGGGTCGCACTCGCACCTGCTCAAGCACCATCCCGACGGGTGC 7583 Query 7530 TACGCGCGGATGCTGCAGCTTGCAGCGGCTGACGGGCGCGGCGGCCGGGCCCGGGCCGTC 7589 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct 7584 TACGCGCGGATGCTGCAGC-TGCAGCGGCTGACGGGCGCGGCGGCCGGGCCCGGGCCGTC 7642 Query 7590 GTCCTCGTGCAACGGGGCCGCGTAGGACGGAATGGATGGATGGATGGGTTTGGTTCCTCG 7649 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7643 GACCTCGTGCAACGGGGCCGCGTAGGACGGAATGGATGGATGGATGGGTTTGGTTCCTCG 7702 Query 7650 AGAGATTGATGGGTGAGGAAGCTGAAGCTCCGGATCAAATGGTGGTACTCCATGATCGCA 7709 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7703 AGAGATTGATGGGTGAGGAAGCTGAAGCTCCGGATCAAATGGTGGTACTCCATGATCGCA 7762 Query 7710 ACAATGAGGGGAAAAAAGGAAAGGAGAAAATACGGTGGTTCATATGATTGTACAATTTGA 7769 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct 7763 ACAATGAGGGGAAAAAAAGAAAGGAGAAAATACGGTGGTTCATATGATTGTACAATTTGA 7822 Query 7770 CGATCTGTTTGAGTCGGGGTTTTAGGATGATGTAAACCTTCACTCGCCttttttttACTC 7829 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7823 CGATCTGTTTGAGTCGGGGTTTTAGGATGATGTAAACCTTCACTCGCCTTTTTTTTACTC 7882 Query 7830 TTGTTTCTCATCCGCATCAGTATCATCTATCTACATACAGTGTCAGAGATGGGAACTGAT 7889 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7883 TTGTTTCTCATCCGCATCAGTATCATCTATCTACATACAGTGTCAGAGATGGGAACTGAT 7942 Query 7890 CCCGCATCATCATCTACCTCCCAAGGCACCCCAGATTGTATTAATGTACTTAGTTAGCCT 7949 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7943 -CCGCATCATCATCTACCTCCCAAGGCACCCCAGATTGTATTAATGTACTTAGTTAGCCT 8001 Query 7950 GTTTTATATATACTTATAAGTACCAAATAGCAGAATTTTACTCCTTATCTGCAGTAGCAC 8009 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8002 GTTTTATATATACTTATAAGTACCAAATAGCAGAATTTTACTCCTTATCTGCAGTAGCAC 8061 Query 8010 GAAAGaaaaaa 8020 ||||||| ||| Sbjct 8062 GAAAGAAGAAA 8072 Applicants traverse in the paper filed 4/22/2026. Applicants’ arguments have been fully considered but were not found persuasive. Applicants argue that the Examiner has not provided a rational underpinning to support the rejection that the combination of cited references would render a phenotype obvious (response, page 24). The Office contends that although the combined teachings do not teach reduction of plant height quantitively, however, Barten et al. teach that a single T insert into Exon 5 of BR2 gene of maize caused reduced height in the modified corn plant (Figure 5, Claim 1). Further, the semi-dominant mutant alleles of br2 gene would be an obvious feature exhibited by the combined teaching given that the gene silencing elements within the insert could be semi-dominant depending on strength of the silencing construct. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to LI ZHENG whose telephone number is (571)272-8031. The examiner can normally be reached Monday-Friday (9-5). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, SHUBO (JOE) ZHOU can be reached on 571-272-0724. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /LI ZHENG/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

May 19, 2023
Application Filed
Nov 26, 2025
Non-Final Rejection mailed — §103, §112
Apr 22, 2026
Response Filed
Jul 20, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747271
AV3 MUTANT POLYPEPTIDES FOR PEST CONTROL
3y 0m to grant Granted Sep 29, 2026
Patent 12740535
PEA VARIETY SVQF0513
2y 6m to grant Granted Sep 22, 2026
Patent 12733606
SOYBEAN VARIETY '20311965'
3y 0m to grant Granted Sep 15, 2026
Patent 12727562
WHEAT VARIETY 6PNUQ24B
2y 8m to grant Granted Sep 08, 2026
Patent 12698507
METHODS AND COMPOSITIONS FOR CONFERRING AND/OR ENHANCING HERBICIDE TOLERANCE USING PROTOPORPHYRINOGEN IX OXIDASE OF VARIOUS CYANOBACTERIA OR VARIANT THEREOF
4y 8m to grant Granted Aug 04, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
84%
Grant Probability
96%
With Interview (+12.9%)
2y 6m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 1279 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month