DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 06/29/2026. Claims 1-24 are currently pending. Claims 1-9, 17, 22-24 are withdrawn from prosecution as being drawn to nonelected subject matter. Accordingly, claims 10-16, 18-21 are examined herein. The restriction requirement mailed on 12/31/2025 is still deemed proper. Applicant's elected Group II without traverse in the reply filed on 06/29/2026, and elected the species SEQ ID NO: 57 (tRNAValCAC).
Election/Restrictions
Applicant's election without traverse of Group II (claims 10-21) and the species “SEQ ID NO:57 (tRNAValCAC)” in the reply filed on 06/29/2026 is acknowledged and is interpreted as the election of species “a nucleic acid molecule comprising a fragment or variant of a tRNAValCAC molecule, comprising a sequence set forth in SEQ ID NO: 57”. Although the election in the reply filed on 06/29/2026 included claim 17, it is also withdrawn because it does not read on the elected species.
Claims 1-9, 17, 22-24 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Groups I & III, there being no allowable generic or linking claim.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. This application is a 371 of PCT/US2021/060430 filed on 11/23/2021, has priority to PRO 63/117,167 filed on 11/23/2020.
Drawings
The drawing is objected to because 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG.”. In the current case, the view number for Figure 1 is preceded by the word "Fig." instead of the abbreviation "FIG.".
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The use of the terms, Sigma-Aldrich, Thermo Fisher Scientific, Sorvall, Triton-X, NanoSight, Malvern Analytical, TRIsure, Bioline, TaqMan, PrimeScript, Takara Bio, SuperScript III, Ssofast Evagreen Supermix, Bio-Rad, Bioland Scientific, Integrated DNA Technologies, ZEN/Iowa Black, Santa Cruz Biotechnology, TruSeq, Illumina, NextSeq 500, PrimeSTAR, New England Biolabs, Affymetrix, Cayman Chemical, Centri-Spin, RNAiMAX, Cell Signaling Technologies, Alexa Fluor, Nikon Eclipse Ti-U, Bioland Scientific, ON-TARGETplus, Dharmacon, BioIVT, miRNeasy, Qiagen, Eve Technologies, which are trade names or a marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
The disclosure is objected to because of the following informalities: There are numerous references to colors or colored objects in the drawings in the BRIEF DESCRIPTION OF THE DRAWINGS section on pages 14-15, e.g. “in red circles”, “in green”, “blue circles” on page 14, lines 6-7; “in green”, “in red”, “in blue” on page 15 in lines 6, 11, 17, 18, 25, 26, 27. The drawings are in black and white.
Appropriate correction is required.
Claim Objections
Claim 12 is objected to because of the following informalities: There appear to be a punctuation “, ” missing after “TLR8” because “TLR8 and a combination thereof” seems to combine two separate Markush group embodiments as a single embodiment. Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 10-16, 18-21 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., law of nature, natural phenomenon, or product of nature) without significantly more. The inventor discloses and claims naturally occurring nucleic acid constructs or compositions. The judicial exception (JE) is not integrated into a practical application and the claims do not include additional elements that are sufficient to amount to significantly more than the JE.
Regarding claims 10-16, 18-21, see the subject matter eligibility test below:
Step 1: Is the claim directed to a process, machine, manufacture, or composition of matter? Yes.
Claims 10-16, 18-21 recites “A nucleic acid molecule comprising a fragment or variant of tRNA molecule” or “A composition comprising the nucleic acid molecule of claim 10, comprising a fragment or variant of a tRNA molecule”. Thus, the claimed invention is directed to a process, machine, manufacture, or composition of matter. Hence, claims 10-16, 18-21 are Yes for Step 1. Step 2 analysis see below:
Regarding claim 10:
Step 2A, Prong 1: Does the claim recite an abstract idea, law of nature, or natural phenomenon? Yes. Is there markedly different characteristics, see MPEP § 2106.04(c)(II): No.
Claim 10 recites “A nucleic acid molecule comprising a fragment or variant of tRNA molecule”. This recitation encompasses fragments of naturally occurring tRNA molecules, or naturally occurring tRNA with naturally occurring chemical modifications under the broadest reasonable interpretation (BRI). Hence, claim 10 recites a judicial exception (JE), i.e. products of nature.
There are no markedly different characteristics in terms of structure between the claimed inventions in claim 10 and its closest natural counterparts, i.e. naturally occurring tRNA fragments, as evidenced by Fu (Genomics Inform. 2015 Dec;13(4):94-101; Page 94, Abstract) and Kumar (Nucleic Acids Res. 2015 Jan;43(Database issue):D141-5), or modified full size tRNAs for the following reasons:
Regarding fragments, Hence, fragments of tRNAs (tRFs) are naturally occurring and are well documented based on Fu (2015). Fu teaches that tRFs have been discovered by independent groups in mammalian cells, plants, yeast etc. (Page 95, Biogenesis and Structure of tRFs, right column, 1st ¶, last 10 lines). Multiple types and structures of tRFs are documented.
Regarding variants, the specification teaches that “variant … refers to a gene or gene product that possesses modifications in sequence and/or functional properties (i.e., altered characteristics) …” (Page 32, Lines 4-7). Jackman (Wiley Interdiscip Rev RNA. 2013 Jan-Feb;4(1):35-48) teaches that “In all organisms, tRNAs undergo by far the most numerous and chemically diverse posttranscriptional modifications …” (Page 1, 2nd ¶, lines 1-2). Hence, variants of naturally occurring tRNA molecules can contain naturally occurring post-transcriptional chemical modifications.
Step 2A, Prong 2: Does the claim recite additional elements that integrate the JE into a practical application?? No. There is no additional element that integrate the JE into a practical application for the claimed invention in claim 10, See MPEP § 2106.04(c)(II)(A)(2).
Step 2B, Does the claim as a whole amount to significantly more than the JE itself? No. Claim 10 refers to a JE itself, but nothing more.
Conclusion of the analysis: Claim 10 is ineligible.
Regarding claims 11 & 12, the recitation “The nucleic acid molecule of claim 10, wherein the fragment or variant of a tRNA molecule activates at least one toll-like receptor (TLR)” in claim 11 and the recitation “wherein the TLR is selected from the group consisting of TLR7, TLR8 and a combination thereof” in claim 12 encompass naturally occurring fragments or variants of naturally occurring tRNAs. Pawar (PLoS Biol. 2020 Dec 17;18(12): e3000982) teaches that naturally occurring “tRNA half molecules as abundant activators of TLR7” (Page 1, Abstract, line 1). There are no markedly different characteristics in terms of structure between the claimed inventions in claim 11 or 12 and their closest natural counterparts, see MPEP §2106.04(c)(II)(C)(2) (Step 2A, Prong 1: JE? Yes; Markedly different characteristics? No). There is no additional element that integrate the JE into a practical application for the claimed invention in claim 11 or 12 (Step 2A, Prong 2: No), and the claim as a whole does not amount to significantly more than the JE itself (Step 2B:No).
Conclusion of the analysis: Claim 11 and 12 are ineligible.
Regarding claim 13, the recitation “The nucleic acid molecule of claim 10, wherein the fragment or variant of a tRNA molecule comprises a fragment comprising at least 4 nucleotides of a tRNA molecule”. Berg (RNA Biol. 2021 Mar;18(3):316-339. Epub 2020 Sep 9) teaches that “Overall the length of canonical tRNAs varies from 76 to 90 bases” (Page 316, left column, 2nd ¶, lines 2-3). At least some embodiments of the claim encompass naturally occurring full size tRNA molecules or fragments that comprise more than 4 nucleotides of the tRNA sequences, as evidenced by 2500+ naturally occurring tRFs in the tRFdb database (genome.bioch.virginia.edu), taught by Kumar (2015), i.e. a JE. Kumar teaches that “For humans and mice, tRF-5s are mainly 15, 22 and 32 nts, whereas tRF-3s are 18 and 22 bases long” (Page D142, right column, 2nd ¶), and 15, 18, 22, 32 are all more than 4. There are no markedly different characteristics in terms of structure between the claimed inventions in claim 13 and its closest natural counterparts, see MPEP §2106.04(c)(II)(C)(2) (Step 2A, Prong 1: JE? Yes; Markedly different characteristics? No). There is no additional element that integrate the JE into a practical application for the claimed invention in claim 13 (Step 2A, Prong 2: No), and the claim as a whole does not amount to significantly more than the JE itself (Step 2B:No). Conclusion of the analysis: Claim 13 is ineligible.
Regarding claims 14 and 15, both claims are directed to the elected species “a nucleic acid molecule comprising a fragment or variant of a tRNAValCAC molecule, comprising a sequence set forth in SEQ ID NO: 57”, despite with different scopes. Claim 14 is broad (37 species) whereas claim 15 is narrow (3 species). The recitation in both claims encompasses a naturally occurring tRNAValCAC molecule, i.e. a JE. The elected species comprising a nucleic acid sequence set forth in SEQ ID NO: 57, which is a fragment of the full size naturally occurring human tRNAValCAC (see alignment below), which is encoded by the TRV-CAC4-1-tRNA-Val (anticodon CAC) 4-1 gene (Gene ID: 100189326, GenBank: HG984119.1). The gene sequence NCBI_2015_Homo sapiens tRNA-Val-CAC-4-1 gene_HG984119.1.pdf is listed in PTO-892.
Query: Instant SEQ ID NO: 57, elected species, a fragment/half of naturally occurring tRNAValCAC
Sbjct: TPA: Homo sapiens tRNA-Val-CAC-4-1 (tRNAValCAC), GenBank: HG984119.1; Length: 73
Query 1 GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCT 33
|||||||||||||||||||||||||||||||||
Sbjct 1 GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCT 33
There are no markedly different characteristics in terms of structure between the claimed inventions in claims 14 and 15 and their closest natural counterparts, See MPEP § 2106.04(c)(II)(C)(2) ) (Step 2A, Prong 1: JE? Yes; Markedly different characteristics? No). There is no additional element that integrate the JE into a practical application for the claimed invention in claims 14 or 15 (Step 2A, Prong 2: No), and the claims as a whole do not amount to significantly more than the JE itself (Step 2B:No). Conclusion of the analysis: Claims 14 & 15 are ineligible.
Regarding claim 16, there are 4 alternatives, encompassing “The nucleic acid molecule of claim 10, wherein the tRNA is selected from the group consisting of a)-d). Claim 16 is directed to the same elected species discussed above in the step 2 analysis of claims 14 and 15, “a nucleic acid molecule comprising a fragment or variant of a tRNAValCAC molecule, comprising a sequence set forth in SEQ ID NO: 57”. All 4 alternatives read on the naturally occurring tRNAValCAC , i.e. reciting a JE, because:
a) a naturally occurring tRNAValCAC comprising SEQ ID NO: 57, see sequence alignment above;
b) a naturally occurring tRNAValCAC comprising SEQ ID NO: 57 has 73 nucleotides, more than 4;
c) Paris (Semin Cell Dev Biol. 2012 May;23(3):269-74) teaches that all tRNAs have extensive post-transcriptional modifications, “On average, each tRNA molecule contains 12 modifications, with over 100 different naturally occurring chemical modifications described so far” (Page 269, first ¶, last 6 lines). Hence, a naturally occurring tRNAValCAC comprising SEQ ID NO: 57 has at least one modified nucleotide;
d) a naturally occurring tRNAValCAC comprises a sequence having 100% identity to an RNA molecule comprising a nucleotide sequence of SEQ ID NO: 57, see alignment above.
There are no markedly different characteristics in terms of structure between the claimed inventions in claim 16 and its closest natural counterparts, See MPEP § 2106.04(c)(II)(C)(2) (Step 2A, Prong 1: JE? Yes; Markedly different characteristics? No). There is no additional element that integrate the JE into a practical application for the claimed invention in claim 16 (Step 2A, Prong 2: No), and the claim as a whole does not amount to significantly more than the JE itself (Step 2B: No). Conclusion of the analysis: Claim 16 is ineligible.
Regarding claim 18, the recitation “a composition comprising the nucleic acid molecule of claim 10, comprising a fragment or variant of a tRNA molecule” reads on a naturally occurring tRNA molecule mixed in naturally occurring solution, such as water, nucleoplasm, or an endosomal lumen where naturally occurring tRNA molecules can be found, hence, it recites a JE. There are no markedly different characteristics in terms of structure between the claimed inventions in claim 18 and its closest natural counterparts, See MPEP § 2106.04(c)(II)(C)(2) (Step 2A, Prong 1: JE? Yes; Markedly different characteristics? No). There is no additional element that integrate the JE into a practical application for the claimed invention in claim 18 (Step 2A, Prong 2: No), and the claim as a whole does not amount to significantly more than the JE itself (Step 2B: No). Conclusion of the analysis: Claim 18 is ineligible.
Regarding claim 19, the recitation “the composition of claim 18, further comprising at least one selected from the group consisting of a pharmaceutically acceptable excipient and an adjuvant” reads on a naturally occurring tRNA molecule mixed in naturally occurring solution, such as water, nucleoplasm, endosomal lumen, or extracellular vesicle lumen, where naturally occurring tRNA molecules can be found based on the teaches of Tosar (RNA Biol. 2020 Aug;17(8):1149-1167). Tosar teaches that “In the extracellular space, tRNA-derived fragments have been shown to exist in extracellular vesicles (EVs)” (Page 1, left column, 3rd ¶). Since the specification does not define adjuvant, based on the teaching of Awate (Front Immunol. 2013 May 16;4:114) teaches “adjuvants” as “substances used in combination with a specific antigen that produced a more robust immune response than the antigen alone” (Page 1, Introduction, lines 3-6). Pawar (2020) above teaches that naturally occurring “tRNA half molecules as abundant activators of TLR7” (Page 1, Abstract, line 1), which could serve as an adjuvant. The claim then reads on a naturally occurring mixture of multiple tRNA fragments that boost the immune responses for each other, e.g. EVs taught by Tosar. Hence, it recites a JE. There are no markedly different characteristics in terms of structure between the claimed inventions in claim 19 and its closest natural counterparts, See MPEP § 2106.04(c)(II)(C)(2) (Step 2A, Prong 1: JE? Yes; Markedly different characteristics? No). There is no additional element that integrate the JE into a practical application for the claimed invention in claim 19 (Step 2A, Prong 2: No), and the claim as a whole does not amount to significantly more than the JE itself (Step 2B: No). Conclusion of the analysis: Claim 19 is ineligible.
Regarding claim 20, the recitation “the composition of claim 18, wherein the composition further comprises at least one additional therapeutic agent” reads on naturally occurring mixture of tRNAs, tRNA fragments, or tRNA variants with different modifications because the specification does not limit “an additional therapeutic agent” to being a non-naturally occurring agent (Pages 59-65, under Co-administration). Based on Tosar (2020)’s teaching above, the claim encompasses naturally occurring, isolated EVs containing heterogeneous therapeutic tRNAs, fragments, and variants, and other types of nucleic acids, proteins, small molecules etc. Hence, claim 20 recites a JE. There are no markedly different characteristics in terms of structure between the claimed inventions in claim 20 and its closest natural counterparts, See MPEP § 2106.04(c)(II)(C)(2) (Step 2A, Prong 1: JE? Yes; Markedly different characteristics? No). There is no additional element that integrate the JE into a practical application for the claimed invention in claim 20 (Step 2A, Prong 2: No), and the claim as a whole does not amount to significantly more than the JE itself (Step 2B: No). Conclusion of the analysis: Claim 20 is ineligible.
Regarding claim 21, the recitation “the composition of claim 20, wherein the additional therapeutic agent is selected from the group consisting of an altered T-cell, a chimeric antigen receptor T-cell (CAR-T), an antigen, a vaccine, an antibody, an immune checkpoint inhibitor, a small molecule, a chemotherapeutic agent, and a stem cell” reads on naturally occurring mixture of tRNAs, tRNA fragments, or tRNA variants with different modifications because the specification does not limit what “an additional therapeutic agent” to being only a non-naturally occurring agent (Pages 59-65, under Co-administration). The claim encompasses naturally occurring antigens, vaccines, antibodies, small molecules, etc, hence, claim 21 recites a JE. There are no markedly different characteristics in terms of structure between the claimed inventions in claim 21 and its closest natural counterparts, See MPEP § 2106.04(c)(II)(C)(2) (Step 2A, Prong 1: JE? Yes; Markedly different characteristics? No). There is no additional element that integrate the JE into a practical application for the claimed invention in claim 21 (Step 2A, Prong 2: No), and the claim as a whole does not amount to significantly more than the JE itself (Step 2B: No). Conclusion of the analysis: Claim 21 is ineligible.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 12 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 12, the recitation “the TLR” is considered indefinite. There is insufficient antecedent basis in claim 10, upon which claim 12 depends.
Claim 16 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 16, it is noted that the claim recites in alternative b) that “a fragment of an RNA molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO…”, and recites in alternatives c) and d) that “a variant of an RNA molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO…”. These recitations are considered to be indefinite because is it not clear whether the “fragment” or “variant” is required to comprise a nucleotide sequence selected from the group of sequences set forth in the recited SEQ ID NOs or only the “RNA molecule” is required to comprise a nucleotide sequence selected from the group of sequences set forth in the recited SEQ ID NOs.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 12 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. The recitation “TLR” does not exist in claim 10 upon which claim 12 depends, hence claim 12 is rejected for failing to further limit claim 10. However, “TLR” is a limitation in claim 11.
Applicant may cancel the claim, amend the claim to place the claim in proper dependent form, rewrite the claim in independent form, or present a sufficient showing that the dependent claim complies with the statutory requirements.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 10-16, 18-21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Yu (WO2019226603A1, published on 11/28/2019).
Regarding claim 10, Yu (2019) teaches “hybrid tRNA/pre-miRNA molecules, e.g., comprising a single tRNA …” (Front page, Abstract, line 1).
The specification teaches that “variant … refers to a gene or gene product that possesses modifications in sequence and/or functional properties (i.e., altered characteristics) …” (Page 32, Lines 4-7), hence Yu teaches a variant of naturally occurring tRNA based on the modifications on the sequence of naturally occurring tRNAs (FIG. 39A demonstrates an embodiment of how a tRNA sequence is modified to arrive at the claimed molecules).
Regarding claim 11, since the specification teaches that “variant … refers to a gene or gene product that possesses modifications in sequence …” (Page 32, Lines 4-7), Yu (2019) claims a tRNA variant wherein “A polynucleotide comprising a tRNA operably linked to … an inserted RNA molecule …” (Page 208, claim 1), “wherein the inserted RNA is … a noncoding RNA (ncRNA)…” (Page 209, claim 13). “Recognized … by … toll-like receptors …, synthetic ncRNAs have been well documented to … induce immunogenicity…” (Page 1, ¶[0004]). This statement is interpreted as at least some embodiments of the claimed nucleic acid molecule of claim 10 are known to activate at least one toll-like receptor (TLR).
Regarding claim 12, claim interpretation: the recitation “the TLR” is interpreted to refer to the limitation “TLR” recited in claim 11, hence, claim 12 is examined herein with the interpretation that it is intended to depend from claim 11. Yu (2019) further teaches that some embodiments of ncRNA include short interfering RNAs and that “Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7” has been reported by Hornung (Nat Med. 2005 Mar;11(3):263-70) by citing it on pages 1 and 155, and indicating that all publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes on page 207 (¶[0314]).
Regarding claim 13, Yu (2019) further teaches “The polynucleotide …, wherein the RNA coding for the tRNA comprises a 5' tRNA sequence and a 3' tRNA sequence having at least about 90%, … sequence identity to SEQ ID NOs: 300-355, as provided in Table 8” (Page 208, claim 6; Page 119, Table 8). All listed sequences are more than 4 nucleotides long and belong to various tRNA molecules.
Regarding claim 14, Yu (2019) further teaches a tRNAValCAC nucleic acid molecule that comprises a 5’ tRNA sequence set forth in SEQ ID NO: 350 (Page 119, Table 8), which has 100% identity to the claimed and elected species set forth in the instant SEQ ID NO: 57 (see alignment below), which is a fragment of tRNAValCAC based on the election and remarks submitted on 06/29/2026.
Query: Instant SEQ ID NO: 57, elected species, a fragment/half of naturally occurring tRNAValCAC
Sbjct: Yu (2019) SEQ ID NO: 350, 5’-tRNA sequence of (tRNAValCAC)
Query 1 GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCU 33
|||||||||||||||||||||||||||||||||
Sbjct 1 GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCU 33
Regarding claim 15, Yu (2019) further teaches a tRNAValCAC nucleic acid molecule that comprises a 5’ tRNA sequence set forth in SEQ ID NO: 350 (Page 119, Table 8), which has 100% identity to the claimed and elected species set forth in the instant SEQ ID NO: 57 (see alignment above), which is a fragment of tRNAValCAC based on the election and remarks submitted on 06/29/2026.
Regarding claim 16, Yu (2019) further teaches a tRNAValCAC nucleic acid molecule that comprises a 5’ tRNA sequence set forth in SEQ ID NO: 350 (Page 119, Table 8), which has 100% identity to the claimed and elected species set forth in the instant SEQ ID NO: 57 (see alignment above), which is a fragment of tRNAValCAC based on the election and remarks submitted on 06/29/2026.
Regarding claim 18, Yu (2019) further teaches a composition (front page, title; Page 214, claims 52-54; Page 70, ¶[0155], lines 8-9) comprising a nucleic acid molecule of claim 10, i.e. the claimed and elected species set forth in the instant SEQ ID NO: 57 (see alignment below), which is a fragment of tRNAValCAC based on the election and remarks submitted on 06/29/2026.
Regarding claim 19, Yu (2019) further teaches a composition (front page, title; Page 214, claims 52-54) comprising “pharmaceutical compositions well known to those in the field, … include liposomal formulations and combinations with other agents or vehicles/excipients” (Page 70, ¶[0155], lines 8-9).
Regarding claim 20, Yu (2019) further teaches “pharmaceutical compositions” (Page 70, ¶[0155], lines 8-9; front page, title; Page 214, claims 52-54) with alternative embodiments where “co-administration of one or more chemotherapeutic or anticancer agents, e.g., gemcitabine” (Page 8, ¶[0012], last 4 lines) can be included in methods using the claimed compositions. Under BRI, it is interpreted that some embodiments of the compositions encompass additional therapeutic agent(s).
Regarding claim 21, Yu (2019) further teaches “co-administration of one or more chemotherapeutic or anticancer agents, e.g., gemcitabine” (Page 8, ¶[0012], last 4 lines) can be included in methods using the claimed compositions. Under BRI, it is interpreted that some embodiments of the compositions encompass additional therapeutic agent(s) including chemotherapeutic agent(s).
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights