Prosecution Insights
Last updated: July 17, 2026
Application No. 18/254,069

SINA MOLECULES, METHODS OF PRODUCTION AND USES THEREOF

Non-Final OA §102§103§112
Filed
May 23, 2023
Priority
Nov 23, 2020 — PO 116899 +1 more
Examiner
HUDSON, AMY ROSE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Phyzat Biopharmaceuticals Lda
OA Round
1 (Non-Final)
75%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
86%
With Interview

Examiner Intelligence

Grants 75% — above average
75%
Career Allowance Rate
1089 granted / 1451 resolved
+15.1% vs TC avg
Moderate +11% lift
Without
With
+11.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
70 currently pending
Career history
1509
Total Applications
across all art units

Statute-Specific Performance

§101
1.7%
-38.3% vs TC avg
§103
47.9%
+7.9% vs TC avg
§102
8.3%
-31.7% vs TC avg
§112
20.1%
-19.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1451 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s election without traverse of group I and the species SEQ ID NOs:233/370 and 235/372 in the reply filed on 3/3/26 is acknowledged. The sequences have been rejoined. It is noted that SEQ ID NOs: 239 and 265 are free of the prior art. Claims 25-27 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 3/3/26. Improper Markush Rejection Claims 1-3, 5, 7, 10, 11, and 19-23 are rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons: The claims recite the Markush group “siNA”, which is not defined in the specification but the specification discloses: [0018] (siNA) and related nucleic acids such as short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), antagomirs and short hairpin RNA (shRNA) capable of mediating RNA interference. Each has a different structure and act via different mechanisms and would not be expected to have identical activity. For example, miRNAs are cleaved by the enzyme Drosha and exported to the cytoplasm, whereas siRNAs bind to Argonaute proteins and function to guide those proteins to targets. Antagomirs bind to target miRNAs and are single-stranded rather than double stranded and act via steric blocking of the miRNA. Accordingly, each of the agents do not have sufficiently similar structures to provide the same function because each has a structure that dictates that it must bind to a different effector molecule. Therefore, the members of the Markush group lack any common substantial structural feature that provides a common use, and the group of alternatives is an improper Markush group. Therefore, the claims broadly recite “siNA”, which is directed to an improper Markush group of agents. In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or grouping of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims(s) in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 U.S.C. 134 and 37 CFR 41.31(a)(1). Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-3, 5, 7, 8, 10, 11, and 19-23 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites the limitation "said molecule" although it does not previously recite a molecule. There is insufficient antecedent basis for this limitation in the claim. Recitation of “said siNA”, for example, would obviate this rejection. Claims 2, 3, 5, 7, 8, 10, 11, and 19-23 are rejected because they depend from claim 1 and do not obviate the rejection. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-3, 5, 7, 8, 10, 11, 14-16, and 18-23 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Instant claim 1 is directed to an isolated or synthetic “short interfering nucleic acid (siNA)” wherein said siNA comprises a nucleic acid sequence selected from group consisting of the recited SEQ ID NOs or sequences comprising at least 18 contiguous nucleotides differing by no more than 4 nucleotides, wherein said siNA reduces the expression of DBH. The specification does not define “siNA”, but discloses: [0018] (siNA) and related nucleic acids such as short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), antagomirs and short hairpin RNA (shRNA) capable of mediating RNA interference. Given that siNA stands for short interfering nucleic acid, it is assumed that the length is required to be in some short range, although the specification does not adequately describe the length limitations. Assuming that the short interfering nucleic acid is required to be short, it is not clear what the difference is in the siRNAs and dsRNAs set forth as example species of siNAs at paragraph [0018] of the specification. The specification discloses that: [0071] In an embodiment, siNA is between 19 and 25 base pairs in length; preferably between 21 and 23 base pairs in length. This embodiment meets the limitation of siRNAs. It is unclear what other types of dsRNAs would fall within the genus of siNAs and the specification does not adequately describe this genus. Additionally, the specification only discloses siNAs that are siRNAs. Claims 1-3, 5, 7, 10, 11, and 19-23 do not require for the siNA to be a siRNA, but rather encompass microRNAs and single-stranded antagomirs, as set forth in the example species of siNAs at paragraph [0018] of the specification. However, the specification does not adequately describe any siNAs other than siRNAs that comprise the instantly recited sequences and function as claimed. The species are not representative of the entire claimed genus. These claims do not require a second strand and the specification does not adequately describe single stranded siNAs that comprise any one of the recited sequences alone, half of which are disclosed as sense sequences and half of which are disclosed as antisense sequences, wherein the sense and antisense sequences are required in combination to form siRNAs as disclosed in specification (see Table 2). The claims encompass single stranded oligomers comprising only a sense strand which would not likely have the structure for the required function. The claims encompass siRNAs that are not required to have any specific combination of sense and antisense sequences and therefore would not likely have the structure required for the function. Additionally, given that the claims are directed to siNAs instead of siRNAs and no clear length limitation is set forth for siNAs, the claims encompass siNAs of unknown lengths that comprise as little as 14 nucleotides in common with any of the recited sequences and would not likely have the structure required for the function. With regards to the dsRNAs of claims 8, 14-16, and 18, the dsRNAs have no length limitation and therefore encompass dsRNAs thousands of nucleotides in length that comprise as little as 14 nucleotides in common with any of the recited sequences and would not likely have the structure required for the function. Additionally, claim 18 requires for the dsRNA to have any one of the recited antisense sequences and any one of the recited sense sequences, which encompasses selection of a sense sequence that is not the complement of the antisense sequence (i.e. SEQ ID NO: 142 and SEQ ID NO: 312) and would therefore not have the structure required for the function. With regards to claim 22, the claim requires the addition of a second ingredient for the treatment of glaucoma. However, the specification does not adequately describe the structure required for the agent to have the function of being able to treat glaucoma. Without further description of the genus, one would not be able to readily envision which agents necessarily treat glaucoma. Claim 23 recites that the ingredient is any “alpha adrenoceptor agonist”, any “beta adrenoceptor blocker”, any “carbonic anhydrase inhibitor”, any “muscarinic agonist”, any “prostaglandin analogue”, or any “rho kinase inhibitor”. The specification does not adequately describe the structure required for the ingredient to meet the limitation of being any “alpha adrenoceptor agonist”, any “beta adrenoceptor blocker”, any “carbonic anhydrase inhibitor”, any “muscarinic agonist”, any “prostaglandin analogue”, or any “rho kinase inhibitor”. The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated: "A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398. The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing. To achieve the desired function, it appears that the structure is required to be a duplex that is fully complementary to a target sequence. With respect to siRNAs, as single species of siNA agents, Elbashir et al. (The EMBO Journal, Vol. 20, No. 23, pages 6877-6888, 2001) teaches that duplexes of 21-23 nt RNAs are the sequence specific mediators of RNAi and that even single mismatches between the siRNA duplex and the target mRNA abolish interference (abstract and page 6888). The claims encompass very long dsRNA, for example, that can trigger RNAi. Such dsRNA with 14 contiguous nucleotides of any of the instantly recited sequences would not likely function as claimed. For example, Parrish et al. (Molecular Cell, Vol. 6, 1077–1087, November, 2000) teach that sequences of 1000 bp trigger RNAi (page 1078). With regards to miRNAs, another species of siNAs, to achieve the desired function, it appears that the miRNA requires fully complementary to a target sequence. For example, Krutzfeldt et al. (Nucleic Acids Research, 2007, 35, 9, 2885-2892) teach that miRNA antagomirs having four, two, or even a single mismatch at a specific position was sufficient to prevent downregulation of the target miRNA (page 2888). Additionally, Krutzfeldt et al. teach that specificity of drug-like oligonucleotides is important to minimize off-target effects and to discriminate between related miRNAs that sometimes differ by only a single nucleotide (page 2890). Thus, having analyzed the claims with regard to the Written Description guidelines, it is clear that the specification does not disclose a representative number of species for RNAi agents within the instant enormous genus that are inhibitory of the target as claimed. Thus, one skilled in the art would be led to conclude that Applicant was not in possession of the claimed invention at the time the application was filed. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Regarding SEQ ID NO: 144: Claim(s) 1-3, 5, 8, 10, 11, 14-16, and 19-21 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Khvorova et al. (WO 2004/045543 A2). Khvorova et al. teach a siRNA wherein each strand is 19 nucleotides in length and one strand is identical to nucleotides 2-20 of instant SEQ ID NO: 144 and the other strand is the complement thereof (instant claims 1-3, 5, 8, and 14-16). Khvorova et al. is silent as to the target name. Since Khvorova et al. teaches a compound meeting the instant structural limitations, the compound would necessarily achieve the recited outcome of reducing expression of the dopamine-beta-hydroxylase (DBH) gene in a cell, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. See result #19 of the PE2E search file titled “us-18-254-069-144.szlim80.rnpm” as follows: RESULT 19 PCT-US03-36787-129672 Sequence 129672, PCTUS0336787 GENERAL INFORMATION APPLICANT: Dharmacon, Inc. APPLICANT: Khvorova, Anastasia APPLICANT: Reynolds, Angela APPLICANT: Leake, Devin APPLICANT: Marshall, William APPLICANT: Read, Steven APPLICANT: Scaringe, Stephen TITLE OF INVENTION: Methods and Compositions for Improving TITLE OF INVENTION: siRNA Functionality FILE REFERENCE: 13499PCT CURRENT APPLICATION NUMBER: PCT/US03,36787 CURRENT FILING DATE: 2003-11-14 PRIOR APPLICATION NUMBER: 60/502,050 PRIOR FILING DATE: 2003-09-10 PRIOR APPLICATION NUMBER: 60/426,137 PRIOR FILING DATE: 2002-11-14 NUMBER OF SEQ ID NOS: 1591911 SEQ ID NO 129672 LENGTH: 19 TYPE: DNA ORGANISM: Homo sapiens Query Match 90.5%; Score 19; Length 19; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 GACCGUGGCGAGCUUGAGA 20 ||||||||||||||||||| Db 1 GACCGUGGCGAGCUUGAGA 19 Khvorova et al. teaches 1) that the siRNA can have 5’ or 3’ overhangs (page 14) (instant claim 10); 2) comprises chemical modifications (pages 18-19)(instant claim 11); 3) a vector comprising the siRNA (pages 51-52)(instant claim 19); liposomes comprising the siRNA (page 54)(instant claim 20); and pharmaceutical compositions comprising the siRNA and pharmaceutically acceptable carriers (page 54) (instant claim 21). Therefore, the instant invention is anticipated by Khvorova et al. Regarding SEQ ID NO: 174: Claim(s) 1-3, 5, 8, 10, 11, 14-16, and 19-21 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Zhao et al. (US 7,601,501 B2). Zhao et al. teach a siRNA targeted to DBH wherein each strand is 23 nucleotides in length and wherein nucleotides 4-21 and 23 of one strand are identical to nucleotides 1-18 and 20 of instant SEQ ID NO: 174 and the other strand is the complement thereof (instant claims 1-3, 5, 8, and 14-16). Instant claims 2, 3, 15, and 16 are anticipated because the siRNA of Zhao et al. comprises (open language) a sequence fragment that is 100% identical to instant SEQ ID NO: 174. The instant claim language does not required for the difference to be over the entire length. See result #2 of the PE2E search file titled “us-18-254-069-174.szlim80.rni” as follows: RESULT 2 US-11-836-512A-102 Sequence 102, US/11836512A Patent No. 7601501 GENERAL INFORMATION APPLICANT: Zhao, Yuanxiang APPLICANT: Ding, Sheng APPLICANT: The Scripps Research Institute TITLE OF INVENTION: Controlling Osteogenesis by Inhibition of Osteogenic TITLE OF INVENTION: Suppressors FILE REFERENCE: 014740-002210US CURRENT APPLICATION NUMBER: US/11/836,512A CURRENT FILING DATE: 2009-02-26 PRIOR APPLICATION NUMBER: US 60/822,184 PRIOR FILING DATE: 2006-08-11 NUMBER OF SEQ ID NOS: 261 SEQ ID NO 102 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Combined DNA/RNA Molecule:DBH siRNA OTHER INFORMATION: Description of Artificial Sequence: DBH siRNA OTHER INFORMATION: dopamine beta-hydroxylase (DBH), dopamine beta-monooxygenase (DBM) double-stranded small interfering RNA (siRNA) FEATURE: NAME/KEY: misc_feature LOCATION: (1)..(2) OTHER INFORMATION: DNA FEATURE: NAME/KEY: misc_feature LOCATION: (3)..(21) OTHER INFORMATION: RNA FEATURE: NAME/KEY: misc_feature LOCATION: (22)..(23) OTHER INFORMATION: DNA Query Match 95.2%; Score 20; Length 23; Best Local Similarity 95.0%; Matches 19; Conservative 1; Mismatches 0; Indels 0; Gaps 0; Qy 1 CACGUACUGGUGCUACAUUA 20 ||||||||||||||||||:| Db 4 CACGUACUGGUGCUACAUTA 23 Zhao et al. teaches 1) that the siRNA can have 5’ or 3’ overhangs (column 10) (instant claim 10); 2) comprises chemical modifications (column 11)(instant claim 11); 3) a vector comprising the siRNA (column 10)(instant claim 19); liposomes comprising the siRNA (column 10)(instant claim 20); and pharmaceutical compositions comprising the siRNA and pharmaceutically acceptable carriers (columns 10 and 17) (instant claim 21). Therefore, the instant invention is anticipated by Zhao et al. Regarding SEQ ID NOs: 233, 235, 250, and 269: Claim(s) 1-3, 5, 8, 10, 11, 14-16, and 19-21 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Khvorova et al. (US 8,090,542 B2). Khvorova et al. teach a siRNA wherein each strand is 19 nucleotides in length and one strand is identical to nucleotides 1-19 of instant SEQ ID NO: 233 and the other strand is the complement thereof (instant claims 1-3, 5, 8, and 14-16). Khvorova et al. is silent as to the target name. Since Khvorova et al. teaches a compound meeting the instant structural limitations, the compound would necessarily achieve the recited outcome of reducing expression of the dopamine-beta-hydroxylase (DBH) gene in a cell, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. See result #1 of the PE2E search file titled “us-18-254-069-233.szlim80.rni” as follows: RESULT 1 US-10-714-333C-129696 Sequence 129696, US/10714333C Patent No. 8090542 GENERAL INFORMATION APPLICANT: Dharmacon, Inc. APPLICANT: Khvorova, Anastasia APPLICANT: Reynolds, Angela APPLICANT: Leake, Devin APPLICANT: Marshall, William APPLICANT: Scaringe, Stephen TITLE OF INVENTION: Functional and Hyperfunctional siRNA FILE REFERENCE: 13499US CURRENT APPLICATION NUMBER: US/10/714,333C CURRENT FILING DATE: 2003-11-14 PRIOR APPLICATION NUMBER: 60/502,050 PRIOR FILING DATE: 2003-09-10 PRIOR APPLICATION NUMBER: 60/426,137 PRIOR FILING DATE: 2002-11-14 NUMBER OF SEQ ID NOS: 1591911 SEQ ID NO 129696 LENGTH: 19 TYPE: DNA ORGANISM: Homo sapiens Query Match 90.5%; Score 19; Length 19; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CCAGGAGAUCCGCAUGUUG 19 ||||||||||||||||||| Db 1 CCAGGAGAUCCGCAUGUUG 19 Khvorova et al. teach a siRNA wherein each strand is 19 nucleotides in length and one strand is identical to nucleotides 2-20 of instant SEQ ID NO: 235 and the other strand is the complement thereof (instant claims 1-3, 5, 8, and 14-16). Khvorova et al. is silent as to the target name. Since Khvorova et al. teaches a compound meeting the instant structural limitations, the compound would necessarily achieve the recited outcome of reducing expression of the dopamine-beta-hydroxylase (DBH) gene in a cell, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. See result #1 of the PE2E search file titled “us-18-254-069-235.szlim80.rni” as follows: RESULT 1 US-10-714-333C-129627 Sequence 129627, US/10714333C Patent No. 8090542 GENERAL INFORMATION APPLICANT: Dharmacon, Inc. APPLICANT: Khvorova, Anastasia APPLICANT: Reynolds, Angela APPLICANT: Leake, Devin APPLICANT: Marshall, William APPLICANT: Scaringe, Stephen TITLE OF INVENTION: Functional and Hyperfunctional siRNA FILE REFERENCE: 13499US CURRENT APPLICATION NUMBER: US/10/714,333C CURRENT FILING DATE: 2003-11-14 PRIOR APPLICATION NUMBER: 60/502,050 PRIOR FILING DATE: 2003-09-10 PRIOR APPLICATION NUMBER: 60/426,137 PRIOR FILING DATE: 2002-11-14 NUMBER OF SEQ ID NOS: 1591911 SEQ ID NO 129627 LENGTH: 19 TYPE: DNA ORGANISM: Homo sapiens Query Match 90.5%; Score 19; Length 19; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 GAGAUCCGCAUGUUGAAGA 20 ||||||||||||||||||| Db 1 GAGAUCCGCAUGUUGAAGA 19 Khvorova et al. teach a siRNA wherein each strand is 19 nucleotides in length and one strand is identical to nucleotides 6-21 of instant SEQ ID NO: 250 and the other strand is the complement thereof (instant claims 1-3, 5, 8, and 14-16). Khvorova et al. is silent as to the target name. The instant claims require 14 nucleotides of the instantly recited sequence (18 differing by no more than 4). Instant claims 2, 3, 15, and 16 are anticipated because the siRNA of Zhao et al. comprises (open language) a sequence fragment that is 100% identical to instant SEQ ID NO: 250. The instant claim language does not required for the difference to be over the entire length. Since Khvorova et al. teaches a compound meeting the instant structural limitations, the compound would necessarily achieve the recited outcome of reducing expression of the dopamine-beta-hydroxylase (DBH) gene in a cell, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. See result #60 of the PE2E search file titled “18-254-069-250.szlim80.rnpbm” as follows: RESULT 60 US-10-714-333A-129639 (NOTE: this sequence has 7 duplicates in the database searched) Sequence 129639, US/10714333A Publication No. US20070031844A1 GENERAL INFORMATION APPLICANT: Dharmacon, Inc. APPLICANT: Khvorova, Anastasia APPLICANT: Reynolds, Angela APPLICANT: Leake, Devin APPLICANT: Marshall, William APPLICANT: Scaringe, Stephen TITLE OF INVENTION: Functional and Hyperfunctional siRNA FILE REFERENCE: 13499US CURRENT APPLICATION NUMBER: US/10/714,333A CURRENT FILING DATE: 2003-11-14 PRIOR APPLICATION NUMBER: 60/502,050 PRIOR FILING DATE: 2003-09-10 PRIOR APPLICATION NUMBER: 60/426,137 PRIOR FILING DATE: 2002-11-14 NUMBER OF SEQ ID NOS: 1591911 SEQ ID NO 129639 LENGTH: 19 TYPE: DNA ORGANISM: Homo sapiens Query Match 76.2%; Score 16; Length 19; Best Local Similarity 100.0%; Matches 16; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 6 UCAACAGGUUCAACAA 21 |||||||||||||||| Db 1 UCAACAGGUUCAACAA 16 Khvorova et al. teach a siRNA wherein each strand is 19 nucleotides in length and one strand is identical to nucleotides 1-17 of instant SEQ ID NO: 269 and the other strand is the complement thereof (instant claims 1-3, 5, 8, and 14-16). Khvorova et al. is silent as to the target name. Since Khvorova et al. teaches a compound meeting the instant structural limitations, the compound would necessarily achieve the recited outcome of reducing expression of the dopamine-beta-hydroxylase (DBH) gene in a cell, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. See result #1 of the PE2E search file titled “us-18-254-069-269.szlim80.rni” as follows: RESULT 1 US-10-714-333C-129689 Sequence 129689, US/10714333C Patent No. 8090542 GENERAL INFORMATION APPLICANT: Dharmacon, Inc. APPLICANT: Khvorova, Anastasia APPLICANT: Reynolds, Angela APPLICANT: Leake, Devin APPLICANT: Marshall, William APPLICANT: Scaringe, Stephen TITLE OF INVENTION: Functional and Hyperfunctional siRNA FILE REFERENCE: 13499US CURRENT APPLICATION NUMBER: US/10/714,333C CURRENT FILING DATE: 2003-11-14 PRIOR APPLICATION NUMBER: 60/502,050 PRIOR FILING DATE: 2003-09-10 PRIOR APPLICATION NUMBER: 60/426,137 PRIOR FILING DATE: 2002-11-14 NUMBER OF SEQ ID NOS: 1591911 SEQ ID NO 129689 LENGTH: 19 TYPE: DNA ORGANISM: Homo sapiens Query Match 81.0%; Score 17; Length 19; Best Local Similarity 100.0%; Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGGUCAUCUCCACACU 17 ||||||||||||||||| Db 3 AAGGUCAUCUCCACACU 19 Khvorova et al. teaches 1) that the siRNA can have 5’ or 3’ overhangs (column 9) (instant claim 10); 2) comprises chemical modifications (column 12)(instant claim 11); 3) a vector comprising the siRNA (column 33)(instant claim 19); liposomes comprising the siRNA (column 35)(instant claim 20); and pharmaceutical compositions comprising the siRNA and pharmaceutically acceptable carriers (column 35) (instant claim 21). Therefore, the instant invention is anticipated by Khvorova et al. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 7, 18, 22, and 23 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhao et al. (US 7,601,501 B2) as applied to claims 1-3, 5, 8, 10, 11, 14-16, and 19-21 above, and further in view of Chalk et al. (Bioinformatics, Vol. 24 no. 10 2008, pages 1316–1317), Soboleva et al. (Russian Academy of Sciences, The Sixth International Conference on Bioinformatics of Genome Regulation and Structure, Abstracts, BGRS’ 2008 , Novosibirsk, Russia June 22-28, 2008, page 230 only), and Greenfield et al. (Journal of Glaucoma, 6, 4, 1997, 250-258). Zhao et al. teach that: siRNA molecules are typically from about 15 to about 30 nucleic acids in length, for example, about 19-25 nucleic acids in length, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleic acids in length (column 10). It would have been obvious in view of Zhao et al. alone to design the siRNA of Zhao et al. targeting DBH to be at varying lengths within the normal siRNA length range taught by Zhao et al. as a matter of design choice with a reasonable expectation of an active siRNA, which would produce a siRNA comprising instant SEQ ID NO: 174 and the complement thereof with a single mismatch (instant claims 7 and 18). It would have been obvious to incorporate a single mismatch because Chalk et al. teaches incorporation of mismatches to minimize off-target effects (page 1316). The placement of the mismatch within the parameters taught by Chalk et al. is considered to be a matter of design choice. Zhao et al. does not teach incorporation of a glaucoma drug. However, Soboleva et al. teach that polymorphisms in DBH cause glaucoma (page 230). Therefore, it would have been obvious to deliver the siRNA of Zhao et al. for the intended use of treatment of glaucoma. It would have been obvious to incorporate an additional glaucoma drug with the motivation of increasing the treatment effect on glaucoma. It would have been obvious for the glaucoma drug to be an alpha adrenoreceptor agonist, more specifically brimonidine, because Greenfield et al. teach that brimonidine is an alpha adrenoreceptor agonist that lowers intraocular pressure for the treatment of glaucoma (instant claims 22 and 23). One would reasonably expect for the siRNA of Zhao et al. to inhibit DBH and for brimonidine to lower intraocular pressure. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMY ROSE HUDSON/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

May 23, 2023
Application Filed
May 21, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680102
miRNAS FOR REDUCING VENTRICLE ENLARGEMENT
4y 5m to grant Granted Jul 14, 2026
Patent 12680099
COMPLEMENT COMPONENT C3 iRNA COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATING OR PREVENTING COMPLEMENT COMPONENT C3-ASSOCIATED DISEASES
3y 10m to grant Granted Jul 14, 2026
Patent 12668797
COMPOSITIONS AND METHODS FOR TREATING CHRONIC MYELOMONOCYTIC LEUKEMIA
3y 11m to grant Granted Jun 30, 2026
Patent 12668798
ANTISENSE NUCLEIC ACID TARGETING APOC3
3y 9m to grant Granted Jun 30, 2026
Patent 12668819
CRISPR-AID USING CATALYTICALLY INACTIVE RNA-GUIDED ENDONUCLEASE
3y 9m to grant Granted Jun 30, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
75%
Grant Probability
86%
With Interview (+11.2%)
2y 5m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1451 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month