Prosecution Insights
Last updated: October 04, 2026
Application No. 18/254,324

MEDIATORS OF GENE SILENCING

Non-Final OA §101§102§112§DOUBLEPATENT
Filed
May 24, 2023
Priority
Nov 25, 2020 — GB 2018570.8 +1 more
Examiner
YU, DELPHINUS DOU YI
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Cancer Research Technology Limited
OA Round
1 (Non-Final)
33%
Grant Probability
At Risk
1-2
OA Rounds
0m
Est. Remaining
33%
With Interview

Examiner Intelligence

Grants only 33% of cases
33%
Career Allowance Rate
2 granted / 6 resolved
-26.7% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
36 currently pending
Career history
36
Total Applications
across all art units

Statute-Specific Performance

§101
5.2%
-34.8% vs TC avg
§103
34.4%
-5.6% vs TC avg
§102
11.7%
-28.3% vs TC avg
§112
33.8%
-6.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 6 resolved cases

Office Action

§101 §102 §112 §DOUBLEPATENT
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. FIG 2b, FIG 36a, FIG 37 and FIG 38 show nucleotide sequences without SEQ ID NOs and which are also not identified by SEQ ID NO in the specification on pages 24 and 28. Required response – Applicant must provide: • Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR • A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: o A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); o A copy of the amended specification without markings (clean version); and o A statement that the substitute specification contains no new matter. Application Status This action is written in response to applicant’s correspondence received 02/19/2026. Claims 1-2,5-6,8,10,12-13,15,23,28-29,31-35,37-38,44 and 46 are currently pending. Claims 1-2,5-6,8,10,12-13, 23, 31, 38,44 and 46 are withdrawn from prosecution as being drawn to nonelected subject matter. Accordingly, claims 15, 28-29,32-35 and 37 are examined herein. The restriction requirement mailed on 12/19/2025 is still deemed proper. Applicant's elected Group II without traverse in the reply filed on 02/19/2026. Election/Restrictions Applicant's election without traverse of Group II in the reply filed on 02/19/2026 is acknowledged. Claims 1-2,5-6,8,10,12-13, 23, 31, 38,44 and 46 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Groups I, II, and IV, there being no allowable generic or linking claim. Claim 23 was inadvertently included in Group II in the Restriction Requirement mailed on 12/19/2025, however, it is clearly a product claim already included in Group I instead of the method claims in the elected Group II, therefore, it is withdrawn from examination herein. Accordingly, claims 15, 28-29,32-35 and 37 are examined herein. The requirement is still deemed proper and is therefore made FINAL. Priority Acknowledgment is made of applicant's claim for foreign priority based on an application filed in GB2018570.8 on 11/25/2020. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Drawings The drawings are objected to because 37 CFR 1.84 (u)(1) states “Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.” In the current case, the view numbers for the partial views for FIGs 1-7, 9-10, 13, 17, 23 & 27-36 that appear on several sheets are followed by "(a), (b), (c) … etc." instead of a capital letter such as FIG. 1A, FIG. 1B, etc. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. The drawings are objected to because FIGs. 12 & 37 are difficult to read the words of the disease classes on the right side of the figure. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The disclosure is objected to because of the following informalities: The description in the specification of FIGs 10-12, 33a, 35a refer to colors in the figures (including blue, green and red). The drawings have not been filed in color, and there is no petition for color drawings filed. Therefore, the specification should not refer to colors in the drawings that are filed as black and white drawings. Since these references to colors are not necessary based on the context of the figures, removing these references would remedy the object. Appropriate correction is required. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 32 and 34 are rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exceptions (i.e., law of nature, natural phenomenon, or abstract idea) without significantly more. The claims recite the steps of determining sequence identity or similarity between a tsRNA fragment having between 14 and 35 nucleotides and a target gene (step c), and identifying a tsRNA fragment that comprises a sequence complementary to an exonic region of the target gene (step d). Regarding claim 32, see the subject matter eligibility analysis below: Analysis: Claim 32: Ineligible The claim recites a series of steps, including characterizing the tsRNA fragment to determine sequence identity or similarity with the target gene. Thus, the claim is directed to a process, which is one of the statutory categories of invention (Step 1: Yes). The claim is then analyzed to determine whether it is directed to any judicial exception. The claim recites steps of providing a sample (step a), followed by isolating a tsRNA fragment having between around 14 and 35 nucleotides from said sample (step b), and in step c), the claim recites determining sequence identity or similarity with the target gene, which describes a correlation or relationship between the sequence of the tsRNA fragment and the sequence of the target gene. Finally, in step d), the claim recites identifying a tsRNA fragment that comprises a sequence that is complementary to an exonic region of the target gene, which describes a process of aligning the sequence of the tsRNA fragment to the sequence of the target gene. Both limitations of steps c) and d) set forth judicial exceptions, because the type of correlation in steps c) and d) are consequences of natural processes, similar to the naturally occurring correlation found to be a law of nature by the Supreme Court in Mayo). Additionally, steps c) and d) could be performed by a human using mental steps or basic critical thinking, which are types of activities that have been found by the courts to represent abstract ideas (e.g., the mental comparison in Ambry Genetics, or the diagnosing an abnormal condition by performing clinical tests and thinking about the results in Grams). Thus, the claim is directed to at least two exceptions (Step 2A Prong 1: Yes), which may be termed a law of nature, an abstract idea, or both. The next step is then to analyze if the judicial exceptions are integrated into practical application(s). Besides the law of nature, the claim recites additional steps of providing a sample (step a), isolating a tsRNA fragment having between around 14 and 35 nucleotides from said sample (step b), and characterizing the tsRNA fragment (i.e. sequencing, as part of wet lab portion of step c). The step is recited at a high level of generality such that it amounts to insignificant pre-solution or extra-solution activity, e.g., a mere data gathering step necessary to use the correlation. Therefore, these steps do not integrate the recited Judicial exceptions into any practical application. Further, it is well established that the mere physical or tangible nature of additional elements such as the providing sample and sequencing or characterizing steps does not automatically confer eligibility on a claim directed to an abstract idea (see, e.g., Alice Corp. v. CLS Bank Int’l, 134 S.Ct. 2347, 2358-59 (2014)) (Step 2A Prong 2: No). The final step of analysis is to determine whether the claim recite additional elements that amount to significantly more than the judicial exception. Thus, the claim as a whole does not amount to significantly more than the exception itself (Step 2B: No). Conclusion of the analysis: The claim is ineligible. Regarding claim 34: see the subject matter eligibility analysis below: Analysis: Claim 34: Ineligible This dependent claim adds no extra step to the independent claim 32, upon which it depends, by reciting “…comprising identifying a tsRNA fragment according to claim 32”. Since “for producing tsRNA fragment that mediates RNA interference…” is just intended use, hence carrying no patentability weight, the only step recited herein is the same judicial exception already discussed above in the eligibility analysis for claim 32. Step 1: Yes, a process claim; Step 2A, prong 1: Yes, It recites judiciary exception inherited from claim 32; Step 2A, prong 2: No, the judicial exception is not integrated into a practical application; Step 2B: No, the claim does not include additional elements that are sufficient to amount to significantly more than the judicial exception. Conclusion of the analysis: Claim 34 is ineligible. Claim 33 is rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exceptions (i.e., law of nature, natural phenomenon, or abstract idea) without significantly more. The inventor discloses and claims naturally occurring proteins and nucleic acid constructs. The judicial exception is not integrated into a practical application and the claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception. Regarding claim 33, see the subject matter eligibility analysis below: Analysis: Claim 33: Ineligible Claim 33 recites “A tsRNA fragment”. Thus, the claimed inventions are directed to a process, machine, manufacturer, or composition of matter (Step 1: Yes). Kim (2020; see full citation above on page 10) teaches that “tRNA-derived small RNAs (tsRNAs) were first discovered in the urine of cancer patients in the 1970s” (Page 2340, right column, second ¶, lines 10-2) and “tsRNAs are also called tRF (tRNA-derived RNA fragment), tDRs (tRNA-derived small RNAs), and tiRNAs (tRNA-derived stressinduced RNAs)…” (Page 2341, left column, 3rd¶). Hence, tsRNAs and tsRNA fragments are naturally occurring molecules. Thus, claim 33 refers to a judicial exception as the recited limitations encompass naturally occurring tsRNA fragment because of the recitation “A tsRNA fragment” in claim 33 is obtained by the recited steps including “isolating a tsRNA fragment…” in step b) of claim 32, upon which claim 33 depends. Next, since there are no markedly different characteristics in terms of structure between the claimed inventions and the closest natural counterparts, See MPEP § 2106.04(c)(II)(C)(2). The recited “A tsRNA fragment that mediates RNA interference obtained or obtainable by the method of claim 32” adds nothing to the characteristics of a naturally occurring tsRNA fragment, therefore, it lacks markedly different characteristics from nature. Hence, yes, claim 33 directs to a product of nature judicial exception (Step 2A: prong 1, Yes). Next, the analysis is to determine if the claim recites additional elements that integrates the judicial exception into practical applications. Claim 33 recites “…mediates RNA interference…” when reciting the judicial exception, however, this element merely recites an intended use and fails to amount to a “particular treatment and prophylaxis”. See MPEP § 2106.04(d)(2). Therefore, they do not include or recite additional elements that integrate the judicial exception into a practical application. (Step 2A: prong 2, No). Finally, step 2B of the analysis is to analyze if the claim recites elements that amount to significantly more than the judicial exception. Claim 33 does NOT recite any additional elements, and therefore, the claim does not include additional elements that are sufficient to amount to significantly more than the judicial exception. Conclusion: claim 33 is ineligible. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 32-34 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “between around” in “between around 14 and 35 nucleotides” in claim 32 introduces ambiguity regarding the precise boundaries of the numerical range which renders the claim indefinite. The term “between around” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Claims 33 & 34 are also rejected for depending from a rejected claim 32 and failing to remedy the indefiniteness therein. Claim Rejections - 35 USC § 112 Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. claims 15, 28-29, 35 and 37 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”. For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Claims 15, 28-29, 35 and 37 encompass a method of inhibiting the expression of a large genus of target genes or large genus of long non-coding RNAs in a large genus of biological systems by introducing a large genus of isolated tRNA-derived polynucleotides comprising a sequence that is complementary to a large genus of exonic regions of any target gene or any long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides. Claim 28 also encompasses a method of treating a large genus of diseases that include cancers, autoimmune diseases, neurodegenerative diseases, metabolic diseases, respiratory diseases and cardiovascular diseases comprising administering an effective amount of a pharmaceutical composition comprising a large genus of isolated tRNA-derived polynucleotides comprising a sequence that is complementary to a large genus of exonic regions of any target gene or a large genus of a long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides. The specification discloses tsRNAs examples having sequences comprising SEQ ID NOs: 4, 5 or 6 (pages 10, 38 and 39) which meet the written description provisions of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph: Example 2-6 (pages 37-40) discloses transfecting tsRNAs in cancer cell lines, and show the dose-dependency effect of example tsRNAs comprising SEQ ID NOs: 4, 5 or 6. However, claims 15, 28-29, 35, and 37 are only directed to encompass tsRNAs of SEQ ID NOs: 4, 5 or 6, and use only cancer cell lines to demonstrate their efficacy, and none of these examples disclose the structural characteristics that associate their function with their respective structure, which can be highly variant and encompass countless possible tsRNA structures. The specification provides insufficient written description to support the genus encompassed by the claim. See MPEP 2163. The species specifically disclosed are not representative of the genus because the genus is highly variant. Regarding the state of the art, Li (tRNA-Derived Small RNA: A Novel Regulatory Small Non-Coding RNA. Genes, Review, 9, 246, Published 10 May 2018; Listed on the IDS filed on 02/19/2026) teaches that high-throughput sequencing has unveiled various tsRNAs in bacteria, fungi, plants and mammals, and that various types of tsRNA can be generated from diverse tRNA sources (Section 2, page 2). Li further teaches that tRFs are evolutionarily ancient and present in both prokaryotes and eukaryotes, and that some tsRNAs preferentially associate with Ago1, Ago3, and Ago4 proteins but not Ago2 in a cell type specific manner, which indicates that tRFs have other functions than direct binding with the target genes as miRNAs (Section 3.1, page 4). Maute (tRNA-derived microRNA modulates proliferation and the DNA damage response and is down-regulated in B cell lymphoma. PNAS Vol. 110, No. 4, Published 22 January 2013, pages 1404-1409; Listed on the IDS filed on 02/19/2026) teaches a class of abundantly expressed small RNAs whose sequences matched either to mature or precursor tRNA transcripts in a variety of human cell types and other organisms, yet the role of how these small RNAs act is undetermined (page 1404). Maute further teaches that the tRNA-derived CU1276 can repress mRNA targets in an argonaut-dependent, miRNA-like fashion (page 1405), and therefore the data presented demonstrates that a tRNA fragment can post-transcriptionally regulate endogenous genes in a sequence-specific, miRNA-like fashion (page 1408). Lastly, Oberbauer (tRNA-Derived Small RNAs: Biogenesis, Modification, Function and Potential Impact on Human Disease Development. Genes (Basel). 2018 Dec 5;9(12):607; Listed on the IDS filed on 02/19/2026) teaches an “aptamer function of tsRNAs” (Page 12, 2nd ¶, line 6), suggesting that sequence complementarity is not a reliable indication of the function of any given tsRNA or fragment molecule, and that the functions of tsRNA fragmants are still not well understood, particularly in the context of diverse and distinct disease types or biological systems. These prior arts point to the diverse structure and functional mechanisms for individual tsRNAs and indicate the highly variant nature of the large genus of tsRNAs, which may have highly unpredictable functions as a result of the variant nature of the correlation between tsRNA structures and function. The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claims 15, 28-29, 35 and 37 are overly broad with insufficient evidence of possession at the time of filing to one with ordinary skill in the art. Therefore, claims 15, 28-29, 35 and 37 do not meet the written description requirement. Claim Rejections - 35 USC § 112 Scope of Enablement Claims 15, 28-29, 35 and 37 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of inhibiting gene expression of target genes EGFR and MET comprising introducing a tRNA-derived polynucleotide of SEQ ID NO: 4, inhibiting gene expression of target gene BCL2 comprising introducing a tRNA-derived polynucleotide of SEQ ID NO: 5, and inhibiting gene expression of target gene LINC00665 comprising introducing a tRNA-derived polynucleotide of SEQ ID NO: 6 in a cancer cell, does not reasonably provide enablement for inhibiting the expression of large genera of target genes or long non-coding RNAs in a large genus of biological systems, the method comprising introducing a tRNA-derived polynucleotide comprising a sequence that is complementary to a large genus of exonic regions of a large genera of target genes or long non-coding RNAs, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below: Nature of the Invention Claims 15, 28-29, 35, and 37 direct to methods of inhibiting expression of a target gene or of long non-coding RNA or mediating target-specific RNA interference in a biological system or in a subject in need of treating a disease, the method comprising: introducing a tRNA-derived polynucleotide according to claim 1 into the biological system or in a subject in need of treating a disease. The recitations of “optionally…” and “and/or” indicates that the limitations that follow these phrases are not required. Thus, the methods require a reliable implementation of: 1) obtaining an isolated tRNA-derived polynucleotide, comprising a sequence that is complementary to an exonic region of a target gene or of a long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14 to 35 nucleotides; 2) obtaining a biological system or a subject in need thereof; 3) introducing a tRNA-derived polynucleotide according to claim 1 into a biological system or administering a tRNA-derived polynucleotide according to claim 1 to a subject in need thereof. Claims 28 and 35 further direct to treating a broad genus of diseases using either the tRNA- or tsRNA-derived polynucleotide alone or in combination with another therapy selected from a broad genus of therapies. Thus, the methods require a reliable implementation of: the steps described above; and combine another therapy with the tsRNA-derived polynucleotide. Breadth of the Claims Claims 15, 28-29, 35 and 37 broadly encompass a method of inhibiting the expression of large genera of target genes or large genera of long non-coding RNAs in a large genus of biological systems by introducing a large genus of isolated tRNA-derived polynucleotides comprising a sequence that is complementary to a large genus of exonic regions of any target gene or any long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides. Claim 28 further encompasses a large genus of diseases with diverse etiologies. Guidance of the Specification The specification discloses tsRNAs examples having sequences comprising SEQ ID NOs: 4, 5 or 6 (pages 10, 38 and 39): Example 2-6 (pages 37-40) discloses transfecting tsRNAs in cancer cell lines, and show the dose-dependency effect of example tsRNAs comprising SEQ ID NOs: 4, 5 or 6. However, claims 15, 28-29, 35, and 37 are only directed to encompass tsRNAs of SEQ ID NOs: 4, 5 or 6 in the examples, and use only cancer cell lines to demonstrate their efficacy towards EGFR/MET, BCL2, and LINC00665 mRNAs (FIGs. 13, 15, 16, 18, 19, 22-23, 25). The specification provides insufficient guidance to support the genera of targets, large genus of tsRNA structures, and diverse specificities as claimed. Furthermore, the specification is silent on how to identify tRNA-derived polynucleotides for diverse diseases aside from a few cancer cell lines with known genetic defect. State of the Art The teachings of Li (2018), Maute (2013), and Oberbauer (2018) have been discussed above. Briefly, Li (2018) teaches that high-throughput sequencing has unveiled various tsRNAs in bacteria, fungi, plants and mammals, and that various types of tsRNA can be generated from diverse tRNA sources (Section 2, page 2). Li further teaches that tRFs are evolutionarily ancient and present in both prokaryotes and eukaryotes, and that tRFs may have other functions than direct binding with the target genes as miRNAs (Section 3.1, page 4). Maute (2013) teaches some tsRNAs can repress mRNA targets in an argonaut-dependent, miRNA-like fashion (page 1405), and therefore the data presented demonstrates that a tRNA fragment can post-transcriptionally regulate endogenous genes in a sequence-specific, miRNA-like fashion (page 1408). Oberbauer (2018) teaches an “aptamer function of tsRNAs” (Page 12, 2nd ¶, line 6), suggesting that sequence complementarity is not a reliable indication of the function of any given tsRNA or fragment molecule, and that the functions of tsRNA fragmants are still not well understood, particularly in the context of diverse and distinct disease types or biological systems. These prior arts point to the diverse structure and functional mechanisms for individual tsRNAs and indicate the highly variant nature of the large genus of tsRNAs, which may have highly unpredictable functions as a result of the variant nature of the correlation between tsRNA structures and function. The Level of Predictability in the Art The unpredictability of the claimed methods in claims 15, 28-29, 35, and 37 is high because: 1) Without firm evidence of how the molecular structure and sequence complementarity-based function correlate with each other for any given tsRNA comprising a sequence that is complementary to an exonic region of a target gene or of a long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14 to 35 nucleotides, the function of the tsRNA fragment is unpredictable based on the disclosures above.1) 2) Without working example to support the application of tsRNA-derived polynucleotide in representative species of the large genus of diseases with distinct etiologies, it is unpredictable how a tRNA- or tsRNA-derived polynucleotide comprising a sequence that is complementary to an exonic region of a target gene or of a long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14 to 35 nucleotides can impact the functions of said target gene or lincRNA based on just extremely limited examples with a narrow coverage of the representative species in a large genus of diseases, each with unique molecular and genetic networks underlying the disease development and progression. Experimentation Required In order to practice the claimed invention, an immense amount of experimentation would be required. For example, it would be necessary for one skilled in the art to: 1) Identify ts-RNA fragments comprising a sequence that is complementary to an exonic region of a target gene or of a long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14 to 35 nucleotides; 2) Determine the effective dose, delivery routes, and duration of the claimed treatment, particularly when the guidance from specification is prophetic. One of ordinary skill in the art would not be able to use the information provided by the instant specification to carry out the full scope of the invention as claimed, as there is no instruction as to how to make or use other tsRNAs to carry out the claimed invention. In absence of such information in the specification as well as the state of the art, a person of ordinary skill in the art would reasonably require an undue quantity of experimentation to practice the full scope of the claimed method. Therefore, this requirement amounts to undue burden of experimentation and also renders following the teachings in the specification highly unpredictable because of vast number of uncertainties and unknowns regarding essential parameters needed for reduction to practice, preventing one skilled in the art to make and use the claimed invention. Taken into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that an unreasonable amount experimentation would be required to use the invention as claimed. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 15, 28-29, 35 and 37 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Mao (US 20180273941, published 09/27/2018, listed on the IDS filed on 02/19/2026). Claim Interpretation: Regarding claims 15, 28-29, 37 the method only requires a step of introducing a tRNA-derived polynucleotide that meets the structural limitations of claim 1 into a biological system. If the art teaches this step, then the function of inhibiting the expression of a target gene or long-noncoding RNA in a biological system will be carried out. Regarding claims 15, Mao (2018) teaches short non-coding protein regulatory RNAs (sprRNAs), variants, fragments and inhibitors thereof, and embodiments where the sprRNAs are useful as therapeutic molecules in treatment of diseases or conditions in a subject (Page 3, ¶[0015]). Mao teaches that the sprRNA is any one of SEQ ID NOs 1-486 (¶[ 0131]). Mao also teaches vectors comprising any one of SEQ ID NOs: 1-486, and a host cell comprising a vector comprising any one of SEQ ID NOs: 1-486 (¶[0127]). SEQ ID NO: 143 of Mao is 22 nucleotides length and is 100% identical to instant SEQ ID NO: 4 which is one of the three exemplified tsRNA sequences in the instant specification. See alignment below: SEQ ID NO: 4 1 UCCCUGGUGGUCUAGUGGUUAG 22 |||||||||||||||||||||| Mao SEQ ID NO: 143 1 UCCCUGGUGGUCUAGUGGUUAG 22 Mao further teaches “In some embodiments, the nucleic acids of the invention can be administered to … a cell with a pharmaceutically acceptable carrier” (Page 16, ¶[0198]), matching the claimed limitation “An in vitro or ex vivo method…” because under the broadest reasonable interpretation, at least one embodiment of the invention involves administering sprRNA nucleic acid to a cell in vitro or ex vivo. The recitation “…of inhibiting expression of a target gene or of long non-coding RNA in a biological system…” in claim 15 is intended use, thereby carrying no patentability weight as it does not limit the scope of the claim. Regarding claim 28, Mao teaches “A method of treating a disease or condition in a subject in need of treatment comprising administering to the subject a composition comprising an effective amount of a nucleic acid comprising an sprRNA…” (Page 403, claim 31). Regarding claim 29, Mao teaches “the nucleic acids of the invention can be administered to a subject or a cell with a pharmaceutically acceptable carrier…” (Page 16, ¶[0198]), which encompasses in vivo, ex vivo, and in vitro biological systems. The recitation of a method “of inhibiting…” preamble is intended use, and the recitation “thereby…” is intended outcome, neither limits the scope of the claim. Regarding claim 35, Mao further teaches that “the sprRNA, variant or fragment thereof is administered to a cell or a subject in combination with one or more additional therapies …” (Page 11, ¶[0144]). The logic above also applies that the SEQ ID NO: 143 of Mao reads on the claimed tsRNA fragment in the instant application. Regarding claim 37, Mao teaches “the nucleic acids of the invention can be administered to a subject or a cell with a pharmaceutically acceptable carrier…” (Page 16, ¶[0198]), which encompasses in vivo, ex vivo, and in vitro biological systems. The recitation of a method “of mediating…” preamble is intended use, which does not limit the scope of the claim. Double Patenting The non-statutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A non-statutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on non-statutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a non-statutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 15, 28-29, 35 and 37 are provisionally rejected on the ground of non-statutory double patenting as being unpatentable over claims 15, 28 and 47-55 of co-pending Application No. 17/609,691 (‘691) (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because claim 15 of ‘691 is directed to a method of inhibiting expression of a cancer associated gene or of a cancer associated long non-coding RNA in a mammalian cell, the method comprising: introducing into the mammalian cell a tRNA-derived polynucleotide comprising a sequence that is at least 90% or at least 95% complementary to an intronic region of a cancer associated target gene or an intronic region of a cancer associated long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14 to 35 nucleotides (tsRNA), wherein the tRNA comprises a stem-loop/hairpin structure. Claim 28 is directed to a method for treating cancer in a subject in need thereof comprising administering to the subject an effective amount of the tRNA-derived polynucleotide; Claim 47 is a method according to claim 15 comprising administration of the tsRNA-derived polynucleotide and another therapy; Claim 48 is the method according to claim 28, wherein the isolated tRNA-derived polynucleotide comprising a sequence that is at least 90% complementary to an intronic region of a cancer associated gene or an intronic region of a cancer associated long non-coding RNA; Claim 49 is the method according to Claim 28, wherein the isolated tRNA-derived polynucleotide targets the intronic region of said cancer associated target gene or the intronic region of said cancer associated long non-coding RNA and downregulates the expression of said cancer associated target gene or of said cancer associated long non-coding RNA through cleaving nascent RNA in an Ago2-dependent manner; Claims 50-53 include further limitations on the structure of tsRNA, e.g, double or single stranded, blunt ended, overhang etc; Claim 54 further limits Claim 28 wherein the polynucleotide binds an intronic region of the mRNA of the cancer associated gene thereby inhibiting gene expression; Claim 55 is the method according to claim 28, comprising administration of the tsRNA-derived polynucleotide and another anti-cancer therapy. Instant Claims 15, 28-29, 35 and 37 broadly encompass methods of inhibiting the expression of large genera of target genes or large genera of long non-coding RNAs in a large genus of biological systems by introducing a large genus of isolated tRNA-derived polynucleotides comprising a sequence that is complementary to a large genus of exonic regions of any target gene or any long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides; Claim 28 further encompasses a large genus of diseases with diverse etiologies; Claim 35 broadly encompasses administering another therapy along with the isolated tRNA-derived polynucleotides comprising a sequence that is complementary to a large genus of exonic regions of any target gene or any long non-coding RNA. The specification of ‘691 recognizes that the sequences of the tsRNA are SEQ ID NOs: 4-6 as shown in examples 4-6, which are the same sequences used in examples 4-6 of the instant specification. Therefore, it doesn’t appear that the sequences of the tsRNA claimed in the co-pending application ‘691 are of a different structure from those in the instant claims. This is a provisional non-statutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DELPHINUS DOU YI YU/Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

May 24, 2023
Application Filed
Apr 23, 2026
Non-Final Rejection mailed — §101, §102, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
33%
Grant Probability
33%
With Interview (+0.0%)
2y 9m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 6 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month