DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-6 and 14-15) in the reply filed on 5/8/2026 is acknowledged.
Claim Status
Claims 1-15 are pending.
Claims 7-13 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 5/8/2026.
Claims 1-6 and 14-15 are being examined on the merits.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement (e.g., see pg 1-2, pg 9, and pg 12). 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing. See item 1) a) or 1) b) above.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Abstract
Applicant is reminded of the proper content of an abstract of the disclosure.
A patent abstract is a concise statement of the technical disclosure of the patent and should include that which is new in the art to which the invention pertains. The abstract should not refer to purported merits or speculative applications of the invention and should not compare the invention with the prior art.
If the patent is of a basic nature, the entire technical disclosure may be new in the art, and the abstract should be directed to the entire disclosure. If the patent is in the nature of an improvement in an old apparatus, process, product, or composition, the abstract should include the technical disclosure of the improvement. The abstract should also mention by way of example any preferred modifications or alternatives.
Where applicable, the abstract should include the following: (1) if a machine or apparatus, its organization and operation; (2) if an article, its method of making; (3) if a chemical compound, its identity and use; (4) if a mixture, its ingredients; (5) if a process, the steps.
Extensive mechanical and design details of an apparatus should not be included in the abstract. The abstract should be in narrative form and generally limited to a single paragraph within the range of 50 to 150 words in length.
See MPEP § 608.01(b) for guidelines for the preparation of patent abstracts.
Applicant is reminded of the proper language and format for an abstract of the disclosure.
The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
The abstract of the disclosure is objected to because it contains legal phraseology (“said one or more copy”) and is over 150 words. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Specification
The disclosure is objected to because of the following informalities:
Page 2, paragraph 3: “The present inventors have previously found that a thus far orphaned regulatory motif in mammalian, when bound by protein BANP” is not grammatically correct. This should read “The present inventors have previously found that a thus far orphaned regulatory motif in mammalian cells, when bound by protein BANP” or “The present inventors have previously found that a thus far orphaned regulatory motif in [[mammalian]]mammals, when bound by protein BANP”.
Page 3, paragraph 4: “In some embodiments, In some embodiments” is repeated at the beginning of the sentence. One should be removed.
Page 3, paragraph 5: This paragraph contains numerous recitations of “approximatively” which should be “approximately”.
There are numerous typos and grammatical errors throughout the specification in addition to the examples noted above. Please read through carefully.
Appropriate correction is required.
The use of the terms “BODIPY” (pg 20, paragraph 2), “Tween” (pg 22, paragraph 3), “Lipofectamine-2000” (pg 23, paragraph 3), and “Stop & Glo” (pg 24, paragraph 1), which are trade names or marks used in commerce, have been noted in this application. These terms should be accompanied by the generic terminology; furthermore the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM, or ® following the terms.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112b - Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-6 and 14-15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 is directed to an “isolated nucleic acid molecule”. However, it is unclear what is meant by the word “isolated”. The specification delves into a definition of “isolated” on page 19 and states that “"isolated" refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered "by the hand of man" from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be "isolated" because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.” The specification goes on to say that “isolated” does not refer to “total or mRNA preparation, genomic DNA preparations”. However, an example of isolated DNA molecules includes “purified (partially or substantially) DNA molecules in solution”. It is unclear how this allowed example is different from what would be obtained from a genomic DNA preparation. This lack of clarity further obscures what “isolated” truly means and thus makes the scope of claim 1 unclear.
Claims 2-4 depend from claim 1, inherit this deficiency and are rejected on the same basis. Claim 5 is directed to a vector containing the isolated nucleic acid molecule of claim 1, and therefore claims 5 and 6 are also rejected due to this indefiniteness. Claim 14 is directed to an “isolated” cell comprising the isolated nucleic acid of claim 1, and therefore claims 14 and 15 are also rejected due to this indefiniteness.
Claim 3 is directed to the isolated nucleic acid of claim 1 “further comprising, operably linked to a constitutive promoter or to an inducible promoter, a further sequence encoding for protein BANP, or for an active fragment or variant thereof”. It is unclear how the sequence encoding for protein BANP operably linked to a promoter is structurally related to the “more than 220 bp” and the “one or more copy of a sequence selected from the group of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3”. Therefore, it is unclear what the structure of the isolated nucleic acid molecule would be with the inclusion of the promoter and the sequence encoding for protein BANP.
Additionally, claim 3 is unclear as to what “active fragment or variant thereof” defines. There is no particular activity of BANP that is defined in the claim. It is unclear what activity of BANP is being persevered, therefore it is unclear what fragments or variants of the BANP protein would need to be retained for any particular activity. It is also unclear if the “variant thereof” is also an “active variant thereof”. The phrase “active fragment or variant thereof” makes it unclear as to whether “active” defines the “fragment” or both the “fragment” and “variant”.
Claim 15 recites the limitation "the heterologous transgene" in line 3. There is insufficient antecedent basis for this limitation in the claim. Claim 15 depends from claim 14, which does not contain reference to a heterologous transgene. Therefore, the scope of claim 15 is indefinite.
Claim Rejections - 35 USC § 112a – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 3 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claim is rejected for failing to describe the genus of structures of the sequence encoding for an active fragment or variant of protein BANP as currently claimed. The claim is rejected for failing to describing a genus of any variant of BANP or fragment that retains any type of activity (not specified). It is art recognized that structure will determine the function of an enzymatic activity. The function of the protein is not claimed, and therefore no structural definition can be attributed to “an active fragment or variant thereof”.
The MPEP states that the purpose of the written description requirement is to ensure that the inventor had possession, at the time the invention was made, of the specific subject matter claimed. The courts have stated:
"To fulfill the written description requirement, a patent specification must describe an
invention and do so in sufficient detail that one skilled in the art can clearly conclude that
"the inventor invented the claimed invention.” Lockwood y. American Airlines, Inc., 107
F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997); In re Gostelli, 872 F.2d 1008,
1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) ("[T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed."). Thus, an applicant complies with the written description requirement "by describing the invention, with all its claimed limitations, not that which makes it obvious,” and by using "such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention." Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966." Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
Further, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated:
"A written description of an invention involving a chemical genus, like a description of a
chemical species, 'requires a precise definition, such as by structure, formula, [or]
chemical name,’ of the claimed subject matter sufficient to distinguish it from other
materials.” Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; Jn re Smythe, 480 F.2d 1376,
1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not
necessarily, chemical cases, where there is unpredictability in performance of certain
species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the
University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
MPEP § 2163 further states that if a biomolecule is described only by a functional characteristic, without any disclosed correlation between function and structure of the sequence, it is "not sufficient characteristic for written description purposes, even when accompanied by a method of obtaining the claimed sequence." MPEP § 2163 does state that for a generic claim the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP §
2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad generic. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. Jn re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618.
As stated supra, the MPEP states that written description for a genus can be achieved by a representative number of species within a broad genus. Claims are broadly generic to all possible fragments/variants of protein BANP given that no activity is defined. The possible variations are enormous. Since the MPEP states that if a biomolecule is described only by a functional characteristic, without any disclosed correlation between function and structure, it is "not sufficient characteristic for written description purposes, even when accompanied by a method of obtaining the claimed sequence." MPEP § 2163. Here, the claims do not recite what the functional characteristics may be, and thus the claims lack written description because there is no disclosure of a correlation between function and structure. The specification merely states that BANP binds a particular orphan motif and is a transcriptional activator, but does not associate said functions with any sequence structure (page 2, paragraph 3). The specification provides alternate names of BANP and the accession numbers of the wild-type protein BANP sequence (HGNC: 13450 Entrez Gene: 54971 Ensembl: ENSG00000172530 OMIM: 611564 UniProtKB: Q8N9NS; page 23, paragraph 2) but no definitions of sequence structure related to functionality of the protein or any examples of variants thereof.
The description requirement of the patent statute requires a description of an invention, not an indication of a result that one might achieve if one made that invention. See Jn re Wilder, 736, F.2d 1516, 1521, 222 USPQ 369, 372-73 (Fed. Cir. 1984) (affirming rejection because the specification does "little more than outlin[e] goals appellants hope the claimed invention achieves and the problems the invention will hopefully ameliorate.") Accordingly, it is deemed that the specification fails to provide adequate written description for the genus of the claims (any active fragment or variant of protein BANP) and does not reasonably convey to one skilled in the relevant art that the inventor(s), at the time the application was filed, had possession of the entire scope of the claimed invention.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1, 5, 6, and 14 are rejected under 35 U.S.C. 101 because the claimed invention is directed to isolated nucleic acids that are identical to naturally occurring nucleic acids without significantly more.
The claim(s) are directed to a composition, a vector comprising the composition, and a cell comprising the composition (all products). Claim 1 is directed to an isolated nucleic acid comprising more than 220 bp and one or more copies selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. The isolated nucleic acid further comprises a CpG Observed over Estimated ratio (O/E ratio) larger than 0.6 in the N base pairs preceding and/or in the N bp following said one or more copies. Claim 5 is directed to a vector comprising the isolated nucleic acid molecule of claim 1, and claim 14 is directed to a cell comprising the isolated nucleic acid molecule of claim 1. Here, it is noted that SEQ ID NO: 1 is naturally occurring in the human genome (within the promoter region of the DENR gene, chr12: 122752553-122752813; see bolded sequence in the provided reference document “NC_000012.12_122752553-122752813 Homo sapiens chromosome 12” and recreated below). The 220 base pairs preceding this sequence has an O/E ratio of 1.02 (larger than 0.6; see sequence provided below).
>ref|NC_000012.12|:122752553-122752813 Homo sapiens chromosome 12, GRCh38.p14 Primary Assembly
GATCCTCGGACTCATTAATAGGGAGTCATTTGTGACTCAGGTGCGCTCTCTGCGTCTGCAAGTCACGTTCCCTTCGGCACGCCCATCTCGAGGATTCATCCTCTCCAACGGGTGACGAGCACCGCCTGCCGGCGGCCCGCCTCTCGGCCTCTTGGCCACGCCCCCCACCGGAGGGCAAGGCGCACGCTCCGCAATTTTTCTCCGCCCCCGTCTTCCGGCTTCTCGCGACATCCGCCCAGCGGCGGCCGGAATCTCGCGATA
Because the claims recite a nature-based product limitation (the isolated nucleic acid molecules), the “markedly different characteristics analysis” is used to determine if the nature-based product limitation is a product of nature exception (MPEP 2106.04(c)(I)). While some of the claims recite additional elements (a vector (claim 5-6), a cell (claim 14)), the markedly different characteristic analysis is applied only to the nature-based product limitation (the claimed isolated nucleic acid molecule). The markedly different characteristics analysis is performed by comparing the nature-based product limitation (in this case the isolated nucleic acid molecule) in the claim to its naturally occurring counterpart to determine if it has markedly different characteristics from the counter part (MPEP 2106.04(c)(II)). Here, the closest natural counterpart is genomic DNA that is found in human cells. When the claimed nucleic acid is compared to this counterpart, the comparison indicates that there are no significant differences in structure, hybridization ability, or other characteristics. Therefore, the nucleic acid of the claims is a product of nature exception.
This judicial exception is not integrated into a practical application because the claims do not recite any additional physical elements that clearly integrate the isolated nucleic acid into a practical application.
The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the additional elements are only broadly/generically recited carriers of claim 1 (a cell or a vector) and such elements are well-known, routine, and conventional with regard to compositions comprising nucleic acids.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2, 5-6, and 14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Mahpour (Mahpour et al., PLOS One 2018), as evidenced by Promega (pGL2-Basic Vector Sequence, 2002).
As noted in MPEP 2131.01, while a 102 rejection is normally made using only one reference, additional references may be relied upon when the additional references are cited to “Explain the meaning of a term used in the primary reference” (MPEP 2131.01(II)). In the instant case, the sequence of the pGL2-Basic vector as noted in Mahpour is not disclosed. However, the sequence of this vector, as evidenced by Promega, is necessary for proving the anticipatory nature of the subject matter of Mahpour.
Regarding claims 1, 5, and 6: Mahpour teaches an isolated nucleic acid molecule that is more than 220 bp, comprises one copy of TCTCGCGACA (reads on SEQ ID NO: 1), and has a CpG Observed over Estimated (O/E ratio) over 0.6 in the N base pairs following said copy. The isolated nucleic acid molecule as taught by Mahpour is the pGL2-Basic plasmid with a fragment of the naturally occurring DENR promoter inserted at the MCS using restriction enzymes MluI and BglII (relevant to claims 1, 5, and 6; CGCG elements recruit transcriptional machinery and activate gene expression, “One to three copies of the CGCG elements from the DENR promoter were synthesized as double stranded oligonucleotides (IDT DNA) and cloned into the BglII and MluI restriction sites of a luciferase reporter construct that lacks promoter sequences (pGL2-basic, Promega)” – Reporter constructions and assays, S1 File – Table 1). The 230 base pairs of downstream sequence following the DENR promoter motif TCTCGCGACA has an O/E ratio of 1.07 (relevant to claim 1).
Claim 2: Mahpour teaches that the isolated nucleic acid of claim 1 comprises a heterologous transgene (Luciferase; Reporter constructions and assays, Figure 2).
Claim 14: Mahpour teaches an isolated cell comprising the isolated nucleic acid of claim 1 (“1 μg of cloned reporter DNA along with 100 ng of a Renilla luciferase reporter construct (pRL-TK) as transfection control were transfected into HEK293T using X-tremeGENE 9 (Roche) reagent according to manufacturer’s protocol.” - Reporter constructions and assays).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Mahpour (Mahpour et al., PLOS One 2018), as evidenced by Promega (pGL2-Basic Vector Sequence, 2002), in view of Liu (Liu et al., Oncology Research 2014).
The teachings of Mahpour as they apply to claim 1, from which claim 3 depends, are detailed above. Relevant to the instantly rejected claim, Mahpour teaches an isolated nucleic acid molecule comprising a plasmid with a TCTCGCGACA (reads on SEQ ID NO: 1) promoter sequence operably linked to a luciferase reporter gene.
Mahpour does not teach that the promoter sequence is operably linked to a sequence encoding for BANP. However, expression of BANP from isolated nucleic acids is known in the art, as taught by Liu.
Liu teaches a pEGFP-SMAR1 plasmid which is employed to induce overexpression of SMAR1 in a human breast cancer cell line (Abstract, Lentiviral Production and Infection of Human Breast Cancer Cell Line MCF7). Protein BANP is also known as SMAR1 (see page 23 of the instant specification).
It would have been prima facie obvious to one having ordinary skill in the art, before the effective filing date of the instant application, to have modified the isolated nucleic acid molecule of Mahpour to include the variant of BANP, SMAR1, as taught by Liu. One would be motivated to do so given the assertion by Liu that enhanced expression of SMAR1 sensitizes breast cancer cells to radiotherapy and thus “will help to improve the clinical efficiency and radiation therapy” (Abstract). One would have a reasonable expectation of success given that Liu successfully demonstrates that SMAR1, operably linked to a promoter, can be expressed in cells (Figure 1).
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Mahpour (Mahpour et al., PLOS One 2018), as evidenced by Promega (pGL2-Basic Vector Sequence, 2002), in view of Zhang (Zhang et al., BMC Biotechnology 2018).
The teachings of Mahpour as they apply to claims 1 and 2, from which claim 4 depends, are detailed above. Relevant to the instantly rejected claim, Mahpour teaches an isolated nucleic acid molecule comprising a plasmid with a TCTCGCGACA (reads on SEQ ID NO: 1) promoter sequence operably linked to a luciferase reporter gene (heterologous transgene).
Mahpour does not teach that the heterologous transgene is a chimeric antigen receptor. However, expression of a chimeric antigen receptor under control of a promoter within a plasmid vector is known in the art, as taught by Zhang.
Zhang teaches a method of T-cell engineering by electro-transfecting T cells with a pcDNA3.1(+) plasmid encoding αCD19 CAR (Abstract and Plasmids and cloning).
It would have been prima facie obvious to one having ordinary skill in the art, before the effective filing date of the instant application, to have modified the isolated nucleic acid molecule of Mahpour to include a chimeric antigen receptor as taught by Zhang. One would be motivated to express a CAR given the assertion by Zhang that expression of CAR to engineer T cells as immunotherapy is a “promising treatment for cancer” (Background). One would have a reasonable expectation of success given that Zhang demonstrates successful expression of the CD19 CAR in electroporated T cells from the transfected plasmid (Figure 5).
Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Mahpour (Mahpour et al., PLOS One 2018), as evidenced by Promega (pGL2-Basic Vector Sequence, 2002), in view of Liu (Liu et al., Oncology Research 2014) and Dropulic (Dropulic, Human Gene Therapy 2011).
The teachings of Mahpour as they apply to claim 14, from which claim 15 depends, are detailed above. Relevant to the instantly rejected claim, Mahpour teaches an isolated nucleic acid molecule comprising a plasmid with a TCTCGCGACA (reads on SEQ ID NO: 1) promoter sequence operably linked to a luciferase reporter gene. Mahpour teaches an isolated cell comprising the isolated nucleic acid of claim 1 Additionally, Mahpour teaches that multiple copies of SEQ ID NO: 1, leads to increased expression of the operably linked heterologous transgene (Figure 2C).
Mahpour does not teach that the isolated nucleic acid sequence with the heterologous transgene is stably integrated into the genome of the cell. However, integration of expression constructs into the genome of host cells is known in the art, as taught by Liu.
Liu teaches overexpression a pEGFP-SMAR1 construct in MCF7 via a lentivirus expression system (Lentiviral Production and Infection of Human Breast Cancer Cell Line MCF7). Lentiviral expression systems allow for integration of the desired plasmid construct into the host cell genome (as taught by Dropulic, Introduction, paragraph 1).
It would have been prima facie obvious to one having ordinary skill in the art, before the effective filing date of the instant application, to have modified the isolated nucleic acid molecule of Mahpour to include integration of the multi-copy plasmid into the host cell genome via a lentiviral expression system, as taught by Liu. One would be motivated to do so given the teachings by Dropulic that usage of lentiviral expression systems allows for “efficient cell entry, transport, and expression of their genomes in the nucleus of target cells” (Introduction, paragraph 1). Additionally, Dropulic teaches that integration into the host cell genome allows for transmission to daughter cells and thus the “creation of cell lines with specific genetic modifications that are useful for research and other purposes” (Introduction, paragraph 1). One would have a reasonable expectation of success given that Liu demonstrates successful integration of a promoter-heterologous transgene into a cell which produces stable expression of said transgene (Figure 1).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-6 and 14-15 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 and 14-15 of copending Application No. 17996276 in view of Hartl (Hartl et al., Genome Research 2/1/2019).
Regarding claim 1: The claims of ‘276 teach an isolated nucleic acid molecule which comprises two copies of SEQ ID NO: 3 (same sequence between the instant claims and the ‘276 claims) operably linked to a heterologous transgene.
The claims of ‘276 do not teach that the isolated nucleic acid molecule is more than 220bp or that the CpG O/E ratio is greater than 0.6 in the N base pairs preceding and/or following said two copies of SEQ ID NO: 3. However, CGI promoters of 200 bps with OE ratios of higher than 0.6 are known in the art, as taught by Hartl.
Hartl teaches that mammalian CpG island (CGI) promoters are typically 200bp or longer with an OE ratio of at least 0.6 (Introduction, paragraph 1). Hartl teaches promoters that are 600 base pairs in length with OE greater than 0.6 (Figure 1A and accompanying description).
It would have been prima facie obvious to one having ordinary skill in the art, before the effective filing date of the instant application, to have modified the isolated nucleic acid molecule of ‘276 with a surrounding sequence context of 600 base pairs exhibiting an OE ratio over 0.6. One would be motivated to do so given the teaching by Hartl that CpG density surround binding motifs contributes to binding of transcription factors and in turn affects transcriptional output of the promoters (TF motifs within CpG islands are preferentially bound and CpG density contributes to CGI activity). One would have a reasonable expectation of success given that Hartl demonstrates binding of TF motifs by transcription factors within CGI context, and demonstrates that greater binding occurs within said CGIs when the OE is greater than 0.6.
This obviousness rationale additionally applies to independent claims 4 and 14 of ‘276 given their inclusion of the claim language of claim 1.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KAILEY E CASH whose telephone number is (571)272-0971. The examiner can normally be reached Monday-Friday 8:30am-6pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow can be reached at (571)272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KAILEY ELIZABETH CASH/ Examiner, Art Unit 1683
/STEPHEN T KAPUSHOC/ Primary Examiner, Art Unit 1683