Prosecution Insights
Last updated: April 19, 2026
Application No. 18/255,690

INTERFERING RNAS TARGETING SEVERE ACUTE RESPIRATORY SYNDROME-ASSOCIATED CORONAVIRUS AND USES THEREOF FOR TREATING COVID-19

Non-Final OA §102§103§112
Filed
Jun 02, 2023
Examiner
VIVLEMORE, TRACY ANN
Art Unit
1638
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Oneness Biotech Co. Ltd.
OA Round
1 (Non-Final)
74%
Grant Probability
Favorable
1-2
OA Rounds
2y 10m
To Grant
79%
With Interview

Examiner Intelligence

Grants 74% — above average
74%
Career Allow Rate
524 granted / 713 resolved
+13.5% vs TC avg
Moderate +5% lift
Without
With
+5.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
10 currently pending
Career history
723
Total Applications
across all art units

Statute-Specific Performance

§101
2.8%
-37.2% vs TC avg
§103
31.5%
-8.5% vs TC avg
§102
22.4%
-17.6% vs TC avg
§112
21.5%
-18.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 713 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Objections Claims 24 and 25 are objected to because of the following informalities: Claim 24 recites an siRNA that “comprises a sequence complementary to a genomic site of the SARS-CoV virus, wherein the siRNA is set forth in claim 1.” However, claim 1 only defines the siRNA as targeting a genomic site of a SARS-CoV virus, therefore the reference to claim 1 is redundant. The examiner recommends removing the “wherein” clause referring to claim 1. Claim 25 recites a composition comprising “the small interfering RNA of claim 22”, however claim 22 recites a limitation related to a method. Claim 22 ultimately depends from claim 1, which does recite an siRNA, therefore it would make more sense for claim 25 to refer to claim 1 rather than claim 22. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 12, 16 and 20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. With regard to claims 12 and 16, each of these claims is indefinite because they refer to compounds defined using abbreviations (C6, C8, C6G25S, etc.) that are not defined within the claim itself and don’t appear to be art-recognized terms for a specific compound. These abbreviations seem to be specific siRNAs, which should be identified by SEQ ID NO. With regard to claim 20: A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 20 recites the broad recitation SARS-CoV, and the claim also recites “preferably…SARS-CoV-2” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-11, 13-15, 17-20 and 22-25 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Beigelman et al (US 2022/0380770). All citations below find support in application 63/008,273, filed April 10, 2020. Beigelman et al. teach short interfering nucleic acid (siNA) molecules comprising modified nucleotides, compositions containing the same, and uses thereof for treating or preventing coronavirus infections. The siNA molecules are effective against a broad spectrum of coronaviruses, and especially the β-coronaviruses, including SARS-CoV-2. With regard to claims 1, 17, 19, and 22-24, Beigelman et al. disclose at paragraph 45 methods for treating a disease in a subject in need thereof, comprising administering to the subject a siNA according to any of the embodiments described herein. In some embodiments, the disease is a viral disease caused by a coronavirus, including severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (also known by the provisional name 2019 novel coronavirus, or 2019-nCoV). Beigelman et al. teach at paragraph 104 that the siRNAs can be targeted to the genome of SARS-CoV-2, the nucleotide sequence of which is found at GenBank Accession No. NC_045512.2. At paragraph 52 Beigelman et al. disclose the subject is a human, while paragraph 53 discloses the siNA is administered intravenously, subcutaneously, or via inhalation. With regard to claims 2-11, Beigelman et al. disclose siRNAs targeting SARS-CoV-2 in table 1. The siRNAs include an siRNA targeting nucleotides 14666-14684 of NC_045512.2. SEQ ID NO: 294 is the sense strand CTGTCAAACCCGGTAATTT (corresponding to instant SEQ ID NO: 12 and instant SEQ ID NO: 35 wherein X1 is U) and SEQ ID NO: 1497 is the antisense strand AAATTACCGGGTTTGACAG. Since SEQ ID NO: 294 is a target site within instant SEQ ID NOs: 23 and 24, it is targeting the RdRP mRNA, which the instant specification (see page 12, line 30) designates the POL gene. Beigelman et al. also disclose another antisense strand SEQ ID NO: 3625, AAATTACCGGGTTTGACAGTT (corresponding to instant SEQ ID NO: 52 and instant SEQ ID NO: 36 wherein X2 is A and N1N2 are U). With regard to claims 13-15, Beigelman et al. disclose at paragraph 68 the siNA molecules may comprise modified nucleotides. The modified nucleotides may be selected from 2′-O-methyl nucleotides and 2′-fluoro nucleotides and may comprise 1 or more phosphorothioate internucleoside linkages. With regard to claims 18 and 25, Beigelman et al. disclose at paragraph 63 pharmaceutical compositions comprising the siNA according to any one of the embodiments described herein and a pharmaceutically acceptable carrier or diluent. With regard to claim 20, Beigelman et al. disclose at paragraph 54 that the subject has been treated with one or more additional coronavirus treatment agents. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-11, 13-15 and 17-25 are rejected under 35 U.S.C. 103 as being unpatentable over Beigelman et al. as applied to claims 1-11, 13-15, 17-20 and 22-25 above, and further in view of Dimitrov et al. (US 10,822,379). The teachings of Beigelman et al. are detailed in the previous rejection. Beigelman et al. teach that a subject may be treated with one or more additional coronavirus treatment agents, but do not specifically teach any of the agents in claim 21. Dimitrov et al. teach (see column 2, lines 21-34) compounds such as antibodies, antigen binding fragments, and/or antibody domains that bind to a SARS-CoV-2 antigen. These compounds can be used to treat a mammal (e.g., a human) having COVID-19 (or a viral infection caused by SARS-CoV-2). For example, a subject having COVID-19 (or a viral infection caused by SARS-CoV-2) can be administered a composition comprising one or more of these compounds to reduce the severity and/or the duration of COVID-19 (or the viral infection caused by SARS-CoV-2). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to perform the method of Beigelman et al. in combination with the compounds taught by Dimitrov et al. One of ordinary skill would do so and would expect success because Beigelman et al. specifically teach combining siRNAs with other coronavirus treatment agents and because Dimitrov et al. teach antibody-type compounds that will bind to SARS-CoV-2 and can be used to treat SARS-CoV-2 infections. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Tracy Vivlemore whose telephone number is (571)272-2914. The examiner can normally be reached Mon-Fri 7:30-4:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Dan Sullivan can be reached at 571-272-0900. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Tracy Vivlemore Supervisory Primary Examiner Art Unit 1638 /Tracy Vivlemore/Supervisory Primary Examiner, Art Unit 1638
Read full office action

Prosecution Timeline

Jun 02, 2023
Application Filed
Dec 31, 2025
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12568968
Herbicide Combinations Comprising Glufosinate and Epyrifencacil
2y 5m to grant Granted Mar 10, 2026
Patent 12557815
HERBICIDE COMBINATIONS COMPRISING GLUFOSINATE AND PYRAFLUFEN-ETHYL
2y 5m to grant Granted Feb 24, 2026
Patent 11976092
RNA NANOSTRUCTURES, METHODS OF MAKING, AND USES THEREOF
2y 5m to grant Granted May 07, 2024
Patent 11629349
RNAi Agents for Inhibiting Expression of Xanthine Dehydrogenase (XDH), Pharmaceutical Compositions Thereof, and Methods of Use
2y 5m to grant Granted Apr 18, 2023
Patent 11597927
OLIGONUCLEOTIDE COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Mar 07, 2023
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
74%
Grant Probability
79%
With Interview (+5.4%)
2y 10m
Median Time to Grant
Low
PTA Risk
Based on 713 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month