Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
This application is a 371 of PCT/EP2021/083972
The amendment filed on September 29, 2025 has been entered.
Election/Restrictions
Applicant’s election without traverse of Group I with a species election of (A) leghemoglobin (SEQ ID NO:2) from Vigna subterranean as the Vigna plant leghemoglobin, (B) E. coli as the host cell, and (C) T7 as the promoter the reply filed on September 29, 2025 is acknowledged.
Claims 3-5, 7, and 10-13 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species and invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on September 29, 2025.
Claims 1 and 9 are partially directed to non-elected inventions. For examination purposes, examination is limited to the elected invention, method of producing a leghemoglobin from a Vigna plant or leghemoglobin encoded by SEQ ID NO:1 and fragments thereof.
Status of Claims
Claims 1-13 are pending.
Claims 3-5, 7, and 10-13 are withdrawn.
Claims 1-2, 6, and 8-9 are under examination.
Claim for Foreign Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on March 31, 2024 and June 2, 2023 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - Sequences appearing in the drawings (Figures 19-21 and 48) are not identified by sequence identifiers in accordance with 37 CFR 1.831(c). Sequence identifiers for sequences (i.e., “SEQ ID NO:X” or the like) must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Amended drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers (i.e., “SEQ ID NO:X” or the like) into the Brief Description of the Drawings, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2, 6, and 8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 2, 6, and 8 recite the phrase “preferably”, “more preferably”, and/or “even more preferably”. The phrase renders the claims indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 6, 8, and 9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2111.01 states that ''[d]uring examination, the claims must be interpreted as broadly as their terms reasonably allow.'' In this case, the examiner has broadly interpreted the claims to a method of producing any leghemoglobin from any Vigna plant or any Vigna leghemoglobin encoded by any fragment comprising as little as two nucleic acids of SEQ ID NO:1 by transforming any host cell or E. coli with an expression vector comprising a polynucleotide encoding said any leghemoglobin. Therefore, the claims are drawn to a method of producing a genus of Vigna plant leghemoglobin in a genus of host cells or E. coli.
MPEP 2163 I. states that to “satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention.
MPEP 2163. II.A.3.(a) sates that “Possession may be shown in many ways. For example, possession may be shown by describing an actual reduction to practice of the claimed invention. Possession may also be shown by a clear depiction of the invention in detailed drawings or in structural chemical formulas which permit a person skilled in the art to clearly recognize that inventor had possession of the claimed invention. An adequate written description of the invention may be shown by any description of sufficient, relevant, identifying characteristics so long as a person skilled in the art would recognize that the inventor had possession of the claimed invention.
According to MPEP 2163.II.A.3.(a).ii), “Satisfactory disclosure of a ‘representative number’ depends on whether one of skill in the art would recognize that the applicant was in possession of the necessary common attributes or features possessed by the members of the genus in view of the species disclosed. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus…Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are ‘representative of the full variety or scope of the genus,’ or by the establishment of ‘a reasonable structure-function correlation.’"
The recitation of “leghemoglobin from a Vigna plant” fails to provide a sufficient description of the genus of the polynucleotides and encoded polypeptides as it merely describes the functional features of the genus without providing any definition of the structural features of the species within the genus. The specification does not specifically define any of the species that fall within the genus. The specification does not define any structural features commonly possessed by members of the genus that distinguish them from others. One skilled in the art therefore cannot, as one can do with a fully described genus, visualize or recognize the identity of the members of the genus.
A method of producing a few Vigna leghemoglobins was known in the prior art, such as a method of producing a Vigna unguiculata leghemoglobin by transforming an E. coli host cell with an expression vector comprising a polynucleotide encoding the Vigna unguiculata, see Fraser (WO 2015/038796 - form PTO-1449). However, a method of producing any leghemoglobin from any Vigna plant in any host cell were not known in the art.
Fransceus (J Ind Microbiol Biotechnol. 2017 May;44(4-5):687-695. – form PTO-892) reviews protein engineering techniques, such as random mutagenesis and recombination, directed evolution and iterative or combinatory saturation “hotspots”. Fransceus states that “a recurring problem, however, is choosing which amino acid positions should be targeted. Answering this question is not an easy feat and requires substantial insight in the relationship between an enzyme’s sequence or structure and its properties.” Sanavia (Computational and Structural Biotechnology Journal, Volume 18, 2020, Pages 1968-1979. – form PTO-892) discloses challenges in the prediction of protein stability in the occurrence of multiple mutations. “Multiple-point mutations are common variations of the protein sequence that may be needed in protein engineering when a single-point mutation is not enough to yield the desired stability change. Dealing with multiple-site variations adds another level of complexity beyond the prediction of the effect of a single variant on protein stability, since it requires the learning of many types of combinatorial effects”.
The specification is limited to the description of a method of producing a Vigna subterranean leghemoglobin having the amino acid sequence of SEQ ID NO:2 and encoded by SEQ ID NO:1 by transforming an E. coli host cell with an expression vector comprising a polynucleotide encoding said leghemoglobin. While MPEP 2163 acknowledges that in certain situations “one species adequately supports a genus,” it also acknowledges that “[f]or inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus.” In view of the widely variant species encompassed by the genus, the example described above is not enough and does not constitute a representative number of species to describe the whole genus.
Further, one of skill in the art could identify polynucleotides comprising fragments of SEQ ID NO:1. However, there is no teaching regarding which nucleic acids can vary from SEQ ID NO:1 and result in polypeptide having leghemoglobin activity. An important consideration is that structure is not necessarily a reliable indicator of function. In the instant case, there is no disclosure relating similarity of structure to conservation of function. Conservation of structure is not necessarily a surrogate for conservation of function.
While general knowledge in the art may have allowed one of skill in the art to identify other polynucleotides encoding polypeptides expected to have the same or similar tertiary structure, there was no general knowledge in the art about polynucleotides comprising as little as two nuclei acids of SEQ ID NO:1 and encoding a leghemoglobin.
Given this lack of description of the representative species encompassed by the genus of the claims, the specification fails to sufficiently describe the claimed invention in such full, clear, concise, and exact terms that a skilled artisan would recognize that applicants were in possession of the inventions of claims 1-2, 6, 8, and 9.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1-2, 6, 8, and 9 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Fraser (WO 2015/038796 - form PTO-1449).
Regarding claims 1-2 and 6, Fraser discloses a method of producing a Vigna unguiculata leghemoglobin by (1) transforming an E. coli host cell with an expression vector comprising a polynucleotide encoding the Vigna unguiculata leghemoglobin of SEQ ID NO:17, (2) culturing said host cell, (3) expressing said polynucleotide, and (4) recovering the leghemoglobin ([0009]-[0015], [0018], [0069]-[0092], [0116], [0132]-[0145], and claims 1, 7, 10, 14, 16, 30, and 39)
Regarding claim 8, Fraser discloses regulating the polynucleotide encoding the leghemoglobin with a promoter ([0009], [0015], [0072], and [0078]).
Regarding claim 9, the polynucleotide encoding the leghemoglobin of SEQ ID NO:17 of Fraser comprises a fragment of the polynucleotide of SEQ ID NO:1 of the instant application (see the sequence alignment below).
Therefore, the reference of Fraser anticipates claims 1-2, 6, and 8-9.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-2, 6, and 8-9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Fraser (WO 2015/038796 - form PTO-1449) and Sikorski (Cloning and expression of plant leghemoglobin cDNA of Lupinus luteus in Escherichia coli and purification of the recombinant protein, Plant Science, Volume 108, Issue 1,1995, Pages 109-117 – form PTO-892).
Regarding claims 1-2 and 6, Fraser discloses a method of producing a Vigna unguiculata leghemoglobin by (1) transforming an E. coli host cell with an expression vector comprising a polynucleotide encoding the Vigna unguiculata leghemoglobin of SEQ ID NO:17, (2) culturing said host cell, (3) expressing said polynucleotide, and (4) recovering the leghemoglobin ([0009]-[0015], [0018], [0069]-[0092], [0116], [0132]-[0145], and claims 1, 7, 10, 14, 16, 30, and 39)
Regarding claim 8, Fraser discloses regulating the polynucleotide encoding the leghemoglobin with a promoter ([0009], [0015], [0072], and [0078]).
Regarding claim 9, the polynucleotide encoding the leghemoglobin of SEQ ID NO:17 of Fraser comprises a fragment of the polynucleotide of SEQ ID NO:1 of the instant application (see the sequence alignment below).
Fraser does not disclose using a T7 promoter to regulate the polynucleotide encoding the leghemoglobin. However, use of T7 promoter in regulating expression of a polynucleotide of interest was well known in the art as discussed below.
Regarding claims 1 and 9, Sikorski discloses expression of a polynucleotide encoding a plant leghemoglobin in E. coli, wherein expression of said polynucleotide is under the control of a T7 promoter (abstract). Sikorski also discloses a method of a method of producing a plant leghemoglobin by (1) transforming an E. coli host cell with an expression vector comprising the polynucleotide encoding a plant leghemoglobin of, (2) culturing said host cell, (3) expressing said polynucleotide, and (4) recovering the leghemoglobin (abstract, Sections 2.1-2.6, and 1st full paragraph at page 116).
Therefore, in combing the above references, it would have been obvious to one having ordinary skill in the art before the time the claimed invention was effectively filed to modify the E. coli host cell of Fraser by replacing the promoter with other known promoters, such as the T7 promoter, because one of ordinary skill in the art would have been able to carry out such a substitution, and the results were reasonably predictable. One having ordinary skill in the art would have been motivated to do so in order optimize or improve the expression of the polynucleotide encoding Vigna unguiculata leghemoglobin. One of ordinary skill in the art would have had a reasonable expectation of success since Fraser teaches a method of producing a Vigna leghemoglobin by expressing the polynucleotide encoding said leghemoglobin under the control of a promoter in E. coli and Sikorski teaches a method of producing a plant leghemoglobin by expressing the polynucleotide encoding said hemoglobin under the control of a T7 promoter in E. coli. The rationale to support a conclusion that the claims would have been obvious is that the substitution of one known element (promoter) for another yields predictable results (regulation of the expression of the polynucleotide encoding a plant leghemoglobin) to one of ordinary skill in the art. See MPEP 2143.
Therefore, the above references render claims 1-2, 6, and 8-9 prima facie obvious.
Conclusion
Claims 1-13 are pending.
Claims 3-5, 7, and 10-13 are withdrawn.
Claims 1-2, 6, and 8-9 are rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to YONG D PAK whose telephone number is (571)272-0935. The examiner can normally be reached M-Th: 5:30 am - 3:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached on 408-918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YONG D PAK/Primary Examiner, Art Unit 1652
Sequence alignment between the polynucleotide of SEQ ID NO:1 of the instant application (“Qy”) and the encoded leghemoglobin of Fraser (“Db”)
BBW23593
ID BBW23593 standard; protein; 145 AA.
XX
AC BBW23593;
XX
DT 07-MAY-2015 (first entry)
XX
DE Vigna unguiculata leghemoglobin, SEQ ID 17.
XX
KW food; genetically engineered microorganism; leghemoglobin; meat; plant;
KW protein production; protein secretion; recombinant protein;
KW transgenic plant.
XX
OS Vigna unguiculata.
XX
CC PN WO2015038796-A2.
XX
CC PD 19-MAR-2015.
XX
CC PF 11-SEP-2014; 2014WO-US055227.
XX
PR 11-SEP-2013; 2013US-0876676P.
PR 25-NOV-2013; 2013US-0908689P.
XX
CC PA (IMPO-) IMPOSSIBLE FOODS INC.
XX
CC PI Brown PO, Davis SC, Fraser R;
XX
DR WPI; 2015-193410/24.
XX
CC PT New recombinant bacterium cell, recombinant plant or plant cell, and
CC PT genetically modified organism useful for secreting heme-containing
CC PT polypeptide e.g. androglobin, cytoglobin, globin E and globin X,
CC PT comprises exogenous nucleic acid.
XX
CC PS Claim 7; SEQ ID NO 17; 118pp; English.
XX
CC The present invention relates to a novel recombinant bacterium cell, a
CC recombinant plant or plant cell, and a genetically modified organism
CC capable of secreting a heme-containing polypeptide. The recombinant
CC bacterium cell comprises an exogenous nucleic acid, where the exogenous
CC nucleic acid comprises first and second nucleic acid sequences, the first
CC nucleic acid sequence encodes signal peptide, the second nucleic acid
CC sequence encodes the heme-containing polypeptide, and the first and
CC second nucleic acid sequences are operably linked to produce a fusion
CC polypeptide comprising the signal peptide and the heme-containing
CC polypeptide. Also described are: (1) a method for producing the heme-
CC containing polypeptide; (2) a vector comprising (a) (i) a polynucleotide
CC sequence encoding the heme-containing polypeptide, and (ii) a
CC polynucleotide sequence encoding the signal peptide, or (b) a
CC polynucleotide sequence encoding the heme-containing polypeptide, signal
CC peptide, and a tag; (3) a composition comprising (a) a purified heme-
CC containing polypeptide, and (b) a non-naturally occurring component of
CC recombinant Bacillus cell or the recombinant plant cell other than a
CC Nicotiana plant cell; (4) a genetically modified organism comprising the
CC vector; (5) a method for secreting the heme-containing polypeptide from
CC bacterium; and (6) a purified fusion polypeptide comprising the heme-
CC containing polypeptide, and the tag. The heme-containing polypeptide
CC useful: as a colorant and an indicator for cooking meat; in food
CC consumables; and for enhancing the properties of the meat, such as meat
CC appearance. The present sequence represents a Vigna unguiculata
CC leghemoglobin, used in the method for producing the heme-containing
CC polypeptide.
XX
SQ Sequence 145 AA;
Length: 145
Score: 645.00 Matches: 131
Percent Similarity: 94.4% Conservative: 5
Best Local Similarity: 91.0% Mismatches: 8
Query Match: 84.5% Indels: 0
Gaps: 0
US-18-255-791-1 (1-441) x ATZ23478 (1-145)
Qy 7 GTTGCTTTTTCTGATAAGCAAGAAGCATTGGTTAATGGTTCATGGGAAGCCTTTAAAACT 66
|||||||||||||||||||||||||||||||||||||||::::::||||||||||||
Db 2 ValAlaPheSerAspLysGlnGluAlaLeuValAsnGlyAlaTyrGluAlaPheLysAla 21
Qy 67 AACATCCCAAAGTACTCTGTTGTTTTCTATACTACAATTTTAGAAAAAGCTCCAGCTGCT 126
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 22 AsnIleProLysTyrSerValValPheTyrThrThrIleLeuGluLysAlaProAlaAla 41
Qy 127 AAAAATTTGTTTTCATTTTTGGCAAATGGTGTTGATCCATCAAATCCAAAATTGTTAGCT 186
|||||||||||||||||||||||||||||||||||| :::||||||||||||
Db 42 LysAsnLeuPheSerPheLeuAlaAsnGlyValAspAlaThrAsnProLysLeuThrGly 61
Qy 187 CATGCAGAAAAATTGTTCGGTTTAGTTAGAGATTCTGCTGCACAATTGAGAGCTTCAGGT 246
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 62 HisAlaGluLysLeuPheGlyLeuValArgAspSerAlaAlaGlnLeuArgAlaSerGly 81
Qy 247 ACAGTTGTTGCAGATGCTGCATTAGGTTCTGTTCATTCACAAAAAGCTGTTACTGATGCA 306
||||||||||||||||||||||||:::||||||||||||||||||||| ||||||
Db 82 GlyValValAlaAspAlaAlaLeuGlyAlaValHisSerGlnLysAlaValAsnAspAla 101
Qy 307 CAATTCTTGGTTGTTAAAGAAGCATTGGTTAAGACATTGAAAGAAGCAGTTGGTGACAAA 366
||||||:::|||||||||||||||||||||||||||||||||||||||||||||||||||
Db 102 GlnPheValValValLysGluAlaLeuValLysThrLeuLysGluAlaValGlyAspLys 121
Qy 367 TGGTCAGATGAATTAACTACAGCTGTTGAATTGGCTTATGATGAATTAGCTGTTGCTATT 426
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||
Db 122 TrpSerAspGluLeuGlyThrAlaValGluLeuAlaTyrAspGluLeuAlaAlaAlaIle 141
Qy 427 AAAAAGGCTTAT 438
||||||||||||
Db 142 LysLysAlaTyr 145