DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Application/Amendment/Claims
This Office action is in response to the communications filed on July 29, 2026.
Currently, claims 1, 5-7, 9-17, 19, and 22-24 are pending in the instant application. Claims 22-24 are withdrawn from further consideration as being drawn to a nonelected invention. Accordingly, claims 1, 5-7, 9-17, and 19 are under examination on the merits in the instant application.
The following rejections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application.
Response to Arguments and Amendments
Withdrawn Rejections
Any rejections/objections not repeated in this Office action are hereby withdrawn.
Maintained Objections/Rejections
Priority
The priority benefit denial is maintained for the reasons as set forth in the Office action mailed on April 30, 2026 and for the reasons stated below.
Applicant's arguments filed on July 29, 2026 have been fully considered but they are not persuasive. Applicant argues that the ‘303 provisional application, in particular Table 2 and the sequence listing, explicitly discloses SEQ ID NOs:14-36 thus the priority benefit should be granted to the ‘303 provisional application filing date. In response, it is noted that the instant claims recite “SEQ ID NOs: 14-36 and 100-107”. Applicant did not point out where in the ‘303 provisional application all of the instantly recited SEQ ID NOs including SEQ ID NOs:100-107 are disclosed. Accordingly, the priority benefit denial to the ‘303 application is maintained.
Claim Rejections - Improper Markush Grouping
Claims 1, 5-7, 9-17, and 19 remain rejected on the basis for containing an improper Markush grouping of alternatives for the reasons as set forth in the Office action mailed on April 30, 2026 and for the reasons stated below.
Applicant's arguments filed on July 29, 2026 have been fully considered but they are not persuasive. Applicant argues that the current amendment reciting SEQ ID NOs:14-36 and 100-107 “substantially resolves the improper Markush concern” because the recited SEQ ID NOs “are a defined set of 21-22 nucleotide single-stranded RNA sequences”, which all have “the same structural feature” of the 21-mer antisense with a 3’ UU overhang and “a common use” of upregulating ADAR1p110 expression. In response, it is noted that the alternatively recited antisense oligonucleotide sequences of SEQ ID NOs:14-36 and 100-107 were expressly indicated as being an improper Markush group of alternatives in the last Office action (see page 5), wherein the generic structure pertaining to the length (21-mer) and the 3’ overhang is not sufficient to show that all of the 31 different nucleotide sequences share a significant nucleotide sequence. Note that the SEQ ID NOs are nucleotide sequence identifiers, not the identifiers for the mere length with the 3’-UU overhang sequence. In fact, SEQ ID NO:14 (5’-GCAAGACGACACACACCCAUU) is targeted to SEQ ID NO:3 identified as “Region C” of ADAR1p110, while SEQ ID NO:36 (5’- AUAAGCACUACCCCCUUUGUU) is targeted to SEQ ID NO:1 identified as “Region A” of ADAR1p110, wherein the underlined bases align with each other in the two different sequences, wherein the 7 bases commonly shared by the two different antisense oligonucleotide species do not account for a significant structural feature shared by the two different sequences. As such, the alternatively recited oligonucleotide sequences fail to satisfy both the common nucleotide sequence and the common function that flows from a commonly shared nucleotide sequence. Furthermore, the mere amendment reciting antisense oligonucleotide SEQ ID NOs is not sufficient to address the three different target sequences, SEQ ID NOs:1-3, recited in the instant claims.
Regarding claim 14, applicant argues that the different RNA therapeutics “all share the same function”. In response, the different RNA species in claim 14 do not all share the same or common structure (e.g., coding mRNA vs. non-coding small miRNA) even if all were deemed to share the same function. Hence, the species do not satisfy both the common structure and the common function flowing from the commonly shared structure.
Regarding claim 16, applicant argues that the different species “all share the common structural character of being macromolecular delivery vehicles”. In response, it is unclear what is meant by “the common structural character” as applicant did not clearly elaborate on the alleged “common structural character” shared by all alternatively recited species. The species recited in claim 16 do not all share a common structure as clearly evidenced by the fact that an antibody comprises amino acids, whereas GalNAc does not comprise amino acids.
In view of the foregoing, this rejection is maintained.
Claim Rejections - 35 USC § 112
Claims 1, 5-7, 9-17, and 19 remain rejected under 35 U.S.C. 112(a) as failing to comply with the written description requirement for the reasons as set forth in the Office action mailed on April 30, 2026 and for the reasons stated below.
Applicant's arguments filed on July 29, 2026 have been fully considered but they are not persuasive. Applicant argues that the claims as amended are adequately described because SEQ ID NOs:14-36 and 100-107 “are individually tested and shown to upregulate ADAR1p110 expression in Tables 4a and 4b.” In response, it is noted that the instant claims expressly require that the antisense oligonucleotide sequence comprising one of SEQ ID NOs:14-36 and 100-107 “is complementary to 21 to 22 nucleotides in a target sequence within SEQ ID NOs: 1, 2, or 3”. As expressly noted in the last Office action, all of the species of SEQ ID NOs:14-36 and 100-107 are complementary to only a 19-mer sequence within the recited target sequences. Hence, the instant specification does not describe that SEQ ID NOs:14-36 and 100-107, which are now recited in all claims, are “complementary to 21 to 22 nucleotides in a target sequence within SEQ ID NOs: 1, 2, or 3”. In addition, as noted in the last Office action, the instant specification at best describes single-stranded aRNAs of SEQ ID NOs:14-36 and 100-107, not dsRNAs comprising the recited SEQ ID NOs and a sense strand sequence as encompassed by the instant claims including claim 19 and as expressly required by claim 5 for instance, wherein the dsRNAs as currently written read on an asymmetric structure as the antisense strand is now claimed to be “21 to 22 nucleotides in length”, whereas the sense strand is “approximately 19 to approximately 30 nucleotides.” Applicant did not provide any persuasive rebuttal arguments as to why Tables 4a and 4b support the required structure-function correlation for the claims as currently broadly written.
In view of the foregoing, this rejection is maintained.
New Rejections Necessitated by Amendment
Claim Rejections - 35 USC § 112
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1, 5-7, and 9-17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1, 5-7, and 9-17 require that the antisense oligonucleotide of one of SEQ ID NOs:14-36 and 100-107 should be “complementary to 21 to 22 nucleotides in a target sequence”. It is noted that the 21-mer sequences are complementary to only 19 nucleotides in the recited target sequence. Hence, the claims recite structurally conflicting limitations pertaining to the antisense oligonucleotide, thereby rendering the claims indefinite.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 6-7 and 10-11 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claims 6-7 recite that the 21-22 nucleotide-long antisense oligonucleotide of one of SEQ ID NOs:14-36 and 100-107 “is at least 80% complementary to a target sequence.” It is noted that an oligonucleotide of “21-22 nucleotides in length” comprising one of SEQ ID NOs:14-36 and 100-107 cannot have the 80% complementarity level. That is, the recited antisense oligonucleotide SEQ ID NOs can only have about 86% or 90% sequence complementarity with the recited target. Hence, the “at least 80%” limitation broadens the scope of the antisense oligonucleotide sequence requirement, thereby failing to further limit the subject matter of claim 1.
Claim 7 recites that SEQ ID NOs:14-36 and 100-107 are at least 80% complementary to a target sequence “within -3000 to +150 nucleotides of the ADAR target sequence transcription start site.” It is noted that none of the recited antisense oligonucleotide sequences is targeted to a position of -3000 or +150. In fact, all of the recited oligonucleotide sequences are targeted upstream (- positions) that is nowhere near the recited “-3000”. Hence, claim 7 fails to further limit the subject matter of claim 1.
Claim 10 recites that the antisense oligonucleotide sequence is about 19-30 nucleotides in length. This limitation broadens the length limitation of 21-22 nucleotides in length as currently amended, thereby failing to further limit the subject matter of claim 1.
Claim 11 recites that the antisense oligonucleotide is 21 or 22 nucleotides in length. This limitation is already recited in claim 1 as currently amended, from which claim 11 depends by virtue of claim dependency. Hence, claim 11 pertaining to the antisense oligonucleotide fails to further limit the subject matter of claim 1.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DANA H SHIN whose telephone number is (571)272-8008. The examiner can normally be reached Monday-Thursday: 8am - 6:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, RAM SHUKLA can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DANA H SHIN/Primary Examiner, Art Unit 1635
