Prosecution Insights
Last updated: April 19, 2026
Application No. 18/258,943

IMMUNOGENIC FORMULATION CONTAINING ONE OR MORE MODIFIED BCG STRAINS EXPRESSING A SARS-CoV-2 PROTEIN, USEFUL FOR PREVENTING, TREATING, OR ATTENUATING THE DEVELOPMENT OF COVID-19

Non-Final OA §101§103§112
Filed
Jun 22, 2023
Examiner
BOESEN, AGNIESZKA
Art Unit
1672
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Fundacion Copec Universidad Católica
OA Round
1 (Non-Final)
68%
Grant Probability
Favorable
1-2
OA Rounds
3y 4m
To Grant
90%
With Interview

Examiner Intelligence

Grants 68% — above average
68%
Career Allow Rate
555 granted / 816 resolved
+8.0% vs TC avg
Strong +22% interview lift
Without
With
+22.5%
Interview Lift
resolved cases with interview
Typical timeline
3y 4m
Avg Prosecution
31 currently pending
Career history
847
Total Applications
across all art units

Statute-Specific Performance

§101
6.9%
-33.1% vs TC avg
§103
31.6%
-8.4% vs TC avg
§102
20.7%
-19.3% vs TC avg
§112
21.3%
-18.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 816 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s preliminary amendment filed on June 22, 2023 is acknowledged. Claims 1-17 are pending and under examination in this Office action. Information Disclosure Statement The information disclosure statement (IDS) submitted on June 22, 2023 has been considered by the examiner. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 15-17 are rejected under 35 U.S.C. § 101 because the claimed invention is directed toward non-statutory subject matter. The claimed recitation of a use, without setting forth any steps involved in the process, results in an improper definition of a process, i.e., results in a claim which is not a proper process claim under 35 U.S.C. 101. Refer to M.P.E.P. § 2173.05(q). See for example Ex parte Dunki, 153 U.S.P.Q. 678 (Bd. App. 1967) and Clinical Products Ltd. v. Brenner, 255 F.Supp. 131, 149 U.S.P.Q. 475 (D.D.C. 1966). Claim 15. Use of the immunogenic formulation according to claim 1 wherein it serves to prepare a vaccine to prevent, treat, or attenuate SARS-CoV-2 infections and/or the development of COVID-19 disease, wherein said formulation contains between 1x104-1x109 colony forming units of the recombinant attenuated strain of Mycobacterium bovis BCG stabilized with a physiologically acceptable saline solution. Claim 16. Use according to claim 15 wherein it serves to prepare a vaccine to prevent, treat, or attenuate infections of SARS-CoV-2 and/or the development of COVID-19, to be administered subcutaneously, percutaneously or subdermally in physiologically acceptable saline. Claim 17. Use according to claim 16 wherein the vaccine to prevent, treat, or attenuate SARS-CoV-2 infections and/or the development of COVID-19, is administered in a first application, which can be followed by a booster containing: A formulation of the attenuated recombinant strain of Mycobacterium bovis Bacillus Calmette- Guerin (BCG), in an amount between 104-109 CFU per dose, which expresses at least one protein or immunogenic fragment of the SARS-CoV-2 virus; or an immunogenic formulation of inactivated SARS-CoV-2 virus; or an immunogenic formulation of purified SARS-CoV-2 viral subunits; or an immunogenic formulation with peptide immunogenic fragments of SARS-CoV-2; or an immunogenic formulation of SARS-CoV-2 DNA vaccine; or an immunogenic formulation with RNA vaccine for SARS-CoV-2. The claims are rejected because they fail to recite method/process steps that describe how the method is to be performed. Applicant is required to recite active method steps required to carry out the claimed invention. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 15-17 are rejected under 35 U.S.C. § 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, regards as the invention. Claims are drawn to: Claim 15. Use of the immunogenic formulation according to claim 1 wherein it serves to prepare a vaccine to prevent, treat, or attenuate SARS-CoV-2 infections and/or the development of COVID-19 disease, wherein said formulation contains between 1x104-1x109 colony forming units of the recombinant attenuated strain of Mycobacterium bovis BCG stabilized with a physiologically acceptable saline solution. Claim 16. Use according to claim 15 wherein it serves to prepare a vaccine to prevent, treat, or attenuate infections of SARS-CoV-2 and/or the development of COVID-19, to be administered subcutaneously, percutaneously or subdermally in physiologically acceptable saline. Claim 17. Use according to claim 16 wherein the vaccine to prevent, treat, or attenuate SARS-CoV-2 infections and/or the development of COVID-19, is administered in a first application, which can be followed by a booster containing: A formulation of the attenuated recombinant strain of Mycobacterium bovis Bacillus Calmette- Guerin (BCG), in an amount between 104-109 CFU per dose, which expresses at least one protein or immunogenic fragment of the SARS-CoV-2 virus; or an immunogenic formulation of inactivated SARS-CoV-2 virus; or an immunogenic formulation of purified SARS-CoV-2 viral subunits; or an immunogenic formulation with peptide immunogenic fragments of SARS-CoV-2; or an immunogenic formulation of SARS-CoV-2 DNA vaccine; or an immunogenic formulation with RNA vaccine for SARS-CoV-2. Two separate requirements are set forth under this statute: (1) the claims must set forth the subject matter that applicants regard as their invention; and (2) the claims must particularly point out and distinctly define the metes and bounds of the subject matter that will be protected by the patent grant. The claims contain improper process language and fail to set forth those steps involved in the process. Refer to M.P.E.P. ' 2173.05(q). Ex parte Erlich, 3 U.S.P.Q.2d 1011 (Bd. Pat. App. & Inter. 1986). In the present case the claims recite “use” of a composition without setting any active method steps required to carry out the claimed invention. The claims are rejected because they fail to clearly define the process or method claimed, including the specific steps that describe how the process or method is to be performed. Applicant is required to amend the claims to recite the method of using the claimed product and the active method steps necessary to carry out the claimed invention. Additionally, Applicant is required to recite a correct grammatical form following the recitation of “wherein”. Correction is required. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1-2 and 15-17 are rejected under 35 U.S.C. 103 as being unpatentable over de Queiroz et al. (Microbes and Infection, September 2020, p. 515-524 in IDS on 6/22/2023) in view of Brosch et al. (US Patent 10,010,597). Regarding claims 1 and 15-17. De Queiroz et al. teach an immunogenic formulation conferring protection against COVID-19 comprising s at least one attenuated recombinant strain of Mycobacterium bovis Bacillus Calmette-Guerin (BCG), which expresses at least one protein or immunogenic fragment of the SARS-CoV-2 virus, and methods of inducing an immune response against COVID-19 in a subject (see Figure 1, pages 519-522). De Queiroz does not teach an amount between 104-109 CFU per dose or saline. Brosch et al. teach recombinant Mycobacterium bovis (BCG) expressing heterologous bacterial antigens wherein the dose of the BCG is 106 CFU (see Figures 17-19 and 22 and figure descriptions and Materials and Methods). It would have been prima facie obvious to provide the composition of De Queiroz, wherein the recombinant Mycobacterium bovis (BCG) expressing SARS-CoV-2 antigen is at the dose of the BCG is 106 CFU, because this particular dosage has been taught in the prior art by Brosch et al. It would have been prima facie obvious to provide the composition of De Queiroz, and Brosch et al. further comprising pharmaceutically acceptable carriers such as saline (see column 23). Regarding present claim 2. De Queiroz et al. teach SARS-Cov-2 spike protein (see page 524). Thus, the claimed invention would have been prima facie obvious at the time the invention was made. Claims 3-14 are rejected under 35 U.S.C. 103 as being unpatentable over de Queiroz et al. (Microbes and Infection, September 2020, p. 515-524 in IDS on 6/22/2023) in view of Brosch et al. (US Patent 10,010,597), as applied to claim 1 and further in view of Kana et al. (US Patent 11,713,491) and Anderson et al. (US Patent 11,253,587). De Quieroz and Brosch teach the claimed invention as discussed above. They do not teach present SEQ ID NO: 1, 2, 3 or 4. Regarding claims 3-7 and 13. Kana et al. teach diagnostic compositions comprising SARS-CoV-2 comprising a nucleic acid sequence having 99.3% identity with present SEQ ID NO: 1 (see sequence alignment below and SEQ ID NO: 28 in Kana). Kana et al. teach Mycobacterium smegmatis transformed using a plasmid comprising SARS-CoV-2 antigens (see Examples 1-3). Since Kana teaches SARS-CoV-2 N, they teach rBCG-N-SARS-CoV-2 of present claim 13. Regarding claims 3-7 and 13. Anderson et al. teach compositions comprising SARS-CoV-2 comprising a nucleic acid sequence having 99.7% identity with present SEQ ID NO: 4 (see sequence alignment below and SEQ ID NO: 26 in Anderson and claims 1-20). Since Anderson teaches SARS-CoV Spike protein, they teach rBCG-S-SARS-CoV-2 of present claim 13. It would have been prima facie obvious to provide the composition of De Queiroz, and Brosch comprising Kana’s nucleotide having 99.8% identity with present SEQ ID NO: 1 and/or Anderson’s nucleotide having 99.7 % identity with present SEQ ID NO: 4, because Kana et al. and Anderson et al, teach using their SARS-CoV-2 nucleotides in immunogenic compositions against COVID-19 (see Examples 1-3 in Kana and claims 1-20 in Anderson). Regarding claims 8-9. Kana et al. teach expression of the genes by endogenous or exogenous promoters of Mycobacterium, constitutive or inducible and the N, E, M or S proteins of SARS-CoV-2 expressed by BCG in a soluble-cytoplasmic way, secreted extracellularly or as proteins bound to cell membrane (see Examples 1-3). Regarding claims 10-11. Anderson et al. teach pharmaceutical compositions. provided as powders (e.g. lyophilized and/or sterilized), optionally under vacuum, which are reconstituted with an aqueous diluent (e.g., water, buffer, salt solution, etc.) prior to injection. In some embodiments, pharmaceutical compositions are diluted and/or reconstituted in water, sodium chloride solution, sodium acetate solution, benzyl alcohol solution, phosphate buffered saline, etc. In some embodiments, powder should be mixed gently with the aqueous diluent (see column 66, lines 45-62). It would have been obvious to lyophilize the composition of De Queiroz, and Brosch because those storage methods have been known in the prior art as taught by Anderson et al. Regarding claim 12. De Quieroz teaches Danish and Pasteur BCG strain (see page 521, left column). In view of the teaching above, the present claims would have been prima facie obvious at the time of the present invention. Present SEQ ID NO: 1 and SEQ ID NO: 28 in Kana Query Match 99.3%; Score 1263.2; Length 3172; Best Local Similarity 99.8%; Matches 1265; Conservative 0; Mismatches 3; Indels 0; Gaps 0; Qy 5 AAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGAC 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1593 AAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGAC 1652 Qy 65 CCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAAC 124 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1653 CCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAAC 1712 Qy 125 GTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATG 184 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1713 GTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATG 1772 Qy 185 GCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTC 244 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1773 GCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTC 1832 Qy 245 CAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTA 304 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1833 CAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTA 1892 Qy 305 AAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTG 364 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1893 AAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTG 1952 Qy 365 GACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGA 424 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1953 GACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGA 2012 Qy 425 ATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTAC 484 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2013 ATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTAC 2072 Qy 485 AACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCA 544 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2073 AACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCA 2132 Qy 545 GTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAG 604 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2133 GTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAG 2192 Qy 605 GCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTG 664 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2193 GCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTG 2252 Qy 665 CTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAAC 724 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2253 CTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAAC 2312 Qy 725 AACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGC 784 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2313 AACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGC 2372 Qy 785 AAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAG 844 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2373 AAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAG 2432 Qy 845 AACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAAC 904 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2433 AACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAAC 2492 Qy 905 ATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCA 964 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2493 ATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCA 2552 Qy 965 TTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGG 1024 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2553 TTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGG 2612 Qy 1025 ATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCAT 1084 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2613 ATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCAT 2672 Qy 1085 ACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTC 1144 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2673 ACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTC 2732 Qy 1145 AAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATT 1204 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2733 AAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATT 2792 Qy 1205 TGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCT 1264 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2793 TGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCT 2852 Qy 1265 AAATCGAT 1272 ||| || Db 2853 AAACTCAT 2860 Present SEQ ID NO: 4 and SEQ ID NO: 26 in Anderson Query Match 99.7%; Score 3640.4; Length 3819; Best Local Similarity 99.9%; Matches 3641; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 7 ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACC 66 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 28 ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACC 87 Qy 67 AGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGAC 126 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 88 AGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGAC 147 Qy 127 AAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCC 186 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 148 AAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCC 207 Qy 187 AATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGAT 246 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 208 AATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGAT 267 Qy 247 AACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATA 306 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 268 AACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATA 327 Qy 307 ATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTT 366 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 328 ATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTT 387 Qy 367 AATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTT 426 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 388 AATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTT 447 Qy 427 TTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTAT 486 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 448 TTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTAT 507 Qy 487 TCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAA 546 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 508 TCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAA 567 Qy 547 GGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTAT 606 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 568 GGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTAT 627 Qy 607 TTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTT 666 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 628 TTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTT 687 Qy 667 TCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACT 726 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 688 TCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACT 747 Qy 727 TTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCT 786 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 748 TTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCT 807 Qy 787 GGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAAT 846 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 808 GGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAAT 867 Qy 847 GAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAG 906 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 868 GAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAG 927 Qy 907 TGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTC 966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 928 TGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTC 987 Qy 967 CAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAA 1026 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 988 CAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAA 1047 Qy 1027 GTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAAC 1086 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1048 GTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAAC 1107 Qy 1087 TGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTAT 1146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1108 TGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTAT 1167 Qy 1147 GGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTT 1206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1168 GGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTT 1227 Qy 1207 GTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGAT 1266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1228 GTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGAT 1287 Qy 1267 TATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAAT 1326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1288 TATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAAT 1347 Qy 1327 CTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAAT 1386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1348 CTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAAT 1407 Qy 1387 CTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGT 1446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1408 CTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGT 1467 Qy 1447 AATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACT 1506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1468 AATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACT 1527 Qy 1507 AATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCA 1566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1528 AATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCA 1587 Qy 1567 CCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAAT 1626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1588 CCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAAT 1647 Qy 1627 TTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTG 1686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1648 TTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTG 1707 Qy 1687 CCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAG 1746 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1708 CCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAG 1767 Qy 1747 ACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCA 1806 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1768 ACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCA 1827 Qy 1807 GGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTC 1866 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1828 GGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTC 1887 Qy 1867 CCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCT 1926 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1888 CCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCT 1947 Qy 1927 AATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATAT 1986 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1948 AATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATAT 2007 Qy 1987 GAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCT 2046 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2008 GAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCT 2067 Qy 2047 CCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGT 2106 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2068 CCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGT 2127 Qy 2107 GCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATT 2166 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2128 GCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATT 2187 Qy 2167 AGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATG 2226 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2188 AGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATG 2247 Qy 2227 TACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGT 2286 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2248 TACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGT 2307 Qy 2287 ACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAA 2346 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2308 ACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAA 2367 Qy 2347 GTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTT 2406 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2368 GTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTT 2427 Qy 2407 AATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGAT 2466 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2428 AATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGAT 2487 Qy 2467 CTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGC 2526 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2488 CTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGC 2547 Qy 2527 CTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTT 2586 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2548 CTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTT 2607 Qy 2587 TTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGT 2646 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2608 TTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGT 2667 Qy 2647 ACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATG 2706 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2668 ACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATG 2727 Qy 2707 CAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAA 2766 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2728 CAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAA 2787 Qy 2767 AAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCC 2826 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2788 AAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCC 2847 Qy 2827 ACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAAC 2886 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2848 ACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAAC 2907 Qy 2887 ACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATC 2946 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2908 ACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATC 2967 Qy 2947 CTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGA 3006 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2968 CTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGA 3027 Qy 3007 CTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCT 3066 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3028 CTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCT 3087 Qy 3067 TCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTT 3126 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3088 TCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTT 3147 Qy 3127 GATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTCAGTCAGCACCTCATGGTGTA 3186 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3148 GATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTCAGTCAGCACCTCATGGTGTA 3207 Qy 3187 GTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCC 3246 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3208 GTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCC 3267 Qy 3247 ATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACA 3306 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3268 ATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACA 3327 Qy 3307 CACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACA 3366 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3328 CACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACA 3387 Qy 3367 TTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCT 3426 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3388 TTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCT 3447 Qy 3427 TTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACA 3486 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3448 TTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACA 3507 Qy 3487 TCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAA 3546 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3508 TCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAA 3567 Qy 3547 AAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTC 3606 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3568 AAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTC 3627 Qy 3607 CAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCACTT 3648 ||||||||||||||||||||||||||||||||||||||| || Db 3628 CAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCATTT 3669 Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to AGNIESZKA BOESEN whose telephone number is (571)272-8035. The examiner can normally be reached on 8:30 - 5:00 PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas Visone can be reached on 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AGNIESZKA BOESEN/Primary Examiner, Art Unit 1648
Read full office action

Prosecution Timeline

Jun 22, 2023
Application Filed
Jan 08, 2026
Non-Final Rejection — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599660
THERAPEUTIC RNA FOR HPV-POSITIVE CANCER
2y 5m to grant Granted Apr 14, 2026
Patent 12589143
HUMAN ANTI-PD-L1 PEPTIDE VACCINES AND METHODS OF THEIR USE
2y 5m to grant Granted Mar 31, 2026
Patent 12569553
SHINGLES VACCINES COMPRISING A TLR9 AGONIST
2y 5m to grant Granted Mar 10, 2026
Patent 12552854
PEPTIDES THAT BLOCK PRESENTATION OF ANTIGENIC ISLET PEPTIDES BY HLA-DQ8 AND METHODS FOR TREATING TYPE-1 DIABETES
2y 5m to grant Granted Feb 17, 2026
Patent 12551550
COMPOSITIONS AND VACCINES FOR TREATING AND/OR PREVENTING CORONAVIRUS VARIANT INFECTIONS AND METHODS OF USING THE SAME
2y 5m to grant Granted Feb 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
68%
Grant Probability
90%
With Interview (+22.5%)
3y 4m
Median Time to Grant
Low
PTA Risk
Based on 816 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month