DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1-7, 9-12, 14-19, 21-22, 24 and 26-27 are pending.
Claim 22 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim.
Claims 1-7, 9-12, 14-19, 21, 24 and 26-27 are examined herein.
Previously, Examiner was unable to interpret the scope of claim 24. Claim 24 was drawn to the method of claim 9. However, claim 9 was drawn to a seed obtained from the plant of claim 1. Neither claim 9 nor claim 1 recite any active method steps but are instead drawn to products. As the metes and bounds of claim 24 could not be determined, Examiner was unable to assess if claim 24 was free of the prior art. In light of Applicant’s amendment of claim 24 to change the dependency to claim 10, claim 24 has now been fully examined.
Status of the claims
All rejections of claims 11-12 are moot in light of Applicant’s cancellation of the claims.
The rejection of claims 3 and 5 under 35 U.S.C. 101 has been withdrawn in light of Applicant’s amendment of the claims. Regarding claim 5, Examiner notes that the claim requires that mutation is either in a UPL2 promoter or results in a non-functional HECT domain and the mutation is in the Glu/Asp rich domain.
The rejection of claims 1, 2, 6, and 9 under 35 U.S.C. 102(a)(2) as being anticipated by Furniss et al 2018 (PLoS Pathology 14(11):e1007447) taken with the evidence of Alonso et al (2003, Science 301: pages 653-656; Supporting online material) and Downes et al (2003, The Plant Journal 35: 729-742) is withdrawn in light of Applicant’s amendment of the claims.
The rejection of claims 1, 5, 6, and 9 under 35 U.S.C. 102(a)(2) as being anticipated by UniProt Accession A0A2T7EGM1 (2018, uniprot.org/uniprotkb/A0A2T7EGM1/entry) taken with the evidence of Huang et al, 2021, The Plant Cell 33: 1212-1228 and Applicant’s admission in the instant specification is withdrawn in light of Applicant’s amendment of the claims.
Claim Interpretation
Claims 1 recites the limitation “A plant, plant part or plant cell, wherein the plant, plant part or plant cell being genetically altered to comprise at least one mutation in at least…”. This is grammatically incorrect and renders the claim indefinite (see 35 U.S.C. 112(b) rejection below). Examiner has interpreted this imitation to mean “A plant, plant part or plant cell, wherein the plant, plant part or plant cell has been genetically altered to comprise at least one mutation in at least…”.
Claim 1 recites the limitation “at least one mutation in at least one UPL2 gene encoding E3 ubiquitin ligase comprising a HECT domain and/or in a promoter of the at least one UPL2 gene and wherein the mutation results in a non-functional HECT domain in comparison to a control plant that does not comprise the mutation.” It is completely unclear how a modification in a promoter would result in a “non-functional HECT domain” as the promoter does not comprise a HECT domain. In light of this, the limitation regarding a mutation that results in a non-functional HECT domain is interpreted to have two different claim scopes; 1) the limitation regarding a non-functional HECT domain only applies when the mutation recited in claim 1 is in a UPL2 gene encoding E3 ubiquitin ligase comprising a HECT domain or 2) it applies when the mutation is in either a UPL2 gene or a UPL2 promoter.
Claim 21 recites “A plant, plant part or plant cell obtained by the method of claim 10, wherein the plant, plant part or plant cell being genetically modified and contains the at least one mutation”. This is grammatically incorrect and renders the claim indefinite (see 35 U.S.C. 112(b) rejection below). Examiner has interpreted this imitation to mean “A plant, plant part or plant cell obtained by the method of claim 10, wherein the plant, plant part or plant cell has been genetically modified and contains the at least one mutation”.
Claim objections
The following claim objections are raised in light of Applicant’s amendment of the claims.
Claim 1 is objected to because of the following informalities: the claim recites “A plant, plant part or plant cell, wherein the plant, plant part or plant cell being genetically altered to comprise at least one mutation in at least…”. This is grammatically incorrect. Appropriate correction is required.
Claim 21 is objected to because of the following informalities: the claim recites “A plant, plant part or plant cell obtained by the method of claim 10, wherein the plant, plant part or plant cell being genetically modified and contains the at least one mutation”. This is grammatically incorrect. Appropriate correction is required.
Claim 27 is objected to because of the following informalities: claim 27 is drawn to the “plant of claim 19”. However, claim 19 is a method claim. Please amend claim 27 to recite “The method of claim 19”. Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefore, subject to the conditions and requirements of this title.
Claims 1-2, 6, 7, 9, and 21 remain rejected and claim 26 is rejected under 35 U.S.C. 101 because the claimed invention is directed to a product of nature (i.e. natural phenomenon) without significantly more. This rejection has been slightly modified from the rejection set forth in the previous Office action in light of Applicant’s. Applicant’s arguments have been fully considered but are not found persuasive.
Claims 1-2, 6, 7, and 9 are drawn to “a genetically altered plant” comprising at least one mutation in at least one UPL2 promoter (claim 1), wherein the mutation is a loss of function or partial loss of function (claim 2), wherein the UPL2 promoter comprises or consists of SEQ ID NO: 3 or a functional variant or homologue thereof (6), wherein the plant is crop plant (claim 7) and wherein the crop plant is rice (claim 26), and a seed obtained from the plant of claim 1 (claim 9).
Examiner notes that claim 1 is a “product by process” claim (see MPEP 2113). Thus, while claim 1 is drawn to a plant that is “genetically modified” (see Claim Interpretation above), the claim is interpreted to read on any plant comprising any mutation in a UPL2 promoter, including both naturally occurring mutations and mutations induced, for example, by chemical mutagenesis or genome editing.
Claim 21 is drawn to a plant obtained by the method of claim 10 where in the plant is “genetically modified”. This claim is a “product by process claim” (see MPEP 2113). Therefore, claim is interpreted to read on any plant comprising any mutation in a UPL2 promoter that leads to a decrease or loss of expression of a UPL2 nucleic acid or reduction in activity of a UPL2 polypeptide, including those which are naturally occurring.
By Applicant’s own admission, nearly all indica varieties have a naturally occurring 2.6kb deletion in in the OsUPL2 gene promoter region. Applicant further notes that indica varieties have increased panicle size (i.e. yield) relative to japonica varieties. Applicant further states “Without being bound by theory, it is possible that during evolution, the natural variation in the OsUPL2 promoter (i.e. deletion of 2.6kp sequence) might lead to changes in panicle size between indica and japonica varieties through changing UPL2 expression levels” (see instant specification, page 61, “Example 9”, lines 12-21).
Therefore, the claims read on an indica rice variety that inherently comprises the claimed promoter deletion. While claim 1 recites the term “genetically altered”, as these claims are drawn to products, such a limitation constitutes a “product-by-process”, and the patentability of the claim must be considered based on the structure of the claimed product unless there is persuasive evidence that the process by which it is made would confer some structural difference. In the instant case, there would be no way to tell the difference between a plant that had undergone gene editing by Crispr, for example, and a plant with a naturally occurring mutation.
This judicial exception is not integrated into a practical application because the claims, in their entirety, read on a naturally occurring indica rice variety. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because they do not recite any additional elements that encompass more than a naturally occurring indica rice variety.
Response to Applicant’s Arguments filed on 5 June 2026
Applicant argues that claim 1 is not a product-by-process claim because “being genetically altered” is a structural feature defining a man-made product. Applicant further argues that if claim Applicant has not addressed any arguments to claim 21. This is not found persuasive.
The limitation “being genetically altered” or “being genetically modified” reflects the result of a process, i.e. genetic alteration or modification. Therefore, as explained above, the claims are “product-by-process” claims. Next, one must consider the structure implied by the process steps. In the instant case, there would be no distinctive structural characteristics imparted to a plant which has been genetically altered or modified relative to a plant which comprises the same alteration or modification naturally. Applicant has not provided any evidence that there would be any structural differences between the instantly claimed plants which have been modified by the hand-of-man and plants which comprises the same modifications naturally.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 1-7, 9-10, 14-17, 19, 21, 24 remain rejected and claims 26-27 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in rejections. The rejection has been modified from the rejection set forth in the previous Office action in light of Applicant’s amendment of the claims. New grounds of rejection, noted below, have been raised in response to Applicant’s claim amendments. Applicant’s arguments have been fully considered but are not found persuasive for the grounds of rejection that are maintained from the previous Office action. Examiner notes that Applicant’s amendments have overcome the previous grounds of rejection that are not included in the 35 U.S.C. 112(b) rejection set forth below.
Claims 1, 10, and 17 are indefinite in their recitation of “UPL2”. It is not clear which genes and promoters are encompassed by the terms “UPL2 gene” and “UPL2 promoter”. Applicant states that UPL2 may be referred to as LARGE2, such terms may be used interchangeably and that “LARGE2 encodes a E3 ubiquitin ligase (UPL2)” (instant specification page 10, lines 18-20). In the art, “UPL” is typically used to refer to HECT-type (i.e. HECT domain containing) E3 ubiquitin ligases. However, the designation of UPL1, UPL2, UPL3 does not appear to have a consistent usage. Downes et al (2003, The Plant Journal 35: 729-742) describes UPL1-7 from Arabidopsis and associated domains (page 731, Figure 1). However, it does not appear that this nomenclature and domain architecture is consistently applied or even appropriate across all plants. For example, Li et al (2019, Genetica 147:391-400), discloses that maize comprises 12 UPL genes, divided into 6 groups, similar to other studies (page 393, column 2, “Identification of maize UPL genes”; Figure 1; Table 2; page 397, column 2, paragraphs 1-2). Their phylogenic analysis places UPL2 from Arabidopsis in a clade with maize UPL3, 9 and 12 in “Group 1” while maize UPL2 clusters with Arabidopsis UPL3, among others, in “Group V”. Xu et al (2016, Molecular Genetics and Genomics 291:635-646) discloses that there are 13 UPL genes in apple (Malus domestica); apple UPL2 clusters with Arabidopsis UPL4 while Arabidopsis UPL2 clusters with apple UPL1 and UPL8 (page 638, columns 1-2, bridging paragraph; Figure 1; Table 1). Applicant states that the E3 ubiquitin ligase UPL2 is characterized by conserved domains: DUF908, DUF913, UBA, DUF4414, AND HECT (instant specification page 15, lines 8-10). Meng et al (2015, International Journal of Molecular Science 16: 8517-8535) discloses that two groupings of soybean HECT type E3 ubiquitin ligases comprise this combination of domains; both Arabidopsis UPL1 and UPL2 occur in the same grouping (Figure 2 and 4). Finally, in instant Table 1, Applicant describes homologs of UPL2 and includes instant SEQ ID NO: 26 as a UPL2 homolog from Brassica napus. However, a BLAST search of SEQ ID NO:26 returns an alignment to a Brassica napus UPL1 with over 99% sequence identity (NCBI Accession number XM_009149223, 2020, ncbi.nlm.nih.gov/nucleotide/XM_009149223.3; the alignment is over 10 pages long, so is not included here beyond the header but is available upon request:
>PREDICTED: Brassica rapa E3 ubiquitin-protein ligase UPL1 (LOC103871016), transcript variant X1, mRNA
Sequence ID: XM_009149223.3 Length: 11421
Range 1: 213 to 11177
Score:20238 bits(10959), Expect:0.0,
Identities:10963/10965(99%), Gaps:0/10965(0%), Strand: Plus/Plus
Thus, the meaning of the term UPL2 is not clear and appears subject to change. It is not clear if UPL2, as recited by applicant, refers to the UPL2 gene from rice (i.e. instant SEQ ID NO: 2), the homologs of UPL2 gene from rice recited in the instant Table 1, any gene referred to as a UPL2 in the prior art, or something altogether different. Therefore, the metes and bounds of claims 1, 4, 10-12, 15, and 17 are not clear.
Claims 2-5, 7, 9, 14-16, 19, 21, 24 and 26-27, which depend from claims 1, 10, and 17, do not recite any limitations which clarify the metes and bounds of the claim from which the depend and are thus rejected on the same ground.
Response to Applicant’s Arguments filed on 5 June 2026
Applicant argues that the specification provides an unambiguous definition of the UPL2 gene and that the incorporation into claims 1 and 10 of limitations from claims 4 and 11, respectively, drawn to “UPL2 gene encoding E3 ubiquitin ligase comprising a HECT domain” and “wherein the mutation results in a non-functional domain HECT domain” overcome the rejection. This is not found persuasive.
As explained above in the rejection, “UPL2” is not the only E3 ubiquitin ligase comprising a HECT domain, but rather this appears to be characteristic of many different “UPL” ligases. As also explained above, the designation of UPL1, UPL2, UPL3 does not appear to have a consistent usage. Thus, the term “UPL2” does not have a consistent usage in the art across different species and thus a “UPL2” in one plant may be a different “UPL” in another plant. Furthermore, examiner notes that claims 4 and 11 were rejected in the previous 35 U.S.C. 112(b) rejection of the claims on the same grounds. Therefore, one should not expect that importing these limitations into the independent claims would overcome said rejection.
Claims 1 recites “A plant, plant part or plant cell, wherein the plant, plant part or plant cell being genetically altered to comprise at least one mutation in at least…”. There is insufficient antecedent basis for this limitation in the claim. From the current phrasing of this claim, it could be interpreted that two different plants (and parts or cells thereof) are being claimed: the first plant recited (i.e. A plant, plant part or plant cell) and then the plant which is being genetically altered. There does not appear to be any nexus between the first plant and the plant being genetically altered. Claim 21 is indefinite on the same grounds because it is not clear which plant is being “genetically altered”. This is a new grounds of rejection necessitated by Applicant’s amendment of claims 1 and 21.
Claims 2-7, 9 and 26 depend from claim 1 and are rejected on the same grounds as they do not recite any limitations which clarify the metes and bounds of the claim from which they depend.
Claim 1 recites the limitation “at least one mutation in at least one UPL2 gene encoding E3 ubiquitin ligase comprising a HECT domain and/or in a promoter of the at least one UPL2 gene and wherein the mutation results in a non-functional HECT domain in comparison to a control plant that does not comprise the mutation.” It is completely unclear how a modification in a promoter would result in a “non-functional HECT domain” as the promoter does not comprise a HECT domain. Thus, the limitation regarding a mutation that results in a non-functional HECT domain could be interpreted to only apply then the mutation is in a UPL2 gene encoding E3 ubiquitin ligase comprising a HECT domain but it could also be interpreted to read on a mutation in the promoter that somehow also results in a non-functional HECT domain. This is a new grounds of rejection necessitated by Applicant’s amendment of claim 1.
Claims 2-3, 6-7, 9 and 26 depend from claim 1 and are rejected on the same grounds as they do not recite any limitations which clarify the metes and bounds of the claim from which they depend.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 2 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This is a new rejection, necessitated by Applicant’s amendment of the claims.
Claim 1 requires a “non-functional HECT domain”. Claim 2 is drawn to the plant of claim 1, wherein the mutation is a loss of function or partial loss of function. A non-functional domain would necessarily be a domain with a complete loss of function. Therefore, claim 2 fails to further limit claim 1.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1 and 5 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for 1) a mutation in UPL2 gene that results in non-functional HECT domain and 2) a mutation in an Glu/Asp-rich domain that results in a frame shift mutation which results in a non-functional HECT domain or in truncation mutation which deletes at least a portion of Glu/Asp-rich domain and the downstream portion of UPL2, does not reasonably provide enablement for a mutation in an UPL2 promoter that results in a non-functional HECT domain or any mutation in a Glu/Asp-rich domain which results in a non-functional HECT domain. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make or use the invention commensurate in scope with these claims. This rejection is new, necessitated by Applicant’s amendment of the claims.
Claim 1 requires either a mutation in at least one UPL2 gene or a UPL2 promoter which results in a non-functional HECT domain in comparison to a control plant that does not comprise the mutation. Claim 5 depends from claim 1 and further requires that the mutation is in the Glu/Asp-rich domain, but does not otherwise limit the type of mutation.
Applicant teaches that nearly all indica varieties have a naturally occurring 2.6kb deletion in in the OsUPL2 gene promoter region relative to japonica varieties. Applicant further notes that indica varieties have increased panicle size (i.e. yield) relative to japonica varieties. Applicant further states “Without being bound by theory, it is possible that during evolution, the natural variation in the OsUPL2 promoter (i.e. deletion of 2.6kp sequence) might lead to changes in panicle size between indica and japonica varieties through changing UPL2 expression levels” (see instant specification, page 61, “Example 9”, lines 12-21).
Applicant teaches that the Glu/Asp-rich domain is distinct from the HECT domain. Applicant’s specification identifies SEQ ID NO: 2 as an OsUPL2 polypeptide (see Sequence Listing and throughout specification). It appears that the Glu/Asp domain is found at residues 2126-2212 and the HECT domain is found at residues 3284-3644 (see Huang et al, 2021, The Plant Cell 33: 1212-1228, Supplemental Figure 7; location of HECT domain determined by aligning SEQ ID NO: 2 and SEQ ID NO: 64, see page 17, lines 1-10 instant specification).
Applicant teaches that the Glu/Asp-rich domain is responsible for the binding of UPL2 with one its target substrates, APO1 and APO2 and that deletion of this domain inhibits binding of UPL2 with APO1/APO2 (page 21, lines 29-34; page 31, lines 1-10; page 52, lines 27-34).
Applicant does not provide any teachings or guidance which shows a mutation in a UPL2 promoter that results in a non-functional HECT domain. One of ordinary skill in the art would understand that a UPL2 promoter would not comprise a HECT domain and would understand that while modifying promoter may lead to loss or change in the expression of a gene, it would not change the function of a domain within the gene or a protein encoded by the gene.
Applicant does not provide any teachings drawn to a mutation in a Glu/Asp-rich domain that would result in a non-functional HECT domain without said mutation also altering the structure of the HECT domain. For example, an in-frame deletion or insertion Glu/Asp-rich domain would not appear to alter the function of the HECT domain in any meaningful way.
The prior art does not provide any teachings that show a nexus between the function of a UPL2 promoter and the functional ability of a HECT domain.
The prior art does not provide any teachings that show a nexus between the function of the Glu/Asp domain and the function of the HECT domain.
Therefore, given the breadth of the claims, the lack of guidance in the claims, the nature of the invention and the state of the prior art, the specification does not reasonably provide enablement across the full scope of the claims.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 10, 14, 18, and 21 remain rejected and claim under 35 U.S.C. 102(a)(2) as being anticipated by Furniss et al 2018 (PLoS Pathology 14(11):e1007447) taken with the evidence of Alonso et al (2003, Science 301: pages 653-656; Supporting online material) and Downes et al (2003, The Plant Journal 35: 729-742). This rejection has been modified from the rejection set forth in the previous Office action in light of Applicant’s amendment of the claims. Applicant’s arguments have been full considered but are not found persuasive.
Furniss et al discloses Arabidopsis plants which are UPL2 knockout mutants (instant claims 10, 14, 18, and 21) wherein the mutants were isolated from SALK_008974 (Abstract; page 4, final paragraph; Materials and Methods, pages 14-15, bridging paragraph).
Alonso provides evidence that SALK_008974 is a knockout mutant of AT1g70320 wherein the insertional mutation is located in an exon (page 364 of Supporting online material).
Downes et al provides evidence that AT1g70320 is a UPL2 gene (i.e. a functional variant or homolog of SEQ ID NO: 2; page 739, column 2, paragraph 2; instant claim and 18).
Regarding claim 10, a knockout mutant of any gene would inherently lack function, which in the case of UPL2 would be E3 ligase function.
Thus, Furniss et al 2018 (PLoS Pathology 14(11):e1007447) taken with the evidence of Alonso et al (2003, Science 301: pages 653-656; Supporting online material) and Downes et al (2003, The Plant Journal 35: 729-742) anticipates all the limitations of claims 10, 14, 18, and 21.
Response to Applicant’s Arguments filed on 5 June 2026
Applicant argues that because claim 15 was not included in the previous office action, the current claims are free of the prior art because Furniss et al does not disclose or suggest “least one mutation in at least one UPL2 gene and/or one UPL2 promoter encoding E3 ubiquitin ligase comprising a HECT domain and wherein the mutation results in a non-functional HECT domain” as recited in claim 10. Applicant also further argues that Furniss teaches that UPL3 is indispensable for development of plant immunity and thus would discourage one from producing a non-functional HECT domain out of concern that the plant will not develop properly, therefore Applicant’s invention is both unexpected and non-obvious.
This is not found persuasive.
Claim 10 does not recite any limitations drawn to a mutation that results in a non-functional HECT domain. Furthermore, arguments drawn to teaching away and obviousness are not relevant to an anticipation rejection.
Claims 1-3, 6-7, 9, 10, 16, 18, 19 and 21 remain rejected and claims 26 and 27 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Li et al (2017, The Plant Journal 92: 349-362) taken with the evidence of NCBI Accession CP056063 (2021, ncbi.nlm.nih.gov/nuccore/cp056063.1) and Applicant’s admission in the instant specification. This rejection has been modified from the previous Office action in light of Applicant’s amendment of the claims. Examiner notes that while claim 19 was included in the rejection set forth in the previous Office action, it was inadvertently not included in the heading of the rejection, therefore it is not newly rejected here. See the previous Office action, page 15, second to last paragraph, where claim 19 is explicitly listed as being drawn to a rice plant. Applicant’s arguments have been fully considered but are not found persuasive.
Claims 1-3, 6, 7, and 9 are drawn to “a genetically altered plant” comprising at least one mutation in at least one UPL2 promoter (claim 1; see Claim Interpretation), wherein the mutation is a loss of function or partial loss of function (claim 2), wherein the plant is heterozygous for the mutation, wherein the UPL2 promoter comprises or consists of SEQ ID NO: 3 or a functional variant or homologue thereof (6), wherein the plant is rice (claim 7 and 26), a seed obtained from the plant of claim 1 (claim 9). The claims are further drawn to a method of reducing expression of a UPL2 nucleic acid by introducing at least one mutation into a UPL2 promoter (claim 10), wherein the method increases at least one of inflorescence size, grain number per plant, grain width and thousand grain weight, wherein the promoter is a homolog of SEQ ID NO: 3 (claim 18), wherein the plant is rice (claim 19 and 27) and a plant made by the method of claim 10, where in the plant is “being genetically altered” (claim 21; see “Claim Interpretation”).
Examiner notes that claim 1 is a “product by process” claim (see MPEP 2113). Thus, while claim 1 recites “genetically altered” in the preamble, the claim is interpreted to read on any plant comprising any mutation in a UPL2 promoter, including both naturally occurring mutations and mutations induced, for example, by chemical mutagenesis or genome editing.
Claim 21 is drawn to a plant obtained by the method of claim 10. This claim is a “product by process claim” (see MPEP 2113). Therefore, claim is interpreted to read on any plant comprising any decrease or loss of expression of a UPL2 nucleic acid or reduction in activity of a UPL2 polypeptide, including those which are naturally occurring.
By Applicant’s own admission, nearly all indica varieties have a naturally occurring 2.6kb deletion in in the OsUPL2 gene promoter region relative to japonica varieties. Applicant further notes that indica varieties have increased panicle size (i.e. yield) relative to japonica varieties. Applicant further states “Without being bound by theory, it is possible that during evolution, the natural variation in the OsUPL2 promoter (i.e. deletion of 2.6kp sequence) might lead to changes in panicle size between indica and japonica varieties through changing UPL2 expression levels” (see instant specification, page 61, “Example 9”, lines 12-21).
Li et al teaches F1 crosses of indica variety Zhenshan 97 and japonica variety Nipponbare (page 350, column 2, paragraphs 2-3).
Alignment of SEQ ID NO: 3 with chromosome 12 of Zhenshan 97 (NCBI Accession ncbi.nlm.nih.gov/nuccore/cp056063.1) provides evidence that Zhenshan 97 has a naturally occurring 2.6kb deletion in the OsUPL2 promoter:
Score:660 bits(357), Expect:0.0,
Identities:392/408(96%), Gaps:5/408(1%), Strand: Plus/Plus
Query 1 ACATTAACTGTCCTATATGCGATGTATTTATTGTTATGGTGTATTAAATCATCAGTATAT 60
||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||
Sbjct 13353114 ACATTAACTGTCCTATATGTGATGTATTTATTGGTATGGTGTATTAA---ATCAGTATAT 13353170
Query 61 ATAGTAAAAAACATAACAAAGAGTGCACGACTAATTTAAAAGATAAAAGAAAAAGTAGAG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct 13353171 ATAGTAAAAAACATAACAAAGAGTGCACGACTAATTTAAAAGATAAAAGAAAAGGTAGAG 13353230
Query 121 TAATTGGGCCACCAAAACTAATGATTTTCGCTACTAGATCGAAGCTCTAGCCtttttttt 180
||||||||||| |||||||||||||||||||| ||||||||||||||||||||| | |||
Sbjct 13353231 TAATTGGGCCATCAAAACTAATGATTTTCGCTGCTAGATCGAAGCTCTAGCCTTATATTT 13353290
Query 181 ttttttGCCATAAGCCTGCTTGACATGTATC-TTTTACTTGATTTTAGATGATCCTCATA 239
||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||
Sbjct 13353291 TTTGTTGCCATAAGCCTGCTTGACATGTATCTTTTTACTTGATTTTATATGATCCTCATA 13353350
Query 240 TTCCTTTATTTCTAAACTTCCC-AAGCAATCAAAAGAATAGCAAATGTTCATCTTTACAC 298
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct 13353351 TTCCTTTATTTCTAAACTTCCCAAAGCAATCAAAAGAATAGCAAATGTTCATCTTTACAC 13353410
Query 299 AAATGAAAACTACCATTTTAGCTTGATTGTGTTCTTGGCCCATTCTAGGAAGCTAAAATT 358
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct 13353411 AAATGAAAACTACCATTTTAGCTTGATTGTGTTCTTGGCCCATTCTAGGAAGATAAAATT 13353470
Query 359 ATGAGAAGTAGCCTTTTGGTAGCTAAATTTTGAGAATCTAGAATATAT 406
|||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct 13353471 ATGAGAAGTAGCCTTTTGGTAGCTAAATTTTGAGAATCTAGATTATAT 13353518
Score:3173 bits(1718), Expect:0.0,
Identities:1804/1845(98%), Gaps:8/1845(0%), Strand: Plus/Plus
Query 3030 AGAATCTAGAATATATAGCTACATATTCTCAAAATCGAATCTGGACTGTTTTGGAGAGTA 3089
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13353503 AGAATCTAGATTATATAGCTACATATTCTCAAAATCGAATCTGGACTGTTTTGGAGAGTA 13353562
Query 3090 GCCGCTAGAAACTTCCTAGAAC-AAAACCCTTATATTTGTTCTTTAAGTCACATCATACT 3148
|| |||||||||||||| |||| |||||||||||||||||| ||| ||||||||||||||
Sbjct 13353563 GCTGCTAGAAACTTCCTCGAACAAAAACCCTTATATTTGTT-TTT-AGTCACATCATACT 13353620
Query 3149 TGCTGATGAAATCACTATCCATTAGTTACTCCATCCGTCCCAAAAATACTTAATCTAGGA 3208
|||| ||||||||||||||||||||||||| | ||||||| ||||||||| ||| ||| |
Sbjct 13353621 TGCTCATGAAATCACTATCCATTAGTTACTTCCTCCGTCCGAAAAATACTCAATATAGAA 13353680
Query 3209 GAAGATGTGACTCCTTCTGATACAATAAATTTGGATAAAGAGCTATCAGATTTGTTAGGA 3268
|| ||| ||||| ||| | |||||||||||||| ||||| |||||||||||||||||||
Sbjct 13353681 GAGGATATGACTTCTTATAATACAATAAATTTGAATAAAAGGCTATCAGATTTGTTAGGA 13353740
Query 3269 TCACACATTTATTTGTAGGTTAAGttttttttAACGGAAGTAGTACGCATAAAGGATTGG 3328
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||
Sbjct 13353741 TCACACATTTATTTGTAGGTTAAGTTTCTTTTAACGGAAGGAGTACGCATAAAGGATTGG 13353800
Query 3329 CTTACCCAATTGTTAACCGGCCC-GGCACTGGAACAGAAAGGTCTTGAACCCAAACGGGA 3387
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||
Sbjct 13353801 CTTACCCAATTGTTAACCGGCCCGGGCCCTGGAACAGAAAGGTCTTGAACCCAAACGGGA 13353860
Query 3388 CGCCGAGAAGGCCCTTCCCTGACGAAAGCAAAGGGCTTAATTAGCTAGCAAGAAACCCAA 3447
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13353861 CGCCGAGAAGGCCCTTCCCTGACGAAAGCAAAGGGCTTAATTAGCTAGCAAGAAACCCAA 13353920
Query 3448 ACCGACCCGAGCCCGTCACGCGCCGCGCCCGTGACCTACCGTGCGCTGCGCCGcctcctc 3507
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13353921 ACCGACCCGAGCCCGTCACGCGCCGCGCCCGTGACCTACCGTGCGCTGCGCCGCCTCCTC 13353980
Query 3508 cctcccacctcccttcacaaaagcagcgacccctcctccctccccaagtttcctccccAC 3567
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13353981 CCTCCCACCTCCCTTCACAAAAGCAGCGACCCCTCCTCCCTCCCCAAGTTTCCTCCCCAC 13354040
Query 3568 ACCGCAACCCTtctctct--ctctctctctcccctctcgacttctctcctctccgccgcc 3625
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct 13354041 ACCGCAACCCTTCTCTCTCGCTCTCTCTCTCCCCTCTCGACTTCTCTCCTCTCCGCCGCC 13354100
Query 3626 tccgagtcccgccgcgccgcgcgcccgtcttccccggcggccgATGTGTCTGCCTCGTCG 3685
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct 13354101 TCCGAGTCCCGCCGCGCCGCGCGCCCGTCTTCCCCGGCGGCCGATGTGTCTGCCTCGCCG 13354160
Query 3686 GCACGAAACCCTAGAGGTAAcccgccgcgccgctccccgccgcttcccgccgcgatcggg 3745
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct 13354161 GCACGAAACCCTAGAGGTAACCCGCCGCGCCGCTCCCCGCCGCTCCCCGCCGCGATCGGG 13354220
Query 3746 ggccctcccccctagggttttcgggggacttttgagggtggatgatttgggggtgtgggg 3805
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct 13354221 GGCCCT-CCCCCTAGGGTTTTCGGGGGACTTTTGGGGGTGGATGATTTGGGGGTGTGGGG 13354279
Query 3806 ggctttgggggCGGTCTAACCTGTTTGTGGTTTCTGGTGCAGGTGCGGTGCAGTTGAGGG 3865
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13354280 GGCTTTGGGGGCGGTCTAACCTGTTTGTGGTTTCTGGTGCAGGTGCGGTGCAGTTGAGGG 13354339
Query 3866 GTCCCGATCGGAGATggcggcggcggcggccatggcggcgCACCGGGCCAGCTTCCCGCT 3925
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13354340 GTCCCGATCGGAGATGGCGGCGGCGGCGGCCATGGCGGCGCACCGGGCCAGCTTCCCGCT 13354399
Query 3926 CCGGCTGCAGCAGATCCTGTCCGGGAGCCGCGCCGTGTCGCCGTCGATCAAGGTGGAGTC 3985
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13354400 CCGGCTGCAGCAGATCCTGTCCGGGAGCCGCGCCGTGTCGCCGTCGATCAAGGTGGAGTC 13354459
Query 3986 CGAGCCGGTGAGTCCCTCGCGCCGTTCCCCTGTTTCCTCGCCCTAGGGTTTTGATCGTCG 4045
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||
Sbjct 13354460 CGAGCCGGTGAGTCCCTCTCGCCGTCCCCCTGTTTCCTCGCCCTAGGGTTTTGATCGTCG 13354519
Query 4046 GGGTTGAGGGGTTGTAGATGCGAAGTTGAGATGGTATGTAGGATCGAATCCTCCCTAGGT 4105
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct 13354520 GGGTTGAGGGGTTGTAGATGCGAAGTTGAGATGGTATGTATGATCGAATCCTCCCTAGGT 13354579
Query 4106 GCTTCCTCTAGGGTTTTGATCGGCTGCCTGTGTTGATGTGGCGTGCTGTTGGGGTGAGGT 4165
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13354580 GCTTCCTCTAGGGTTTTGATCGGCTGCCTGTGTTGATGTGGCGTGCTGTTGGGGTGAGGT 13354639
Query 4166 AGTTAGGCCGTAAGGAGTTTGCTCCGTTTATGATCGGTGTTGAGCATGGGGACCAGTGGT 4225
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13354640 AGTTAGGCCGTAAGGAGTTTGCTCCGTTTATGATCGGTGTTGAGCATGGGGACCAGTGGT 13354699
Query 4226 GTGGTGTGCAGGGTAGTTGTTACTGCTTTAGGCCATCTCAAATTTGGGTTTCCTTGGTCA 4285
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct 13354700 GTGGTGTGCAGGGTAGTTGTTACTGTTTTAGGCCATCTCAAATTTGGGTTTCCTTGGTCA 13354759
Query 4286 GGGGTAGAAGAGACACCGGTTTGAAGTTTCTGGTTATCTTGCTTGTGCTGTTATTGTACT 4345
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13354760 GGGGTAGAAGAGACACCGGTTTGAAGTTTCTGGTTATCTTGCTTGTGCTGTTATTGTACT 13354819
Query 4346 ATATTGTAGTAGGGATACATGCTCGTGTTATTCTGTTACCTTGTTTAAGCATGTCTATGC 4405
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13354820 ATATTGTAGTAGGGATACATGCTCGTGTTATTCTGTTACCTTGTTTAAGCATGTCTATGC 13354879
Query 4406 CCCTCAATGCTTAGTTGCCGCTGCAGCCGTAATCTTTTAGGCTTAGCCGCTTAGGTATCC 4465
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13354880 CCCTCAATGCTTAGTTGCCGCTGCAGCCGTAATCTTTTAGGCTTAGCCGCTTAGGTATCT 13354939
Query 4466 CCATTACATTTGTATTATCTTGTTATTACTACGGTGTCCCATTGGACATTTATTAGTTCA 4525
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct 13354940 CCATTACATTTGTATTATCTTGTTCTTACTACGGTGTCCCATTGGACATTTATTAGTTCA 13354999
Query 4526 GACTTTCTTGCACTTGTAATTCCTTCTGCAAAACATACGAGTCAATACAGAATGCCACAT 4585
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13355000 GACTTTCTTGCATTTGTAATTCCTTCTGCAAAACATACGAGTCAATACAGAATGCCACAT 13355059
Query 4586 CTAGCAAATTACTATGTTATCATTGATGCTTAGGTGCCCATGATCAGTACTTATGGACTT 4645
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct 13355060 CTAGCAAATTACTATGTTATCATTGATGCTTAGGTGCCCATGGTCAGTACTTATGGACTT 13355119
Query 4646 GTACTGGCCattttataatgttattttttcattctgttattgctatagctttttaatcct 4705
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct 13355120 GTACTGGCCATTTTATAATGTTATTTTTTCATTCTGTTATTGCTATAG-TTTTTAATCCT 13355178
Query 4706 tttttacgtatttttatttCTGTGCACAACTGCACTTATGTTGACCAATCCTGTATCATG 4765
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct 13355179 TTTTTACGTATTTTTATTTCTGTGCACAACTGCACTTATGTTGGCCAATCCTGTATCATG 13355238
Query 4766 TTTTGGATAATGGCTTACTACATAAATATATGACGTTGGATAGTAGCCTCAAGATTGATG 4825
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13355239 TTTTGGATAATGGCTTACTACATAAATATATGACGTTGGATAGTAGCCTCAAGATTGATG 13355298
Query 4826 CATTGATTTAGTTCACTTGATATTACAGCTCAAGAGTTGAGACAT 4870
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct 13355299 CATTGATTTAGTTCACTTGATATTACAGCTCAAGAGTTGAGACAT 13355343
Regarding claim 3, an F1 hybrid of Zhenshan 97 and Nipponbare would inherently be heterozygous for the promoter as one parent comprises the deletion and the other does not.
Regarding claim 9, such a hybrid would produce at least some seeds.
Regarding claim 10, by Applicant’s own admission, as set forth above, a 2.6kb deletion in the promoter of OsUPL2 would reduce expression of OsUPL2. Crossing the two plants as disclosed by Li et al would thus anticipate all the limitations of claim 10, which recites the method steps of reducing expression of a UPL2 nucleic acid by introducing a mutation into a UPL2 promoter. A cross of two plants which results in the claimed modified promoter would constitute “introducing a mutation into a UPL2 promoter” (see instant specification, page 2, lines 19-26, which discloses introducing mutations into UPL2 genes and promoters by crossing a first and second plant).
Regarding claim 16, the limitation is drawn to an intended result of practicing the method of claim 10. Thus, as the prior art anticipates all the active method steps of claim 10, it would likewise produce the intended result of claim 16.
Therefore, Li et al, taken with the evidence of evidence of NCBI Accession CP056063 and Applicant’s admission in the instant specification, anticipates all the limitations of claims 1-3, 6-7, 9, 10, 16, 18, 19, 21 and 26-27.
Response to Applicant’s Arguments filed on 5 June 2026
Applicant argues that Li et al does not disclose or suggest ““least one mutation in at least one UPL2 gene and/or one UPL2 promoter encoding E3 ubiquitin ligase comprising a HECT domain and wherein the mutation results in a non-functional HECT domain” as recited in claim 1 or 10. Applicant argues that the statement regarding the 2.6kb promoter deletion present in indica rice should not be viewed as admission because it relates to theory and statement was made without wishing to be bound by theory. They argue that Li teaches away from making mutations in loci which Li et al teaches are important to the fertility of hybrids. Applicant argues that this makes the claims non-obvious over Li et al. This is not found persuasive.
First, as set forth in the claim interpretation at the beginning of the Office action and in the rejection of claim 1 under 35 U.S.C. 112(b), the limitation drawn to a non-functional HECT domain is interpreted to apply only to the alternative limitation “a mutation in at least one UPL2 gene”. As explained above, it is completely unclear from both the Applicant’s disclosure and the knowledge in the prior art how a mutation in a UPL2 promoter would result in a non-functional HECT domain, if such a mutation is even possible. Thus, the limitation “a mutation in a UPL2 promoter” is interpreted to not require the later limitation “wherein the mutation results in a non-functional HECT domain in comparison to a control plant that does not comprise the mutation”.
Secondly, claim 10 does not recite the limitation “least one mutation in at least one UPL2 gene and/or one UPL2 promoter encoding E3 ubiquitin ligase comprising a HECT domain and wherein the mutation results in a non-functional HECT domain”, but rather requires a mutation in a promoter of the UPL2 gene that reduces expression of the UPL2 gene or reduced E3 ubiquitin activity.
Regarding Applicant’s statement about the promoter deletion found in indica rice, qualifying a statement with “without being bound by theory” does not disqualify the admission from being applied as an evidentiary reference in an Office action. Moreover, from the context of Applicant’s entire specification (especially Examples 9 and 10) and the claims (for example claim 10), it is clear that the Applicant considers that this deletion reduces expression of the UPL2 gene. Indeed, it is the only promoter modification exemplified by Applicant.
Regarding applicants arguments drawn to teaching away and non-obviousness, neither of these arguments are relevant to an anticipation rejection.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEKSANDAR RADOSAVLJEVIC whose telephone number is (571)272-8330. The examiner can normally be reached Monday--Friday 8-5:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALEKSANDAR RADOSAVLJEVIC/ Examiner, Art Unit 1662 /BRENT T PAGE/Primary Examiner, Art Unit 1663
Prosecution Insights