DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 06/27/2023 and 03/24/2025 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Specification
The disclosure is objected to because of the following informalities:
The use of the following trade names or marks in the specification, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore the terms should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
At Page 30, line 14, "Kaneka" (Serial # 88722632)
At Page 30, line 18, "DNeasy" (Serial #75283127)
At Page 32, line 5, “SYBR” (Serial # 79339566)
At Page 39, line 6, "KOD FX" (Serial # 90613285)
At Page 39, line 27, "GelRed"(Serial # 99306429)
Regarding the terms above, trademark symbols are not used to denote the tradenames and should be added. Further, each letter in the trademark should be capitalized.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Status of Claims
Claims 1-19 are pending and under examination. This is the first action on the merits.
Priority
The effective filling date of the instant claims 1-19 is June 27, 2023, the filling date of the instant U.S. nonprovisional application.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Specifically, Applicant's claim to domestic priority is acknowledged as a 371 national stage entry of PCT/JP2022/005426. Applicant's claim to foreign priority to JAPAN Application 2021-021102 is also acknowledged. However, neither of the submitted document is in English, and English translations have not been submitted.
The domestic benefit date may be the effective filing date of the claimed invention if:
• the earlier application to which domestic benefit is claimed supports the claimed invention under 35 U.S.C. 112(a).
The foreign priority date may be the effective filing date of the claimed invention if:
• the foreign application supports the claimed invention under 35 U.S.C. 112(a), AND
• the applicant has perfected the right of priority by providing a certified copy of the priority application, and a translation of the certified copy (if not in English) along with a statement that the translation of the certified copy is accurate.
See MPEP 213.04 and 216
In this instant case, the priority documents submitted are not in English, without a translation; without a English translation, the examiner is unable to verify whether the earlier applications provide written description support for the claimed invention under 35 U.S.C. 112(a). Thus, since an English translation of the priority application has not been filed, the effective filing date (EFD) of the claimed invention is the filing date of the application.
However, if applicant perfects the right of priority by providing an English translation of the priority application that supports the claimed invention under 35 U.S.C. 112(a), the effective filing date will be the filing date of the foreign application.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
For the purpose of applying prior art, claims 7-8, 10-11 and 17-18 recite "at least about" followed by a numerical value, such as "at least about 70°C."
The specification defines the term "about" in para. [0012] as "±10% of a numerical value that follows."
Therefore, "at least about" is interpreted to mean at least the lower bound of this range. For example, "at least about 70°C" is interpreted as at least 63°C.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 5-8, 12-13 and 19 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A) Regarding claim 5, it recites a composition comprising a nucleic acid fragment, characterized by whether the fragment is "amplified" or "not amplified" by certain primer pairs.
This claim language is indefinite. Specifically, it is unclear, within the context of the claim whether the terms "amplified" or "not amplified" describe a process by which the nucleic acid fragment is generated (i.e., the fragments are produced via amplification using specific primer sets), or whether they refer to structural features of the fragments (i.e., the fragments possess structures that render them amplifiable or non-amplifiable by the specific primer pairs).
For the purpose of applying prior art, this language is interpreted as referring to structural characteristics of the nucleic acid fragments that allow for the nucleic acid fragments to be amplified or not amplified by the specific primer pairs (e.g., nucleotide sequences).
Claims 6-8 are rejected for depending from claim 5 and not remedying the indefiniteness.
B) Regarding claim 12, it is drawn to a method that recites:
“wherein the nucleic acid fragment is not amplified by one or more primer sets
selected from the group consisting of:
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 1 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 2;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 4 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 5;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 7 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 8;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 10 and an oligonucleotide comprising the base sequence of SEQ ID NO: 11;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 13 and an oligonucleotide comprising the base sequence of SEQ ID NO: 14;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 16 and an oligonucleotide comprising the base sequence of SEQ ID NO: 17;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 19 and an oligonucleotide comprising the base sequence of SEQ ID NO: 20;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 22 and an oligonucleotide comprising the base sequence of SEQ ID NO: 23;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 25 and an oligonucleotide comprising the base sequence of SEQ ID NO: 26; and/or
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 28 and an oligonucleotide comprising the base sequence of SEQ ID NO: 29.”
However, base claim 9 recites "the step of amplifying the nucleic acid fragment using at least one of the primer sets of claim 1." The primer sets in claim 1 includes the same primer sets listed in the wherein clause of claim 12, which explicitly states that the nucleic acid fragment is not amplified by one or more of these primer sets.
Therefore, base claim 9 recites amplification using primer sets in this wherein clause, while claim 12 expressly excludes amplification by one of more of those same primer sets.
This creates a contradiction between the dependent claim and its base claim, rendering the scope of the claim indefinite. Specifically, it is indefinite whether amplification using the primer sets above is included or excluded in the scope of the claim.
As such, the exact scope of claim 12 cannot be determined without applying considerable speculation and assumption. Consequently, claim 12 is excluded from prior art search in this examination, as any rejection based on prior art cannot be based on speculations and assumptions, see In re Steele, 305 F.2d 859, 862 (CCPA 1962).
C) Regarding claim 13, it recites claim languages such as "the polynucleotide set forth in SEQ ID NO: X," which is indefinite because the term "set forth in " is unclear in this context.
As per MPEP 2111.03, proper transitional phrases like "comprising" or "consisting of" should be used to clearly define the scope of the claim. The current wording gives uncertainty in the composition of primer set and the relationship to the recited SEQ ID Nos, rendering the scope of the claims indefinite. Specifically, it is unclear whether the claim requires the polynucleotide to comprise the sequence identified by the specific SEQ ID NO, consist of the sequence identified by the specific SEQ ID NO, or whether the claim requires the polynucleotide to be comprised by the sequence identified by the specific SEQ ID NO.
For the purpose of applying prior art, this language "set forth in" is interpreted as "comprising."
D) Regarding claim 19, it is drawn to a method that recites:
“wherein the nucleic acid fragment is not amplified by one or more primer sets
selected from the group consisting of:
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 1 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 2;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 4 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 5;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 7 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 8;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 10 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 11;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 13 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 14;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 16 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 17;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 19 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 20;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 22 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 23;
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 25 and
an oligonucleotide comprising the base sequence of SEQ ID NO: 26; and/or
a pair of an oligonucleotide comprising the base sequence of SEQ ID NO: 28 and an oligonucleotide comprising the base sequence of SEQ ID NO: 29.”
However, base claim 16 recites "the step of amplifying the nucleic acid fragment using at least one of the primer sets of claim 2." The primer sets in claim 2 includes the same primer sets listed in the wherein clause of claim 19, which explicitly states that the nucleic acid fragment is not amplified by one or more of these primer sets.
Therefore, base claim 16 recites amplification using primer sets in this wherein clause, while claim 19 expressly excludes amplification by one of more of those same primer sets.
This creates a contradiction between the dependent claim and its base claim, rendering the scope of the claim indefinite. Specifically, it is indefinite whether amplification using the primer sets above is included or excluded in the scope of the claim.
As such, the exact scope of claim 19 cannot be determined without applying considerable speculation and assumption. Consequently, claim 19 is excluded from prior art search in this examination, as any rejection based on prior art cannot be based on speculations and assumptions, see In re Steele, 305 F.2d 859, 862 (CCPA 1962).
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 5-8 and 13 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Independent claims 5 and 13 are drawn to polynucleotides, also referred to as nucleic acid fragments.
Following the analysis below the claims are not patent eligible under 35 U.S.C. 101.
Step 1 - Whether the Claim is to a Statutory Category : YES. The claims are drawn to a product or composition, therefore to one of the of statutory categories.
Step 2A Prong 1 - Whether the Claim Recite an Abstract idea, Law of Nature, or Natural Phenomenon: Yes. The claims recite naturally occurring nucleic acid sequences without specifying any unique, markedly different characteristics compared to what occurs in nature. As stated in MPEP 2106.04(b)(I), laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature.
In this instant case, both claims 5 and 13 encompass a polynucleotide comprising SEQ ID NO: 42, which can be amplified by a primer set consist of SEQ ID NO: 16 and 18, and not amplifiable by SEQ ID NO: 17 for lack of sequence complementarity. Polynucleotide sequences that comprise SEQ ID NO: 42 are naturally occurring in the genomes of Enterococcus faecalis, for example, see GenBank Accession # LR962468.1.
Enterococcus faecalis isolate 28099_2#370 genome assembly, chromosome: 1
Sequence ID: LR962468.1
Query 1 CATGGCTTGCCGTTTCACAACCATTTTTCAATACTGATACTGCTTATGGGCGTTCCTTTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 62091 CATGGCTTGCCGTTTCACAACCATTTTTCAATACTGATACTGCTTATGGGCGTTCCTTTG 62032
Query 61 TTAATCAGTCAATGAGTTTTGCTGAATTAGAAGCACAAATGGCATCTGAACGTATCAAAG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 62031 TTAATCAGTCAATGAGTTTTGCTGAATTAGAAGCACAAATGGCATCTGAACGTATCAAAG 61972
Query 121 CAGTATTTGAAAACAAAATTAGAAAGGGAGAAGTGGTAACTGGTAGCGTTCCTTTTGGT 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61971 CAGTATTTGAAAACAAAATTAGAAAGGGAGAAGTGGTAACTGGTAGCGTTCCTTTTGGT 61913
See also in Genbank Accession # CP060796.1
Enterococcus faecalis strain EF-2001 chromosome, complete genome
Sequence ID: CP060796.1
Query 1 CATGGCTTGCCGTTTCACAACCATTTTTCAATACTGATACTGCTTATGGGCGTTCCTTTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 60965 CATGGCTTGCCGTTTCACAACCATTTTTCAATACTGATACTGCTTATGGGCGTTCCTTTG 60906
Query 61 TTAATCAGTCAATGAGTTTTGCTGAATTAGAAGCACAAATGGCATCTGAACGTATCAAAG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 60905 TTAATCAGTCAATGAGTTTTGCTGAATTAGAAGCACAAATGGCATCTGAACGTATCAAAG 60846
Query 121 CAGTATTTGAAAACAAAATTAGAAAGGGAGAAGTGGTAACTGGTAGCGTTCCTTTTGGT 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 60845 CAGTATTTGAAAACAAAATTAGAAAGGGAGAAGTGGTAACTGGTAGCGTTCCTTTTGGT 60787
In conclusion, the claims recite nature-based products.
Step 2A Prong 2- Whether the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application: No. The claim does not integrate the judicial exception into a practical application.
The claims do not further recite any additional elements other than the judicial exception.
Step 2B - Whether a Claim Amounts to Significantly More: No. In this instant case, the claims, when considered as a whole, do not recite any inventive concept with additional elements that amount to significantly more than the judicial exception. The claims do not appear to add markedly different characteristics that significantly modify or use the naturally occurring polynucleotides in a manner that is not naturally occurring.
The dependent claims 6-8 do not recite any additional elements that amount to significantly more than the judicial exception.
In conclusion, the claims are not patent eligible under 35 U.S.C. 101.
Claims 1-4, 9-12, and 14-19 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Independent claims 1 and 2 are drawn to primer sets comprising specific sequences idented by SEQ ID Nos.
Following the analysis below the claims are not patent eligible under 35 U.S.C. 101.
Step 1 - Whether the Claim is to a Statutory Category : YES. The claims are drawn to sets of primers, which are nucleic acid products, therefore to one of the of statutory categories.
Step 2A Prong 1 - Whether the Claim Recite an Abstract idea, Law of Nature, or Natural Phenomenon: Yes. The claims recite naturally occurring nucleic acid sequences without specifying any unique, markedly different characteristics compared to what occurs in nature. As stated in MPEP 2106.04(b)(I), laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature.
The primers are classified as nature-based products because they could be either naturally occurring or they do not have markedly different characteristics compared to what occurs in nature. Claims 1 and 2 are directed to primers that comprise or consist of SEQ ID NO: 1 and SEQ ID NO: 2. Both SEQ ID NO: 1 and SEQ ID NO: 2 are naturally occurring sequences in the genome of Enterococcus faecalis, strain EF-2001 (Genbank Accession # CP060796.1).
Query 1 CGAAAAGGATGTAGTCAGCGG 21 (SEQ ID NO: 1)
|||||||||||||||||||||
Sbjct 84843 CGAAAAGGATGTAGTCAGCGG 84823 (Genbank Accession# CP060796.1)
Query 1 CCGAAGGCGAAACAGAGGAT 20 (SEQ ID NO: 2)
||||||||||||||||||||
Sbjct 84263 CCGAAGGCGAAACAGAGGAT 84282 (Genbank Accession# CP060796.1)
Additionally, the courts have identified that "short, synthetic, single-stranded DNA molecule[s] that bind specifically to … intended targets nucleotide sequence[s]" are products of nature because they claim the same nucleotide sequence as naturally occurring DNA. See University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 761, 113 USPQ2d 1241, 1244 (Fed. Cir. 2014). See also MPEP 2106.
In this instant case, Applicant does not claim any specific structural feature or characteristics, that could distinguish the claimed oligonucleotides from naturally occurring nucleic acid sequences. Thus, the primers recited in claims 1 and 2 are classified as nature-based products because they do not have markedly different characteristics compared to what occurs in nature.
In conclusion, the claims recite nature-based products.
Step 2A Prong 2- Whether the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application: No. The claim does not integrate the judicial exception into a practical application.
For a claim reciting a judicial exception to be eligible, the additional elements (if any) in the claim must “transform the nature of the claim” into a patent-eligible application of the judicial exception, Alice Corp., 573 U.S. at 217, 110 USPQ2d at 1981.
In this instant case, the claims 1 and 2 do not further recite any additional elements other than the judicial exception.
Step 2B - Whether a Claim Amounts to Significantly More: No.
According to MPEP§ 2106.05, The second part of the Alice/Mayo test is often referred to as a search for an inventive concept. Alice Corp. Pty. Ltd. v. CLS Bank Int'l, 573 U.S. 208, 217, 110 USPQ2d 1976, 1981 (2014) (citing Mayo Collaborative Servs. v. Prometheus Labs., Inc., 566 U.S. 66, 71-72, 101 USPQ2d 1961, 1966 (2012)). An “inventive concept” is furnished by an element or combination of elements that is recited in the claim in addition to (beyond) the judicial exception, and is sufficient to ensure that the claim as a whole amounts to significantly more than the judicial exception itself. Alice Corp., 573 U.S. at 27-18, 110 USPQ2d at 1981 (citing Mayo, 566 U.S. at 72-73, 101 USPQ2d at 1966).
In this instant case, the claims, when considered as a whole, do not recite any inventive concept with additional elements that amount to significantly more than the judicial exception. The claims do not appear to add markedly different characteristics that significantly modify or use the naturally occurring oligonucleotides in a manner that is not naturally occurring.
The dependent kit claims 3 and 14 do not further recite any additional element other than the judicial exception.
The dependent claims 9-12 and 15-19 recite methods of using the primers, comprising steps of heating a sample comprising bacterium, extracting nucleic acids, amplifying, detecting amplification products, and selecting a heat treated lot based on the detection of nucleic acid amplification products. However, these steps, recited at high level of generality, are well-known, routine, and conventional in the field of microbiology1.
Furthermore, the selecting step does not provide an inventive concept (significantly more than the judicial exception) because it is classified as an abstract mental process, which is also a judicial exception. These claimed steps stop at selecting a lot comprising a microorganism based on its genetic marker. The claims do not recite any further step that applies or uses the identified information in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological environment, such as a step of further utilizing the selected bacterium lot for a particular application.
As such, these steps merely observe natural laws (i.e., the natural function of primer hybridize to target sequence; analyzing naturally occurring nucleic acid in bacterium) and constitute abstract ideas.
In conclusion, the claims are not patent eligible under 35 U.S.C. 101.
Claim Rejections - 35 USC § 102
Claims 1-11 and 13-18 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hamamoto (Hamamoto et al. Establishment of a polymerase chain reaction-based method for strain-level management of Enterococcus faecalis EF-2001 using species-specific sequences identified by whole genome sequences. Front Microbiol. 2022 Aug 12;13:959063. doi: 10.3389/fmicb.2022.959063. PMID: 36033901; PMCID: PMC9411961),
as evidenced by Genbank (Accession # CP060796.1; MAR-2021) .
Regarding claims 1-3 and 14, Hamamoto teaches a pair of primers consist of SEQ ID NO: 1 (Table 1; EFC01_For) and SEQ ID NO: 2 (Table 1; EFC01_Rev. L).
Regarding claims 4, 9, 15 and 16, Hamamoto teaches heating a lactic acid bacterium Enterococcus faecalis EF-2001 strain to obtain a plurality of lots of a heat-treated lactic acid bacterium product (page 3, left-hand col, para 2);
extracting a nucleic acid fragment in one of the lots of the heat-treated lactic acid bacterium product (page 3, left-hand col, para 3);
amplifying the nucleic acid fragment using at least one of the primer sets of SEQ ID NO: 1 and 2 (Table 1; Figure 5);
detecting a nucleic acid fragment obtained in the amplification step (Table 1; Figure 5);
and selecting a lot of the heat-treated lactic acid bacterium product in which the nucleic acid fragment has been detected (Figure 4).
Regarding claim 10 and 17, Hamamoto teaches heating at at least about 70°C (Figure 4 and legend).
Regarding claim 11 and 18, Hamamoto teaches heating at at least about 90°C (Figure 4 and legend).
Regarding claims 5-6 and 13, Hamamoto teaches the whole genome sequence of Enterococcus faecalis EF-2001. As evidenced by Genbank (Accession # CP060796.1) the genomic DNA of Enterococcus faecalis EF-2001 is a polynucleotide comprising SEQ ID NO: 42, which can be amplified by a primer set consist of SEQ ID NO: 16 and 18, and not amplifiable by SEQ ID NO: 17 for lack of sequence complementarity.
Enterococcus faecalis strain EF-2001 chromosome, complete genome
Sequence ID: CP060796.1
Query 1 CATGGCTTGCCGTTTCACAACCATTTTTCAATACTGATACTGCTTATGGGCGTTCCTTTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 60965 CATGGCTTGCCGTTTCACAACCATTTTTCAATACTGATACTGCTTATGGGCGTTCCTTTG 60906
Query 61 TTAATCAGTCAATGAGTTTTGCTGAATTAGAAGCACAAATGGCATCTGAACGTATCAAAG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 60905 TTAATCAGTCAATGAGTTTTGCTGAATTAGAAGCACAAATGGCATCTGAACGTATCAAAG 60846
Query 121 CAGTATTTGAAAACAAAATTAGAAAGGGAGAAGTGGTAACTGGTAGCGTTCCTTTTGGT 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 60845 CAGTATTTGAAAACAAAATTAGAAAGGGAGAAGTGGTAACTGGTAGCGTTCCTTTTGGT 60787
Regarding claims 7-8, Hamamoto teaches heat-treated lactic acid bacterium product (Figure 4 and legend).
MPEP 2113 states: "[E]ven though product-by-process claims are limited by and defined by the process, determination of patentability is based on the product itself. The patentability of a product does not depend on its method of production."
In this instant case, the recitations such as "resulting from subjecting a lactic acid bacterium Enterococcus faecalis EF-2001 strain to heat treatment at at least about 70°C, " without any details regarding the structure or specific characteristics of the product, are not considered to limit the scope of the claimed composition based on the description of the process alone.
Claims 5-6 and 13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by GenBank (Accession # LR962468.1; Jan, 2021).
Regarding claims 5-6 and 13, Genbank (Accession# LR962468.1; Jan, 2021) teaches a polynucleotide comprising SEQ ID NO: 42, which can be amplified by a primer set consist of SEQ ID NO: 16 and 18, and not amplifiable by SEQ ID NO: 17 for lack of sequence complementarity.
Enterococcus faecalis isolate 28099_2#370 genome assembly, chromosome: 1
Sequence ID: LR962468.1
Query 1 CATGGCTTGCCGTTTCACAACCATTTTTCAATACTGATACTGCTTATGGGCGTTCCTTTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 62091 CATGGCTTGCCGTTTCACAACCATTTTTCAATACTGATACTGCTTATGGGCGTTCCTTTG 62032
Query 61 TTAATCAGTCAATGAGTTTTGCTGAATTAGAAGCACAAATGGCATCTGAACGTATCAAAG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 62031 TTAATCAGTCAATGAGTTTTGCTGAATTAGAAGCACAAATGGCATCTGAACGTATCAAAG 61972
Query 121 CAGTATTTGAAAACAAAATTAGAAAGGGAGAAGTGGTAACTGGTAGCGTTCCTTTTGGT 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61971 CAGTATTTGAAAACAAAATTAGAAAGGGAGAAGTGGTAACTGGTAGCGTTCCTTTTGGT 61913
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
1 See James et al., Assessing the Impact of Heat Treatment of Food on Antimicrobial Resistance Genes and Their Potential Uptake by Other Bacteria—A Critical Review. Antibiotics Nov 2021, 10, 1440.;
Inatomi et al. Effects of heat-killed Enterococcus faecalis T-110 supplementation on gut immunity, gut flora, and intestinal infection in naturally aged hamsters. PLoS One. 2020 Dec 30;15(12):e0240773. doi: 10.1371/journal.pone.0240773. PMID: 33378402; PMCID: PMC7773277;
Ferguson et al. Virulence Genes among Enterococcus faecalis and Enterococcus faecium Isolated from Coastal Beaches and Human and Nonhuman Sources in Southern California and Puerto Rico. J Pathog. 2016;2016:3437214. doi: 10.1155/2016/3437214. Epub 2016 Apr 10. PMID: 27144029; PMCID: PMC4842068.