Prosecution Insights
Last updated: October 01, 2026
Application No. 18/260,110

HERPES SIMPLEX VIRUS TYPE 1 DERIVED INFLUENZA VACCINE

Non-Final OA §103
Filed
Jun 30, 2023
Priority
Jan 12, 2021 — provisional 63/136,309 +1 more
Examiner
BOESEN, AGNIESZKA
Art Unit
1672
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Regents of the University of California
OA Round
1 (Non-Final)
68%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
90%
With Interview

Examiner Intelligence

Grants 68% — above average
68%
Career Allowance Rate
577 granted / 842 resolved
+8.5% vs TC avg
Strong +22% interview lift
Without
With
+21.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
23 currently pending
Career history
866
Total Applications
across all art units

Statute-Specific Performance

§101
6.3%
-33.7% vs TC avg
§103
33.3%
-6.7% vs TC avg
§102
16.5%
-23.5% vs TC avg
§112
22.1%
-17.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 842 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicants’ election without traverse of Group I, claims 1-11 in the reply filed on July 20, 2026 is acknowledged. Claims 12-13 are withdrawn. Claims Information Disclosure Statement The information disclosure statement (IDS) submitted on June 30, 2023 has been considered by the examiner. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 2, 5, 6, 8, 9 and 11 are rejected under 35 U.S.C. 103 as being unpatentable over. Kousolas et al. (WO 2020/028719 A2 in IDS on 6/30/2023) in view of Garcia-Sastre (US 10,131,695 B2). Claims 1 and 2. Kousolas et al. teach live-attenuated engineered chimeric Herpes Simplex Virus Type-1 (HSV-1) VC2 virus comprising a nucleotide sequence encoding a heterologous polypeptide operably linked to a promoter, wherein the heterologous polypeptide replaces the glycoprotein C (gC) open-reading frame (ORF) in VC2, and wherein the nucleotide sequence encoding the heterologous polypeptide operably linked to a promoter encodes an oncolytic protein (see claims 1-25, and Examples 1-3). Claims 5-11. Kousolas et al. teach a recombinant nucleic acid comprising a nucleotide sequence encoding a live-attenuated chimeric Herpes Simplex Virus Type-1 (HSV-1) VC2 viral vector (abstract - "The compositions comprise herpes simplex viruses comprising recombinant herpes simplex virus genomes"; pg 17, In 13-15 - "Preferably, the vaccines of the present invention comprise a live, attenuated HSV comprising a recombinant HSV genome of the present invention"; claim 4 "wherein the recombinant HSV genome is derived from the genome of VC2") and a nucleotide sequence encoding a heterologous polypeptide operably linked to a promoter (pg 16, In 8-10 "the nucleic acid construct encoding an oncolytic protein or tumor antigen will be in the form of an expression cassette comprising a promoter operably linked to a coding sequence for the oncolytic protein or tumor antigen"), wherein the heterologous polypeptide replaces the glycoprotein C (gC) open-reading frame (ORF) in VC2 (pg 6, In 31-33; pg 7, In 1 "VC2-delta-gC-NIS comprises the modifications to the UL53 and UL20 genes described above and further comprises the replacement of the HSV gene (UL44) encoding glycoprotein C (gC) with an expression cassette comprising a nucleotide sequence encoding the Mws musculus sodium iodide symporter"). Kousolas et al. does not teach the nucleotide sequence encoding the heterologous polypeptide operably linked to a promoter encodes the influenza virus hemagglutinin A. Garcia-Sastre et al. teach flu hemagglutinin (HA) polypeptides that induce a cross -protective immune response against the conserved HA stem domain (see col 2, In 32-54 and claims 1-47), wherein the nucleotide sequence encoding the heterologous polypeptide operably linked to a promoter encodes the influenza virus hemagglutinin A or a fragment thereof (see col 201, In 10-15 "An expression vector comprises a nucleic acid encoding a flu hemagglutinin (HA) polypeptide described herein in a form suitable for expression of the nucleic acid in a host cell. Regarding present claim 11. Garcia-Sastre et al. teach flu hemagglutinin (HA) polypeptides and an adjuvant (see Figures 42-44 and paragraph 1006). Since Kousolas et al. teach a recombinant HSV genome derived from the genome of VC2 for use as a vaccine (abstract; claim 4), and Garcia-Sastre et al. discloses the heterologous polypeptide operably linked to a promoter encoding the influenza virus hemagglutinin A for use in a vaccine (abstract; col 201, In 10-15); it would have been obvious to one of ordinary skill in the art that the flu hemagglutinin A of Garcia-Sastre et al. could be introduced within the Kousolas et al. construct to provide a safe viral vector for immunization due to its inability to enter ganglionic axons and establish latency. One would have thus been motivated to provide Kousolas et al. live-attenuated engineered chimeric Herpes Simplex Virus Type-1 (HSV-1) VC2 virus comprising a nucleotide sequence encoding a heterologous polypeptide operably linked to a promoter, wherein the heterologous polypeptide replaces the glycoprotein C (gC) open-reading frame (ORF) in VC2, and wherein the heterologous polypeptides is Garcia-Sastre’s influenza virus hemagglutinin. Thus, the present invention would have been prima facie obvious at the time the invention was made. Claims 3, 4, 7 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over. Kousolas et al. (WO 2020/028719 A2) in view of Garcia-Sastre (US 10,131,695 B2) as applied to claim 1 and further in view of Schickli et al., (Phil Trans, 2001, p. 1965-1973) and (Accession number AF 389118 (see sequence alignment below) and Accession number GU734771 and Szpara et al. (Journal of Virology, 2010, p. 5303-5313). Kousolas et al. and Garcia-Sastre et al. teach the claimed invention as discussed above. They don’t teach present SEQ ID NO: 19 and SEQ ID NO: 20. Schickli et al., and Accession number AF 389118 teach a sequence identical with present SEQ ID NO: 19. Szpara et al., and Accession number GU734771 disclose a sequence identical with present SEQ ID NO: 20. One of ordinary skill in the art would have been motivated to provide the construct of Kousolas et al. and Garcia-Sastre et al. comprising a nucleic acid encoding influenza heterologous polypeptide of present SEQ ID NO: 19 and comprising the recombinant nucleic acid of present SEQ ID NO: 20 because the nucleic acid sequences identical with present SEQ ID NO: 19 and SEQ ID NO: 20 were known to the skilled artisan at the time of the present invention as taught by Schickli et al., and Szpara et al. Thus, the present invention would have been prima facie obvious at the time the invention was made. Present SEQ ID NO: 19 and Accession number AF 389118 Query 1 ATGAAGGCAAACCTACTGGTCCTGTTAAGTGCACTTGCAGCTGCAGATGCAGACACAATA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 33 ATGAAGGCAAACCTACTGGTCCTGTTAAGTGCACTTGCAGCTGCAGATGCAGACACAATA 92 Query 61 TGTATAGGCTACCATGCGAACAATTCAACCGACACTGTTGACACAGTACTCGAGAAGAAT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 93 TGTATAGGCTACCATGCGAACAATTCAACCGACACTGTTGACACAGTACTCGAGAAGAAT 152 Query 121 GTGACAGTGACACACTCTGTTAACCTGCTCGAAGACAGCCACAACGGAAAACTATGTAGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 153 GTGACAGTGACACACTCTGTTAACCTGCTCGAAGACAGCCACAACGGAAAACTATGTAGA 212 Query 181 TTAAAAGGAATAGCCCCACTACAATTGGGGAAATGTAACATCGCCGGATGGCTCTTGGGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 213 TTAAAAGGAATAGCCCCACTACAATTGGGGAAATGTAACATCGCCGGATGGCTCTTGGGA 272 Query 241 AACCCAGAATGCGACCCACTGCTTCCAGTGAGATCATGGTCCTACATTGTAGAAACACCA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 273 AACCCAGAATGCGACCCACTGCTTCCAGTGAGATCATGGTCCTACATTGTAGAAACACCA 332 Query 301 AACTCTGAGAATGGAATATGTTATCCAGGAGATTTCATCGACTATGAGGAGCTGAGGGAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 333 AACTCTGAGAATGGAATATGTTATCCAGGAGATTTCATCGACTATGAGGAGCTGAGGGAG 392 Query 361 CAATTGAGCTCAGTGTCATCATTCGAAAGATTCGAAATATTTCCCAAAGAAAGCTCATGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 393 CAATTGAGCTCAGTGTCATCATTCGAAAGATTCGAAATATTTCCCAAAGAAAGCTCATGG 452 Query 421 CCCAACCACAACACAAACGGAGTAACGGCAGCATGCTCCCATGAGGGGAAAAGCAGTTTT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 453 CCCAACCACAACACAAACGGAGTAACGGCAGCATGCTCCCATGAGGGGAAAAGCAGTTTT 512 Query 481 TACAGAAATTTGCTATGGCTGACGGAGAAGGAGGGCTCATACCCAAAGCTGAAAAATTCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 513 TACAGAAATTTGCTATGGCTGACGGAGAAGGAGGGCTCATACCCAAAGCTGAAAAATTCT 572 Query 541 TATGTGAACAAAAAAGGGAAAGAAGTCCTTGTACTGTGGGGTATTCATCACCCGCCTAAC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 573 TATGTGAACAAAAAAGGGAAAGAAGTCCTTGTACTGTGGGGTATTCATCACCCGCCTAAC 632 Query 601 AGTAAGGAACAACAGAATATCTATCAGAATGAAAATGCTTATGTCTCTGTAGTGACTTCA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 633 AGTAAGGAACAACAGAATATCTATCAGAATGAAAATGCTTATGTCTCTGTAGTGACTTCA 692 Query 661 AATTATAACAGGAGATTTACCCCGGAAATAGCAGAAAGACCCAAAGTAAGAGATCAAGCT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 693 AATTATAACAGGAGATTTACCCCGGAAATAGCAGAAAGACCCAAAGTAAGAGATCAAGCT 752 Query 721 GGGAGGATGAACTATTACTGGACCTTGCTAAAACCCGGAGACACAATAATATTTGAGGCA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 753 GGGAGGATGAACTATTACTGGACCTTGCTAAAACCCGGAGACACAATAATATTTGAGGCA 812 Query 781 AATGGAAATCTAATAGCACCAATGTATGCTTTCGCACTGAGTAGAGGCTTTGGGTCCGGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 813 AATGGAAATCTAATAGCACCAATGTATGCTTTCGCACTGAGTAGAGGCTTTGGGTCCGGC 872 Query 841 ATCATCACCTCAAACGCATCAATGCATGAGTGTAACACGAAGTGTCAAACACCCCTGGGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 873 ATCATCACCTCAAACGCATCAATGCATGAGTGTAACACGAAGTGTCAAACACCCCTGGGA 932 Query 901 GCTATAAACAGCAGTCTCCCTTACCAGAATATACACCCAGTCACAATAGGAGAGTGCCCA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 933 GCTATAAACAGCAGTCTCCCTTACCAGAATATACACCCAGTCACAATAGGAGAGTGCCCA 992 Query 961 AAATACGTCAGGAGTGCCAAATTGAGGATGGTTACAGGACTAAGGAACACTCCGTCCATT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 993 AAATACGTCAGGAGTGCCAAATTGAGGATGGTTACAGGACTAAGGAACACTCCGTCCATT 1052 Query 1021 CAATCCAGAGGTCTATTTGGAGCCATTGCCGGTTTTATTGAAGGGGGATGGACTGGAATG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1053 CAATCCAGAGGTCTATTTGGAGCCATTGCCGGTTTTATTGAAGGGGGATGGACTGGAATG 1112 Query 1081 ATAGATGGATGGTATGGTTATCATCATCAGAATGAACAGGGATCAGGCTATGCAGCGGAT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1113 ATAGATGGATGGTATGGTTATCATCATCAGAATGAACAGGGATCAGGCTATGCAGCGGAT 1172 Query 1141 CAAAAAAGCACACAAAATGCCATTAACGGGATTACAAACAAGGTGAACACTGTTATCGAG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1173 CAAAAAAGCACACAAAATGCCATTAACGGGATTACAAACAAGGTGAACACTGTTATCGAG 1232 Query 1201 AAAATGAACATTCAATTCACAGCTGTGGGTAAAGAATTCAACaaattagaaaaaaggatg 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1233 AAAATGAACATTCAATTCACAGCTGTGGGTAAAGAATTCAACAAATTAGAAAAAAGGATG 1292 Query 1261 gaaaatttaaataaaaaaGTTGATGATGGATTTCTGGACATTTGGACATATAATGCAGAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1293 GAAAATTTAAATAAAAAAGTTGATGATGGATTTCTGGACATTTGGACATATAATGCAGAA 1352 Query 1321 TTGTTAGTTCTACTGGAAAATGAAAGGACTCTGGATTTCCATGACTCAAATGTGAAGAAT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1353 TTGTTAGTTCTACTGGAAAATGAAAGGACTCTGGATTTCCATGACTCAAATGTGAAGAAT 1412 Query 1381 CTGTATGAGAAAGTAAAAAGCCAATTAAAGAATAATGCCAAAGAAATCGGAAATGGATGT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1413 CTGTATGAGAAAGTAAAAAGCCAATTAAAGAATAATGCCAAAGAAATCGGAAATGGATGT 1472 Query 1441 TTTGAGTTCTACCACAAGTGTGACAATGAATGCATGGAAAGTGTAAGAAATGGGACTTAT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1473 TTTGAGTTCTACCACAAGTGTGACAATGAATGCATGGAAAGTGTAAGAAATGGGACTTAT 1532 Query 1501 GATTATCCCAAATATTCAGAAGAGTCAAAGTTGAACAGGGAAAAGGTAGATGGAGTGAAA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1533 GATTATCCCAAATATTCAGAAGAGTCAAAGTTGAACAGGGAAAAGGTAGATGGAGTGAAA 1592 Query 1561 TTGGAATCAATGGGGATCTATCAGATTCTGGCGATCTACTCAACTGTCGCCAGTTCACTG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1593 TTGGAATCAATGGGGATCTATCAGATTCTGGCGATCTACTCAACTGTCGCCAGTTCACTG 1652 Query 1621 GTGCTTTTGGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGTTCTAATGGATCTTTGCAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1653 GTGCTTTTGGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGTTCTAATGGATCTTTGCAG 1712 Query 1681 TGCAGAATATGCATCTGA 1698 |||||||||||||||||| Sbjct 1713 TGCAGAATATGCATCTGA 1730 Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to AGNIESZKA BOESEN whose telephone number is (571)272-8035. The examiner can normally be reached on 8:30 - 5:00 PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas Visone can be reached on 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AGNIESZKA BOESEN/Primary Examiner, Art Unit 1648
Read full office action

Prosecution Timeline

Jun 30, 2023
Application Filed
Sep 03, 2026
Non-Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12741018
VIRAL PANDEMIC VACCINE
5y 6m to grant Granted Sep 22, 2026
Patent 12735697
METHOD FOR SELECTING ANTIBODY FRAGMENTS, RECOMBINANT ANTIBODIES PRODUCED THEREFROM, AND USES THEREOF
3y 9m to grant Granted Sep 15, 2026
Patent 12729407
MUCINS AND ISOFORMS THEREOF IN DISEASES CHARACTERIZED BY BARRIER DYSFUNCTION
3y 9m to grant Granted Sep 08, 2026
Patent 12721887
VACCINE COMPOSITION COMPRISING PLANT-EXPRESSED RECOMBINANT ZIKA VIRUS ENVELOPE PROTEIN AND PREPARATION METHOD THEREFOR
3y 6m to grant Granted Sep 01, 2026
Patent 12709634
TREATMENT OF DISEASES RELATED TO HEPATITIS B VIRUS
4y 2m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
68%
Grant Probability
90%
With Interview (+21.8%)
3y 2m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 842 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month