Prosecution Insights
Last updated: July 17, 2026
Application No. 18/260,344

GENE THERAPY FOR MONOGENIC DIABETES

Non-Final OA §103§DP
Filed
Jul 05, 2023
Priority
Jan 30, 2021 — EU 21382079.8 +1 more
Examiner
YU, DELPHINUS DOU YI
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITA AUTÒNOMA DE BARCELONA
OA Round
1 (Non-Final)
50%
Grant Probability
Moderate
1-2
OA Rounds
0m
Est. Remaining
50%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allowance Rate
2 granted / 4 resolved
-10.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 4m
Avg Prosecution
35 currently pending
Career history
25
Total Applications
across all art units

Statute-Specific Performance

§103
35.5%
-4.5% vs TC avg
§102
1.6%
-38.4% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 4 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received on 04/09/2026. Claims 1-11, 16-17 are currently pending. Claims 5-6, 16-17 are withdrawn from prosecution as being drawn to nonelected subject matter. Accordingly, claims 1-4, 7-11 are examined herein. The restriction requirement mailed on 02/12/2026 is still deemed proper. Applicant's elected Group I and Species (a) without traverse in the reply filed on 04/09/2026. Election/Restrictions Applicant's election without traverse of Group I (claims 1-11), drawn to a gene construct or expression vector thereof that facilitates expression of a hepatocyte nuclear factor (HNF) in pancreas, and Species (a): a gene construct for expression in the pancreas comprising a nucleotide sequence encoding a hepatocyte nuclear factor (HNF), operably linked to a pancreas-specific promoter in the reply filed on 04/09/2026 is acknowledged. Claims 5-6, 16-17 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Group 2 or Species (b), there being no allowable generic or linking claim. Accordingly, claims 1-4, 7-11 are examined herein. Information Disclosure Statement The listing of references throughout the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Priority Acknowledgment is made of applicant's claim for foreign priority based on an application filed in EP 21382079.8 filed on 01/30/2021. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Specification The disclosure is objected to because it contains an embedded hyperlinks and/or other form of browser-executable code on pages 12 and 13. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the terms Braun, Sigma-Aldrich, Dako, Pierce, Nikon, Eclipse, analysis, Soft Imaging System, Roche/Roche Diagnostics Corp., Gibco, Life Technologies, Biowest, Eppendorf, Histopaque, Fluka, RNAseasy, Qiagen, Nanodrop, ThermoCientific (sic, Thermo Scientific), Transcriptor, SYBR, Invitrogen, Crystal Chem, Cell Signaling, Abcam, ECL Plus, Amersham, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-4, 7-11 are rejected under 35 U.S.C. 103 as being unpatentable over Rezvani (In Vivo Hepatic Reprogramming of Myofibroblasts with AAV Vectors as a Therapeutic Strategy for Liver Fibrosis. Cell Stem Cell. 2016 Jun 2;18(6):809-816) in view of Brunicardi (US20150218555A1, published on 08/06/2015, filed on 04/24/2013), further in view of Fukazawa (Development of a novel beta-cell specific promoter system for the identification of insulin-producing cells in in vitro cell cultures. Exp Cell Res. 2006 Oct 15;312(17):3404-12; Listed on IDS filed on 07/04/2023), Pedersen (The transcription factor HNF1α induces expression of angiotensin-converting enzyme 2 (ACE2) in pancreatic islets from evolutionarily conserved promoter motifs. Biochim Biophys Acta. 2013 Nov;1829(11):1225-35), and Lin (US 2007/0105224 A1, published on 05/10/2007, filed on 11/07/2005). Since HNF1A, HNF-1A, HNF1, HNF1alpha or HNF1α are all synonyms of the same gene or protein known in the art, as evidenced by NCBI (NCBI_2020_HNF1A.pdf attached and listed in PTO-892; Published in 2020), despite the different terms used in different prior arts, HNF1A will be used herein. Rezvani (2016) teaches a gene construct for expression in the pancreas comprising a nucleotide sequence encoding a hepatocyte nuclear factor (HNF) by reciting “Hnf1a: GC-Mm21209 and Hnf4a: GC-Mm03071” in the Supplemental methods section under the “AAV-TF vector construction” section on page 826, 2nd¶, line 2-3. Rezvani does not teach that the gene construct is operably linked to a pancreas-specific promoter. Rezvani also does not teach specific HNF1 or HNF1A sequence that has been validated to express the functional HNF1 or HNF1A protein in a gene construct or a viral vector. However, Brunicardi (2015) teaches “a synthetic promoter and a nucleic acid operably linked to this promoter that regulates the expression of this exogenous nucleic acid” (Page 1, ¶[0009]), “the nucleic acid construct includes a synthetic promoter designed using selected PDX-1 activation sites such as those observed in the human insulin promoter (HIP)” (Abstract, lines 3-6), and “demonstrate that a pancreas homing platform using the BL promoter” (Page 2, ¶[0016]), which is interpreted as a “pancreas-specific promoter” in view of Fukazawa (2006) in that Fukazawa teaches a pancreas islet “β-cell specific promoter system” for targeting “insulin-producing cells” (Page 3404, Title) and show that the -363 to -1 fragment of human insulin promoter (HIP) contains transcription factor binding motifs (Page 3405, Fig. 1; See below) that confer “β-cell specific transactivation” (Page 3406, Fig. 2C). PNG media_image1.png 292 1492 media_image1.png Greyscale None of Rezvani (2016), Brunicardi (2015), or Fukazawa (2006) teach why would anyone operatively link a nucleotide sequence encoding a hepatocyte nuclear factor (HNF) with a pancreas specific promoter. And None of Rezvani (2016), Brunicardi (2015), or Fukazawa (2006) teach a specific HNF sequence that has been validated to express the functional HNF1 or HNF1A protein in a gene construct or a viral vector. However, Pedersen (2013) teaches that “A deficient allele of HNF1α or HNF1β causes maturity-onset diabetes of the young (MODY) types 3 and 5, respectively, in humans” and “Pancreatic angiotensin converting enzyme 2 (ACE2) has previously been shown to be critical for maintaining glycemia and β-cell function. Efforts to maintain or increase ACE2 expression in pancreatic β-cells might therefore have therapeutic potential for treating diabetes” and “conclude that HNF1α can induce the expression of ACE2 in pancreatic islet cells via evolutionarily conserved HNF1 binding sites in the ACE2 promoter. Potential therapeutics aimed at counteracting functional HNF1α depletion in diabetes and MODY3 will thus have ACE2 induction in pancreatic islets as a likely beneficial effect” (Page 1225, Abstract). Hence, Pedersen provides motivation to design a gene construction for pancreas-specific expression comprising a nucleotide sequence encoding a HNF, operably linked to a pancreas-specific promoter, in order to induce pancreas-specific expression of a HNF to boost ACE2 levels specifically in pancreas islets and β-cells, which in turn maintains glycemia and β-cell function and potentially treats MODY types 3 and 5. Lin (2007), however, teaches specific coding nucleic acid sequence for HNF1 or HNF1A (SEQ ID NO: 1 for both nucleic acid and amino acid sequences, or SEQ ID NO: 2 for just the amino acid sequence) in a retroviral expression vector for genetic modification of liver cells to enhance metabolic and physiological efficacy (Front page, Abstract; Page 1, ¶[0003], lines 6-10), thereby providing results that support functional HNF protein expression in a gene construct or a viral vector known in the art (Page 1, ¶[0009]-¶[0017]; FIG. 1-FIG. 9). It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to have modified the gene construct of Rezvani by operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, motivated by the discoveries by Pedersen, to address the deficiency of HNF expression in pancreas to explore the therapeutic potentials for MODY types 3 or 5. PHOSITAs could have been further motivated to modify the gene construct using the coding sequence of HNF1A validated by Lin, to enhance reasonable expectation of success because of the success in the expression of HNF gene constructs and viral vectors demonstrated by Lin. PHOSITAs could have combined the teachings, strategies, and motivations from Rezvani, Brunicardi, Fukazawa, Pedersen, and Lin outlined above and would have constructed the gene constructs and viral vectors to specifically investigate the potential role of a HNF replacement gene therapy for MODY type 3 or 5 because of the loss-of-function mutations in HNF proteins observed in these disease types, and would have arrived at the claimed gene constructs and vectors with reasonable expectation of success. Regarding claim 1, the combined teachings, strategies, and motivations of Rezvani, Brunicardi, Fukazawa, and Pedersen would have provided at least directions and motivations to explore the therapeutic potentials of targeted transfection of gene constructs that facilitate pancreas-specific HNF expression in islets and insulin producing cell types to treat MODY types 3 and 5. Regarding claim 2, both Brunicardi and Fukazawa teach human insulin promoter and/or derivatives thereof that comprise PDX-1 activation sites or binding sites as discussed above. Regarding claim 3, both Brunicardi and Fukazawa teach human insulin promoter or derivative thereof as discussed above. Regarding claim 4, the transitional phrases “comprises, consists essentially of or consists of” is interpreted as “comprising” under the broadest reasonable interpretation (BRI). Furthermore, the clause after “and/or” is interpreted as “not required”. Brunicardi further teaches “methods for regulating expression of an exogenous protein in one or more cells by providing an expression vector comprising a BL promoter and an exogenous nucleic acid fragment operably linked to the BL promoter, wherein the BL promoter regulates the expression of an exogenous nucleic acid fragment” (Page 1, ¶[0010]) and “FIGURE 1C a sequence of the BL1 promoter sequence showing the promoter elements SEQ ID NO: 2” (Page 2, ¶[0023]), wherein, SEQ ID NO: 2 of Brunicardi comprises a 385nt segment that aligns 100% with the claimed SEQ ID NO: 20 of the instant application, which is also the -385 to -1 fragment of SEQ ID NO: 18 of the instant application. Although the SEQ ID NO: 1 of Brunicardi is also named BL1, it has a sequence that does not align 100% with SEQ ID NO: 2, however, since Brunicardi does not distinguish these two sequences when demonstrating the enhanced gene expression using BL1 (or BL-1) promoter in Figure 3 (Page, ¶[0079] & ¶[0083]), PHOSITAs would have used both gene constructs and variants to determine which performs better, and at least some embodiments of these gene constructs would have comprised SEQ ID NO: 2 of Brunicardi, and arrive at the claimed invention with reasonable expectation of success because of Brunicardi’s success in enhancing transgene expression (Figure 3). Query: Instant SEQ ID NO: 20; Sbjct: SEQ ID NO: 2 of Brunicardi: Query 1 TGTGGGGACAGGGGTCTGGGGACAGCAGCGCAAAGAGCCCCGCCCTGCAGCCTCCAGCTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 TGTGGGGACAGGGGTCTGGGGACAGCAGCGCAAAGAGCCCCGCCCTGCAGCCTCCAGCTC 180 Query 61 TCCTGGTCTAATGTGGAAAGTGGCCCAGGTGAGGGCTTTGCTCTCCTGGAGACATTTGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 TCCTGGTCTAATGTGGAAAGTGGCCCAGGTGAGGGCTTTGCTCTCCTGGAGACATTTGCC 240 Query 121 CCCAGCTGTGAGCAGGGACAGGTCTGGCCACCGGGCCCCTGGTTAAGACTCTAATGACCC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 CCCAGCTGTGAGCAGGGACAGGTCTGGCCACCGGGCCCCTGGTTAAGACTCTAATGACCC 300 Query 181 GCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGATCTTCCCACAGACCCAGCACCAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGATCTTCCCACAGACCCAGCACCAG 360 Query 241 GGAAATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGAcccccccACCCCAG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 GGAAATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGACCCCCCCACCCCAG 420 Query 301 GCCCTAATGGGCCAGGCGGCAGGGGTTGAGAGGTAGGGGAGATGGGCTCTGAGACTATAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 GCCCTAATGGGCCAGGCGGCAGGGGTTGAGAGGTAGGGGAGATGGGCTCTGAGACTATAA 480 Query 361 AGCCAGCGGGGGCCCAGCAGCCCTC 385 ||||||||||||||||||||||||| Sbjct 481 AGCCAGCGGGGGCCCAGCAGCCCTC 505 Regarding claim 7, HNF1A and HNF1α are synonyms, as evidenced by NCBI (2020), and is interpreted to encompass HNF1A orthologs of all mammalian species, e.g. murine Hnf1a or Hnf1α, under BRI because species is not limited by the claim, nor is it limited by the specification based on the teaching of the instant specification on page 5, lines 20-24. Rezvani (2016) teaches a gene construct for expression comprising a nucleotide sequence encoding a hepatocyte nuclear factor (HNF) by reciting “Hnf1a: GC-Mm21209 and Hnf4a: GC-Mm03071” in the Supplemental methods section under the “AAV-TF vector construction” section (page 826, 2nd¶, line 2-3). Pedersen teaches adenovirus vector comprising HNF1α coding sequence (Page 1226, section 2.4 Plasmids and adenovirus, last two lines). Regarding claim 8, Lin further teaches a 631 amino acid protein sequence for HNF1A (SEQ ID NO: 2), which is a 100% perfect match for the claimed instant SEQ ID NO: 1. See the alignment below: Query: Instant SEQ ID NO: 1 Sbjct: SEQ ID NO: 2 of Lin (2007). Query 1 METVALSERLYSLEUSERGLNLEUGLNTHRGLULEULEUALAALALEULEUGLUSERGLY 60 METVALSERLYSLEUSERGLNLEUGLNTHRGLULEULEUALAALALEULEUGLUSERGLY Sbjct 1 METVALSERLYSLEUSERGLNLEUGLNTHRGLULEULEUALAALALEULEUGLUSERGLY 60 Query 61 LEUSERLYSGLUALALEUILEGLNALALEUGLYGLUPROGLYPROTYRLEULEUALAGLY 120 LEUSERLYSGLUALALEUILEGLNALALEUGLYGLUPROGLYPROTYRLEULEUALAGLY Sbjct 61 LEUSERLYSGLUALALEUILEGLNALALEUGLYGLUPROGLYPROTYRLEULEUALAGLY 120 Query 121 GLUGLYPROLEUASPLYSGLYGLUSERCYSGLYGLYGLYARGGLYGLULEUALAGLULEU 180 GLUGLYPROLEUASPLYSGLYGLUSERCYSGLYGLYGLYARGGLYGLULEUALAGLULEU Sbjct 121 GLUGLYPROLEUASPLYSGLYGLUSERCYSGLYGLYGLYARGGLYGLULEUALAGLULEU 180 Query 181 PROASNGLYLEUGLYGLUTHRARGGLYSERGLUASPGLUTHRASPASPASPGLYGLUASP 240 PROASNGLYLEUGLYGLUTHRARGGLYSERGLUASPGLUTHRASPASPASPGLYGLUASP Sbjct 181 PROASNGLYLEUGLYGLUTHRARGGLYSERGLUASPGLUTHRASPASPASPGLYGLUASP 240 Query 241 PHETHRPROPROILELEULYSGLULEUGLUASNLEUSERPROGLUGLUALAALAHISGLN 300 PHETHRPROPROILELEULYSGLULEUGLUASNLEUSERPROGLUGLUALAALAHISGLN Sbjct 241 PHETHRPROPROILELEULYSGLULEUGLUASNLEUSERPROGLUGLUALAALAHISGLN 300 Query 301 LYSALAVALVALGLUTHRLEULEUGLNGLUASPPROTRPARGVALALALYSMETVALLYS 360 LYSALAVALVALGLUTHRLEULEUGLNGLUASPPROTRPARGVALALALYSMETVALLYS Sbjct 301 LYSALAVALVALGLUTHRLEULEUGLNGLUASPPROTRPARGVALALALYSMETVALLYS 360 Query 361 SERTYRLEUGLNGLNHISASNILEPROGLNARGGLUVALVALASPTHRTHRGLYLEUASN 420 SERTYRLEUGLNGLNHISASNILEPROGLNARGGLUVALVALASPTHRTHRGLYLEUASN Sbjct 361 SERTYRLEUGLNGLNHISASNILEPROGLNARGGLUVALVALASPTHRTHRGLYLEUASN 420 Query 421 GLNSERHISLEUSERGLNHISLEUASNLYSGLYTHRPROMETLYSTHRGLNLYSARGALA 480 GLNSERHISLEUSERGLNHISLEUASNLYSGLYTHRPROMETLYSTHRGLNLYSARGALA Sbjct 421 GLNSERHISLEUSERGLNHISLEUASNLYSGLYTHRPROMETLYSTHRGLNLYSARGALA 480 Query 481 ALALEUTYRTHRTRPTYRVALARGLYSGLNARGGLUVALALAGLNGLNPHETHRHISALA 540 ALALEUTYRTHRTRPTYRVALARGLYSGLNARGGLUVALALAGLNGLNPHETHRHISALA Sbjct 481 ALALEUTYRTHRTRPTYRVALARGLYSGLNARGGLUVALALAGLNGLNPHETHRHISALA 540 Query 541 GLYGLNGLYGLYLEUILEGLUGLUPROTHRGLYASPGLULEUPROTHRLYSLYSGLYARG 600 GLYGLNGLYGLYLEUILEGLUGLUPROTHRGLYASPGLULEUPROTHRLYSLYSGLYARG Sbjct 541 GLYGLNGLYGLYLEUILEGLUGLUPROTHRGLYASPGLULEUPROTHRLYSLYSGLYARG 600 Query 601 ARGASNARGPHELYSTRPGLYPROALASERGLNGLNILELEUPHEGLNALATYRGLUARG 660 ARGASNARGPHELYSTRPGLYPROALASERGLNGLNILELEUPHEGLNALATYRGLUARG Sbjct 601 ARGASNARGPHELYSTRPGLYPROALASERGLNGLNILELEUPHEGLNALATYRGLUARG 660 Query 661 GLNLYSASNPROSERLYSGLUGLUARGGLUTHRLEUVALGLUGLUCYSASNARGALAGLU 720 GLNLYSASNPROSERLYSGLUGLUARGGLUTHRLEUVALGLUGLUCYSASNARGALAGLU Sbjct 661 GLNLYSASNPROSERLYSGLUGLUARGGLUTHRLEUVALGLUGLUCYSASNARGALAGLU 720 Query 721 CYSILEGLNARGGLYVALSERPROSERGLNALAGLNGLYLEUGLYSERASNLEUVALTHR 780 CYSILEGLNARGGLYVALSERPROSERGLNALAGLNGLYLEUGLYSERASNLEUVALTHR Sbjct 721 CYSILEGLNARGGLYVALSERPROSERGLNALAGLNGLYLEUGLYSERASNLEUVALTHR 780 Query 781 GLUVALARGVALTYRASNTRPPHEALAASNARGARGLYSGLUGLUALAPHEARGHISLYS 840 GLUVALARGVALTYRASNTRPPHEALAASNARGARGLYSGLUGLUALAPHEARGHISLYS Sbjct 781 GLUVALARGVALTYRASNTRPPHEALAASNARGARGLYSGLUGLUALAPHEARGHISLYS 840 Query 841 LEUALAMETASPTHRTYRSERGLYPROPROPROGLYPROGLYPROGLYPROALALEUPRO 900 LEUALAMETASPTHRTYRSERGLYPROPROPROGLYPROGLYPROGLYPROALALEUPRO Sbjct 841 LEUALAMETASPTHRTYRSERGLYPROPROPROGLYPROGLYPROGLYPROALALEUPRO 900 Query 901 ALAHISSERSERPROGLYLEUPROPROPROALALEUSERPROSERLYSVALHISGLYVAL 960 ALAHISSERSERPROGLYLEUPROPROPROALALEUSERPROSERLYSVALHISGLYVAL Sbjct 901 ALAHISSERSERPROGLYLEUPROPROPROALALEUSERPROSERLYSVALHISGLYVAL 960 Query 961 ARGTYRGLYGLNPROALATHRSERGLUTHRALAGLUVALPROSERSERSERGLYGLYPRO 1020 ARGTYRGLYGLNPROALATHRSERGLUTHRALAGLUVALPROSERSERSERGLYGLYPRO Sbjct 961 ARGTYRGLYGLNPROALATHRSERGLUTHRALAGLUVALPROSERSERSERGLYGLYPRO 1020 Query 1021 LEUVALTHRVALSERTHRPROLEUHISGLNVALSERPROTHRGLYLEUGLUPROSERHIS 1080 LEUVALTHRVALSERTHRPROLEUHISGLNVALSERPROTHRGLYLEUGLUPROSERHIS Sbjct 1021 LEUVALTHRVALSERTHRPROLEUHISGLNVALSERPROTHRGLYLEUGLUPROSERHIS 1080 Query 1081 SERLEULEUSERTHRGLUALALYSLEUVALSERALAALAGLYGLYPROLEUPROPROVAL 1140 SERLEULEUSERTHRGLUALALYSLEUVALSERALAALAGLYGLYPROLEUPROPROVAL Sbjct 1081 SERLEULEUSERTHRGLUALALYSLEUVALSERALAALAGLYGLYPROLEUPROPROVAL 1140 Query 1141 SERTHRLEUTHRALALEUHISSERLEUGLUGLNTHRSERPROGLYLEUASNGLNGLNPRO 1200 SERTHRLEUTHRALALEUHISSERLEUGLUGLNTHRSERPROGLYLEUASNGLNGLNPRO Sbjct 1141 SERTHRLEUTHRALALEUHISSERLEUGLUGLNTHRSERPROGLYLEUASNGLNGLNPRO 1200 Query 1201 GLNASNLEUILEMETALASERLEUPROGLYVALMETTHRILEGLYPROGLYGLUPROALA 1260 GLNASNLEUILEMETALASERLEUPROGLYVALMETTHRILEGLYPROGLYGLUPROALA Sbjct 1201 GLNASNLEUILEMETALASERLEUPROGLYVALMETTHRILEGLYPROGLYGLUPROALA 1260 Query 1261 SERLEUGLYPROTHRPHETHRASNTHRGLYALASERTHRLEUVALILEGLYLEUALASER 1320 SERLEUGLYPROTHRPHETHRASNTHRGLYALASERTHRLEUVALILEGLYLEUALASER Sbjct 1261 SERLEUGLYPROTHRPHETHRASNTHRGLYALASERTHRLEUVALILEGLYLEUALASER 1320 Query 1321 THRGLNALAGLNSERVALPROVALILEASNSERMETGLYSERSERLEUTHRTHRLEUGLN 1380 THRGLNALAGLNSERVALPROVALILEASNSERMETGLYSERSERLEUTHRTHRLEUGLN Sbjct 1321 THRGLNALAGLNSERVALPROVALILEASNSERMETGLYSERSERLEUTHRTHRLEUGLN 1380 Query 1381 PROVALGLNPHESERGLNPROLEUHISPROSERTYRGLNGLNPROLEUMETPROPROVAL 1440 PROVALGLNPHESERGLNPROLEUHISPROSERTYRGLNGLNPROLEUMETPROPROVAL Sbjct 1381 PROVALGLNPHESERGLNPROLEUHISPROSERTYRGLNGLNPROLEUMETPROPROVAL 1440 Query 1441 GLNSERHISVALTHRGLNSERPROPHEMETALATHRMETALAGLNLEUGLNSERPROHIS 1500 GLNSERHISVALTHRGLNSERPROPHEMETALATHRMETALAGLNLEUGLNSERPROHIS Sbjct 1441 GLNSERHISVALTHRGLNSERPROPHEMETALATHRMETALAGLNLEUGLNSERPROHIS 1500 Query 1501 ALALEUTYRSERHISLYSPROGLUVALALAGLNTYRTHRHISTHRGLYLEULEUPROGLN 1560 ALALEUTYRSERHISLYSPROGLUVALALAGLNTYRTHRHISTHRGLYLEULEUPROGLN Sbjct 1501 ALALEUTYRSERHISLYSPROGLUVALALAGLNTYRTHRHISTHRGLYLEULEUPROGLN 1560 Query 1561 THRMETLEUILETHRASPTHRTHRASNLEUSERALALEUALASERLEUTHRPROTHRLYS 1620 THRMETLEUILETHRASPTHRTHRASNLEUSERALALEUALASERLEUTHRPROTHRLYS Sbjct 1561 THRMETLEUILETHRASPTHRTHRASNLEUSERALALEUALASERLEUTHRPROTHRLYS 1620 Query 1621 GLNVALPHETHRSERASPTHRGLUALASERSERGLUSERGLYLEUHISTHRPROALASER 1680 GLNVALPHETHRSERASPTHRGLUALASERSERGLUSERGLYLEUHISTHRPROALASER Sbjct 1621 GLNVALPHETHRSERASPTHRGLUALASERSERGLUSERGLYLEUHISTHRPROALASER 1680 Query 1681 GLNALATHRTHRLEUHISVALPROSERGLNASPPROALAGLYILEGLNHISLEUGLNPRO 1740 GLNALATHRTHRLEUHISVALPROSERGLNASPPROALAGLYILEGLNHISLEUGLNPRO Sbjct 1681 GLNALATHRTHRLEUHISVALPROSERGLNASPPROALAGLYILEGLNHISLEUGLNPRO 1740 Query 1741 ALAHISARGLEUSERALASERPROTHRVALSERSERSERSERLEUVALLEUTYRGLNSER 1800 ALAHISARGLEUSERALASERPROTHRVALSERSERSERSERLEUVALLEUTYRGLNSER Sbjct 1741 ALAHISARGLEUSERALASERPROTHRVALSERSERSERSERLEUVALLEUTYRGLNSER 1800 Query 1801 SERASPSERSERASNGLYGLNSERHISLEULEUPROSERASNHISSERVALILEGLUTHR 1860 SERASPSERSERASNGLYGLNSERHISLEULEUPROSERASNHISSERVALILEGLUTHR Sbjct 1801 SERASPSERSERASNGLYGLNSERHISLEULEUPROSERASNHISSERVALILEGLUTHR 1860 Query 1861 PHEILESERTHRGLNMETALASERSERSERGLN 1893 PHEILESERTHRGLNMETALASERSERSERGLN Sbjct 1861 PHEILESERTHRGLNMETALASERSERSERGLN 1893 Regarding claim 9, Rezvani further teaches developing “in vivo reprogramming … using adeno associated virus (AAV) vectors expressing hepatic transcription factors …” (Page 810, Abstract, lines 9-12), including “TF genes Foxa1, Foxa2, Foxa3, Gata4, Hnf1a, or Hnf4a” (Page 811, last ¶, line 2). As discussed above, Hnf1a is one embodiment or synonym of HNF1A. Regarding claim 10, Rezvani further teaches adeno-associated viral (AAV) vectors (Page 810, Title; Abstract; Page 811, 2nd ¶, under Results). Regarding claim 11, Rezvani further teaches screening targeted AAV expression levels using naturally occurring “AAV2, AAV5, AAV6, AAV7, AAV8, and AAV9” serotypes, as well as AAV vectors with “engineered capsids AAV1P4 (seven amino-acid re-targeting peptide displayed in an exposed capsid loop), AAV2(Y444,500,730F) (mutation of three exposed tyrosines to phenylalanines), and AAV-DJ (chimera of AAV2/8/9)”, which resulted in the selection of AAV6 (Page 811, 2nd ¶, lines 3-12; Figure 1). Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. US Patent US 10,617,771 B2 Claims 1-4, 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-6 of U.S. Patent No. US 10,617,771 B2, in view of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007). Although the claims at issue are not identical, they are not patentably distinct from each other. US 10,617,771 B2 teaches gene constructs, AAV vectors, pharmaceutical compositions comprising said AAV vectors encoding iduronate-2-sulfatase ( IDS ) enzyme (columns 83, 84, claims 1-6). US 10,617,771 B2 does not teach pancreas-specific promoter system operably linked to a nucleic acid encoding a HNF. However, the collective teachings of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), already discussed above in the §103 rejection, provide pancreas-specific human insulin promoter (HIP) designs using fragments of HIP or tandem repeats of said fragments to confer pancreas-specific HNF expression, particularly in islet insulin producing β-cells. It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of US 10,617,771 B2, Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), could then have modified the gene construct of US 10,617,771 B2 by operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, as evidenced by NCBI, with the coding sequence of HNF1A, taught by Lin, to address the deficiency of HNF expression in pancreas islet insulin producing cell types to explore the therapeutic potentials for MODY types 3 or 5 based on the discoveries and motivations taught by Pedersen, and would have arrived at the claimed invention. Claims 1, 9-11 correspond to the claims 1-6 of US 10,617,771 B2. US Patent US 10,711,281 B2 Claims 1-4, 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-10, 16-19 of U.S. Patent No. US 10,711,281 B2, in view of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007). Although the claims at issue are not identical, they are not patentably distinct from each other. US 10,711,281 B2 teaches AAV vectors for tissue-specific gene transduction (Front page, Title), and contemplates HNF-4 transduction (Column 19, line 5). US 10,711,281 B2 does not teach pancreas-specific promoter system operably linked to a nucleic acid encoding a HNF. However, the collective teachings of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), already discussed above in the §103 rejection, provide pancreas-specific human insulin promoter (HIP) designs using fragments of HIP or tandem repeats of said fragments to confer pancreas-specific HNF expression, particularly in islet insulin producing β-cells. It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of US 10,711,281 B2, Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), could then have modified the gene construct of US 10,711,281 B2 by operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, as evidenced by NCBI, with the coding sequence of HNF1A, taught by Lin, to address the deficiency of HNF expression in pancreas islet insulin producing cell types to explore the therapeutic potentials for MODY types 3 or 5 based on the discoveries and motivations taught by Pedersen, and would have arrived at the claimed invention. Claims 1, 9-11 correspond to the claims 1-10, 16-19 of US 10,711,281 B2. US Patent US 10,973,931 B2 Claims 1-4, 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 8, 14 of U.S. Patent No. US 10,973,931 B2, in view of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007). Although the claims at issue are not identical, they are not patentably distinct from each other. US 10,973,931 B2teaches a method of treatment and/or prevention of obesity, insulin resistance, type 2 diabetes, liver cirrhosis and/or non-alcoholic fatty liver disease (NAFLD)/non-alcoholic steatohepatitis (NASH) wherein an adeno-associated viral vector is administered … (Column 47, Claim 1). US 10,973,931 B2 does not teach pancreas-specific promoter system operably linked to a nucleic acid encoding a HNF. However, the collective teachings of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), already discussed above in the §103 rejection, provide pancreas-specific human insulin promoter (HIP) designs using fragments of HIP or tandem repeats of said fragments to confer pancreas-specific HNF expression, particularly in islet insulin producing β-cells. It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of US 10,973,931 B2, Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), could then have modified the gene construct of US 10,973,931 B2 by operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, as evidenced by NCBI, with the coding sequence of HNF1A, taught by Lin, to address the deficiency of HNF expression in pancreas islet insulin producing cell types to explore the therapeutic potentials for MODY types 3 or 5 based on the discoveries and motivations taught by Pedersen, and would have arrived at the claimed invention. Claims 1, 9-11 correspond to the claims 1, 8, 14 of US 10,973,931 B2. US Patent US 12,146,169 B2 Claims 1-4, 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-9 of U.S. Patent No. US 12,146,169 B2, in view of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007). Although the claims at issue are not identical, they are not patentably distinct from each other. US 12,146,169 B2 teaches gene constructs, AAV vectors and pharmaceutical compositions for the treatment of mucopolysaccharidoses type IV A (Front page, Title). US 12,146,169 B2 does not teach pancreas-specific promoter system operably linked to a nucleic acid encoding a HNF. However, the collective teachings of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), already discussed above in the §103 rejection, provide pancreas-specific human insulin promoter (HIP) designs using fragments of HIP or tandem repeats of said fragments to confer pancreas-specific HNF expression, particularly in islet insulin producing β-cells. It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of US 12,146,169 B2, Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), could then have modified the gene construct of US 12,146,169 B2 by operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, as evidenced by NCBI, with the coding sequence of HNF1A, taught by Lin, to address the deficiency of HNF expression in pancreas islet insulin producing cell types to explore the therapeutic potentials for MODY types 3 or 5 based on the discoveries and motivations taught by Pedersen, and would have arrived at the claimed invention. Claims 1, 9-11 correspond to the claims 1-9 of US 12,146,169 B2. US Patent US 12,398,403 B2 Claims 1-4, 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-10 of U.S. Patent No. US 12,398,403 B2, in view of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007). Although the claims at issue are not identical, they are not patentably distinct from each other. US 12,398,403 B2 teaches a method of manufacturing AAV vectors (Front page, Title). US 12,398,403 B2 does not teach pancreas-specific promoter system operably linked to a nucleic acid encoding a HNF. However, the collective teachings of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), already discussed above in the §103 rejection, provide pancreas-specific human insulin promoter (HIP) designs using fragments of HIP or tandem repeats of said fragments to confer pancreas-specific HNF expression, particularly in islet insulin producing β-cells. It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of US 12,398,403 B2, Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), could then have modified the gene construct and AAV vectors of US 12,398,403 B2 by operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, as evidenced by NCBI, with the coding sequence of HNF1A, taught by Lin, to address the deficiency of HNF expression in pancreas islet insulin producing cell types to explore the therapeutic potentials for MODY types 3 or 5 based on the discoveries and motivations taught by Pedersen, and would have arrived at the claimed invention. Claims 1, 9-11correspond to the claims 1-10 of US 12,398,403 B2. US Patent US 12,629,429 B2 Claims 1-4, 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 10, 15-17 of U.S. Patent No. US 12,629,429 B2, in view of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007). Although the claims at issue are not identical, they are not patentably distinct from each other. US 12,629,429 B2 teaches a method of diabetes gene therapy comprising administering AAV vectors for tissue-specific gene transduction (Front page, Title). US 12,629,429 B2 does not teach pancreas-specific promoter system operably linked to a nucleic acid encoding a HNF. However, the collective teachings of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), already discussed above in the §103 rejection, provide pancreas-specific human insulin promoter (HIP) designs using fragments of HIP or tandem repeats of said fragments to confer pancreas-specific HNF expression, particularly in islet insulin producing β-cells. It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of US 12,629,429 B2, Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), could then have modified the gene construct of US 12,629,429 B2 by operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, as evidenced by NCBI, with the coding sequence of HNF1A, taught by Lin, to address the deficiency of HNF expression in pancreas islet insulin producing cell types to explore the therapeutic potentials for MODY types 3 or 5 based on the discoveries and motivations taught by Pedersen, and would have arrived at the claimed invention. Claims 1, 9-11 correspond to the claims 1, 10, 15-17 of US 12,629,429 B2. US Application 18/003,980 Claims 1-4, 7-11 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the claims 92-94, 102-105, 122-126 of 18/003,980 in view of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007). Although the claims at issue are not identical, they are not patentably distinct from each other. 18/003,980 teaches AAV-based gene constructs and vectors for targeted transgene delivery and gene therapies to treat diabetes. Co-pending claims of 18/003,980 do not teach pancreas-specific promoter system operably linked to a nucleic acid encoding a HNF. However, the collective teachings of 18/003,980, Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), already discussed above in the §103 rejection, provide pancreas-specific human insulin promoter (HIP) designs using fragments of HIP or tandem repeats of said fragments to confer pancreas-specific HNF expression, particularly in islet insulin producing β-cells. It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), and 18/003,980, could then have modified the gene construct of 18/003,980 operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, with the coding sequence of HNF1A, taught by Lin, to address the deficiency of HNF expression in pancreas islet insulin producing cell types to explore the therapeutic potentials for MODY types 3 or 5 based on the discoveries and motivations taught by Pedersen, and would have arrived at the claimed invention. Claims 1, 9-11 correspond to the claims 92-94, 102-105, 122-126 of 18/003,980. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. US Application 19/431,912 Claims 1-4, 7-11 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the claims 52-54, 71, 78-81 of 19/431,912 in view of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007). Although the claims at issue are not identical, they are not patentably distinct from each other. US application 19/431,912 teaches AAV-based gene constructs and vectors for targeted transgene delivery and gene therapies. Co-pending claims of 19/431,912 do not teach pancreas-specific promoter system operably linked to a nucleic acid encoding a HNF. However, the collective teachings of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), already discussed above in the §103 rejection, provide pancreas-specific human insulin promoter (HIP) designs using fragments of HIP or tandem repeats of said fragments to confer pancreas-specific HNF expression, particularly in islet insulin producing β-cells. It would have been obvious for persons of ordinary skill in the art (PHOSITAs) to combine the teachings, strategies, and motivations of Brunicardi (2013), Fukazawa (2006), Pedersen (2013), and Lin (2007), and 19/431,912, could then have modified the gene construct of 19/431,912 by operably linking a pancreas-specific promoter system taught by Brunicardi and Fukazawa, with the coding sequence of HNF1A, taught by Lin, to address the deficiency of HNF expression in pancreas islet insulin producing cell types to explore the therapeutic potentials for MODY types 3 or 5 based on the discoveries and motivations taught by Pedersen, and would have arrived at the claimed invention. Claims 1, 9-11 correspond to the claims 52-54, 71, 78-81 of 19/431,912. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DELPHINUS DOU YI YU/Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jul 05, 2023
Application Filed
Jun 11, 2026
Non-Final Rejection mailed — §103, §DP (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
50%
Grant Probability
50%
With Interview (+0.0%)
2y 4m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 4 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month