Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
2. Applicant’s response filed on 06/19/2026 is acknowledged.
3. Claims 1, 14-23, 25-26 and 29-30 are pending.
4. Applicant's election with traverse of Group I, claims 1, 14-16, 18 and 29 and the species of the nucleic acid encoding SEQ ID NO:47 and T cells from a healthy donor in the reply filed on 06/19/2026 is acknowledged. The traversal is on the ground(s) that “Applicant respectfully submits that the claims of Group I are directed to nucleic acids and vectors encoding a CAR, modified cells comprising the nucleic acids, vectors, and CAR encoded by the nucleic acids and Vectors, and the claims of Group II are directed to a CAR and modified cells comprising the CAR. The claims of Group I and II are related as nucleic acids, CAR encoded by the nucleic acids, and cells comprising the nucleic acids and cells. Moreover, the claims of Group III are related to the claims of Groups I and II as methods of using the cells of Groups I and II. Accordingly, the search for the invention of Group I would result in finding relevant art for Groups Il and III. Therefore, it would not be a serious burden to search and examine the claims of Groups I, II, and III in this application. Further, Applicant respectfully submits that claims 19-23 and 30 of Group II are directed to modified cells comprising the nucleic acids of claim 1, as they comprise the CAR encoded by the nucleic acids of claim 1. Therefore, Applicant respectfully requests that, at a minimum, claims 19-23 and 30 be rejoined with the claims of Group I for search and examination.” This is not found persuasive because searches of proteins and nucleic acids are different and require the examiner to go through all of the searches looking for prior art. In addition, proteins and nucleic acids have different 112, first paragraph considerations. It is both a burden to search, examine and prepare an office action on two different groups.
The requirement is still deemed proper and is therefore made FINAL.
5. Claims 17, 19-23, 25-26 and 30 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected group, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 06/19/2026.
6. Claims 1, 14-16, 18 and 29 are under consideration as they read on a nucleic acid encoding SEQ ID NO:47.
7. Applicant’s IDS document filed on 07/05/2023 has been considered.
8. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
9. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
10. Claims 1, 14-16, 18 and 29 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by U.S. Patent Application Publication 2021/0060069 (PTO-892; Reference A) as evidenced by the attached sequence alignment.
U.S. Patent Application Publication 2021/0060069 teaches a nucleic acid encoding the CLDN18.2 CAR of reference SEQ ID NOs 439 and 452 which are 100% sequence identical to instant SEQ ID NO:47 (In particular, Table 2). The reference teaches the use of the nucleic acid in a vector and in a modified T cell. (In particular, paragraph [0088], [0092], whole document).
PNG
media_image1.png
59
268
media_image1.png
Greyscale
The recitations of claims 14-15 are encompassed by reference SEQ ID NOs 439 and 452.
The reference teachings anticipate the claimed invention.
11. Claims 1, 14-16, 18 and 29 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by U.S. Patent Application Publication 2021/0100841 (PTO-892; Reference B) as evidenced by the attached sequence alignment.
U.S. Patent Application Publication 2021/0100841 teaches a nucleic acid encoding the CLDN18.2 CAR of reference SEQ ID NOs 290 and 277 which are 100% sequence identical to instant SEQ ID NO:47. The reference teaches the use of the nucleic acid in a vector and in a modified T cell. (In particular, claims, whole document).
The recitations of claims 14-15 are encompassed by reference SEQ ID NOs 290 and 277.
The reference teachings anticipate the claimed invention.
12. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
13. Claims 1, 14-16, 18 and 29 are rejected under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over WO 2018/102795 (PTO-892; Reference N) as evidenced by the attached sequence alignment.
WO 2018/102795 teaches the nucleic acid of reference SEQ ID NO:17706 which encodes amino acids 1-469 of instant SEQ ID NO:47. Reference SEQ ID NO:17706 further comprises the nucleic acids “ACGCGTGAGCAGAAACTGATCTCGGAAGAGGATCTGGCGAAGCCC” which encodes a c-Myc tag but reference SEQ ID NO:17706 still “encodes” instant SEQ ID NO:47.
The reference teaches the nucleic acids for use in vectors and cells including T-cells. (In particular, claims, whole document).
The recitations of claims 14-15 are encompassed by reference SEQ ID NO:17706.
The reference teachings anticipate the claimed invention.
14. Claims 1, 14-16, 18 and 29 are rejected under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over WO 2019/067805 (PTO-892; Reference O) as evidenced by the attached sequence alignment.
WO 2019/067805 teaches the nucleic acid of reference SEQ ID NO:1589 which encodes amino acids 1-469 of instant SEQ ID NO:47. Reference SEQ ID NO:1589 further comprises the nucleic acids “ACGCGTGAGCAGAAACTGATCTCGGAAGAGGATCTGGCGAAGCCC” which encodes a c-Myc tag but reference SEQ ID NO:1589 still “encodes” instant SEQ ID NO:47.
The reference teaches the nucleic acids for use in vectors and cells including T-cells. (In particular, claims, whole document).
The recitations of claims 14-15 are encompassed by reference SEQ ID NO:1589.
The reference teachings anticipate the claimed invention.
15. No claim is allowed.
16. Any inquiry concerning this communication or earlier communications from the examiner should be directed to NORA MAUREEN ROONEY whose telephone number is (571)272-9937. The examiner can normally be reached on M-F from 8:00am to 4:30pm.
If attempts to reach the examiner by telephone are unsuccessful, the examiner' s supervisor, Misook Yu, can be reached at telephone number (571) 272-0839. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from Patent Center. Status information for published applications may be obtained from Patent Center. Status information for unpublished applications is available through Patent Center for authorized users only. Should you have questions about access to Patent Center, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) Form at https://www.uspto.gov/patents/uspto-automated- interview-request-air-form.
September 5, 2026
/Nora M Rooney/
Primary Examiner, Art Unit 1641
