Prosecution Insights
Last updated: April 19, 2026
Application No. 18/260,406

GENETICALLY-MODIFIED PLURIPOTENT STEM CELLS AND DERIVED NATURAL KILLER CELLS AND METHODS FOR PRODUCING THE SAME

Non-Final OA §103§112
Filed
Jul 05, 2023
Examiner
SHIBUYA, MARK LANCE
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nuwacell Biotechnologies Co. Ltd.
OA Round
1 (Non-Final)
32%
Grant Probability
At Risk
1-2
OA Rounds
3y 9m
To Grant
57%
With Interview

Examiner Intelligence

Grants only 32% of cases
32%
Career Allow Rate
51 granted / 158 resolved
-27.7% vs TC avg
Strong +25% interview lift
Without
With
+24.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
28 currently pending
Career history
186
Total Applications
across all art units

Statute-Specific Performance

§101
2.9%
-37.1% vs TC avg
§103
38.2%
-1.8% vs TC avg
§102
18.1%
-21.9% vs TC avg
§112
27.0%
-13.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 158 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 1, 4-8, 10-11, 14-18, 20-22, 25-31, 33-37 are pending. Claims 11, 14-18, 20, and 21 of Group II are examined. Non-elected Claims 1, 4-8 and 10, 21-22, 25-31 and 33-37 are withdrawn. Election/Restrictions Applicant's election with traverse of the finding of lack of unity in the reply filed on 1/16/2026 is acknowledged. The traversal is on the ground(s) that unity of invention exists because neither Welstead nor Pei teaches or suggest Ubiquitous Chromatin Opening Elements (UCOE), as currently required following the amendments to the claims. The traversal further argues that Groups I-III are so linked as to form a “single general concept” and so are “different aspects of a single invention”. The traversal cites MPEP 803 to argue that examination of the entire application can be made without serious burden, based on similar keywords and searches that would produce overlapping results. This is not found persuasive because the technical feature linking the claims does not represent an improvement over the prior art and so is not a special technical feature. The publications of Welstead, US 20220143084 and Smolke, US 20220193266, as set forth, infra, in the rejection under 35 U.S.C 103, holds obvious the technical feature of the UCOE, as now amended in the claims. Thus the technical feature linking the claims is not special. The traversal argument that the different Inventive Groups are actually the same invention is not unpersuasive. The invention of Group I claims to any cell derived from an induced pluripotent stem cell. This reads on virtually any cell type found in the body. The instant Specification states: [0046] As used herein, the term “pluripotency” or “pluripotent” refers to a cell that has the developmental potential to differentiate into cells of all three germ layers (Ectoderm, mesoderm, and endoderm). Pluripotency can be determined, at least in part, by assessing pluripotency characteristics of the cells. Pluripotency characteristics include, but are not limited to: (i) pluripotent stem cell morphology; (ii) the potential for unlimited self-renewal; (iii) expression of pluripotent stem cell markers including, but not limited to SSEA1 (mouse only), SSEA3/4, SSEA5, TRA1-60/81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133/prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30 and/or CD50; (iv) ability to differentiate to all three somatic lineages (ectoderm, mesoderm and endoderm); (v) teratoma formation consisting of the three somatic lineages; and (vi) formation of embryoid bodies consisting of cells from the three somatic lineages. Specification at para [0046]. The specification states that pluripotent stem cells are capable of differentiating into all three somatic cell lineages and event to teratomas and embryoid bodies. The iNK cells of elected Group II are a species of the generic scope of the Invention of Group I, and are so disparate in scope as to require separate examination. For examination purposes, it cannot be assumed that Groups I, II and III form “a single invention.” The traversal argues that examination of all groups would not constitute a search and examination burden, but this is a consideration under US practice, as set forth in MPEP Section 803, and not germane unity of invention practice under PCT Rule 13. Unity of invention entails more than similar keywords and searches with results that overlap, because the Groups of Invention have differences that should be considered. For these reasons the restriction for lack of unity of invention is maintained. Information Disclosure Statement The information disclosure statement (IDS) submitted on 8/25/2023 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 1. Claims 14, 17, 18, 20, and 21 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 14, recites the broad recitation “EF1α, PGK, CAG, CMV, CLP, UBC and/or any promoter derived therefrom,” and the claim also recites “preferably EF1α, CMV, and/or CLP”; claim 17 recites the broad recitation “Fc receptor comprises CD16, CD64, or variants thereof”, and the claim also recites “preferably non-cleavable CD16A” and “more preferably CD64/16A fusion protein”; claim 18 recites the broad recitation “cytokine comprises a membrane-bound cytokine”, and the claim also recites “preferably a membrane-bound IL-15 and a variant thereof, and more preferably membrane-bound IL15RLI shown in SEQ ID NO.: 12”; claim 20 recites the broad recitation “CD16, CD64, or variants thereof” and the claim also recites “preferably non-cleavable CD16A shown in SEQ ID NO.: 3 and . . . . more preferably CD64/16A fusion protein shown in SEQ ID NO.: 5; claim 21 recites the broad recitation “genetically-modified iNK cells are immature or mature genetically-modified iNK cells and the claim also recites “preferably mature genetically-modified iNK cells; respectively. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. 2. Claim 17 is further rejection for reciting unclear language as to whether the claimed Fc receptor comprises CD16 and CD64/16A fusion protein as a combination, or if the claim comprises CD16 and CD64/16A in the alternative as a Markush Group. The clause reciting “more preferably CD64/16A fusion protein shown in in SEQ ID NO.:5” appears to favor an alternative interpretation of CD16 or CD64/16A, as is construed as such. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 1. Claim(s) 11, 15, 16, 20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Welstead, US 20220143084 and Smolke, US 20220193266. Welstead, US 20220143084, discloses a method for differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the stem cell comprises (1) an exogenous nucleic acid expression construct comprising a nucleic acid sequence encoding CAR, CD16, IL-15, IL-15R, IL12, IL12R or any combination of two or more, and (2) an indel, or an insertion of an exogenous nucleic acid in one or more of the following genetic loci: CISH, TGFßR2, ADORA2A, TIGIT or NKG2A, wherein the pluripotent stem cell is an iPS cell. Welstead, e.g., at para [0017], teaches a gene product knocked into a “safe harbor” locus, such as a ROSA26 locus. In some embodiments, the exogenous nucleic acid construct encoding a gene product listed under (1) is knocked into a genomic locus encoding a gene product listed under (2), resulting in a loss-of-function of the gene product listed under (2) and expression of a gene product encoded by the exogenous nucleic acid construct, either driven by a heterologous promoter, or driven by the endogenous promoter of the genomic locus that the exogenous nucleic acid construct is knocked into. Welstead teaches, e.g. at [0015], nucleic acid expression constructs comprising a gene product operably linked to a promoter driving expression in a target cell, e.g. a modified NK cell. The lymphocyte comprises iNK cells (see, e.g., Welstead at para [0007]), or other lymphocytes. The genetically modified NK cells can be derived from stem cells, e.g., iPS cells. The genomic edits present in the final iNK cell can be made at any stage of the process of reprogramming the donor cell to the iPS cell state, during the iPS cell state, and/or at any stage of the process of differentiating the iPS cell to an iNK state (see the abstract, claims 73, 74,80, the description, paragraph 15, 16, 164, 245, 246, table 7). Welstead at para [0007] teaches loss of function of CISH that result from genomic edits in the modified NK cell, as in claim 15. Welstead does not teach a ubiquitous chromatin opening element (UCOE). Welstead does not teach a promoter that is EF1a, as in claim 14. Smolke, US 20220193266, throughout the publication and abstract and at, e.g., para [0021]-[0025], Figures 2A, 2B, 2C, 2E, teaches ubiquitous chromatin opening element (UCOE), DNA constructs and vectors and host cell comprising the DNA constructs or vectors, for increasing and / or maintaining expression of a gene of interest, for example Green Fluorescent Protein. Smolke, at para [0007], teach UCOE polynucleotide operably linked to a heterologous promoter, as in claim 16; at para [0021]-[0025], Figure 3B, teaches EF1a, as in claim 14. Smolke e.g., at para [0136], teaches that when liked to A2UCOE, 3’UCOE, and a candidate construct, EF1a can increase expression of GFP positive cells. It would have been prima facie obvious before the filing date of the instant application for one of ordinary skill in the art to have combined a ubiquitous chromatin opening element (UCOE), and an EF1a promoter, as taught by Smolke, with the genetically-modified iNK cell expression cassettes, as taught by Welstead. One of ordinary skill in the art would have motivated to have combined genetically-modified iNK cell expression cassettes with a ubiquitous chromatin opening element (UCOE), in order to increase expression; and to have combined an EF1a promoter with UCOE, in order expression of the protein encoding construct. 2. Claim(s) 17, 18 and 20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Welstead, US 20220143084 and Smolke, US 20220193266 as applied to claims 11, 15, 16, 20 above, and further in view of Zhang, U.S. 20180273903, Desbois, 2020, Journal for ImmunoTherapy of Cancer, vol. 8, e000632, pages 1 to 13, and DiLeo, US 20090142805A1. The prior art references of Welstead, US 20220143084 and Smolke, US 20220193266 are relied upon, as above. Welstead does not teach SEQ ID NO: 3, as in claim 17; a membrane-bound cytokine or a variant of IL-15, as in claim 18; or SEQ ID NO: 14, as in claim 20. Zhang, U.S. 20180273903, (WO2018126074), throughout the publication and abstract and at para [0011], teaches a population of natural killer (NK) cells that comprise a modified CD16, reference SEQ ID 1, which is a 100% query match to instant SEQ ID NO: 3, as in claim 17. Zhang et papa [0011], teaches the modified CD 16 introduced into the NK ells via a vector that has either a CMV or an EF1a promoter. Zhang at para [0017] teaches the modified CD16 has a higher affinity for IgG than wildtype CD16. Desbois, 2020, Journal for ImmunoTherapy of Cancer, vol. 8, e000632, pages 1 to 13, throughout the publication and abstract, teaches the fusion molecule IL-15 (RLI) which IL-15 covalently linked to an IL-15a, for treatment of advanced/metastatic solid cancer by modulation and activation of NK cells. Desbois, at p. 10, right column, para 2, disclose RLI is more potent than IL-15 alone to reduce metastases. DiLeo, US 20090142805A1, describes at reference SEQ ID NO: 2, a sequence that shows a 99.1% query match to instant SEQ ID NO: 14, as in claim 20. DiLeo, at para [0061]-[0069] teaches reference SEQ ID NO: 2, to be a methylation-free CpG island derived from the promoter region of the human RNPA2 gene, which can maintain chromatin in an open state to support expression. Such methylation-free CpG islands can be derived from ubiquitously expressed genes, (UCOEs). DiLeo, US20090142805A1, Publication No. US20090142805A1, SEQ ID NO: 2. Query Match 99.1%; Score 1536; Length 1558; Best Local Similarity 99.7%; Matches 1550; Conservative 0; Mismatches 0; Indels 4; Gaps 1; Qy 1 GGCCCTCCGCGCCTACAGCTCAAGCCACATCCGAAGGGGGAGGGAGCCGGGAGCTGCGCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGCCCTCCGCGCCTACAGCTCAAGCCACATCCGAAGGGGGAGGGAGCCGGGAGCTGCGCG 60 Qy 61 CGGGGCCGCCGGGGGGAGGGGTGGCACCGCCCACGCCGGGCGGCCACGAAGGGCGGGGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CGGGGCCGCCGGGGGGAGGGGTGGCACCGCCCACGCCGGGCGGCCACGAAGGGCGGGGCA 120 Qy 121 GCGGGCGCGCGCCCGGCGGGGGGAGGGGCCGCGCGCCGCGCCCGCTGGGAATTGGGGCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCGGGCGCGCGCCCGGCGGGGGGAGGGGCCGCGCGCCGCGCCCGCTGGGAATTGGGGCCC 180 Qy 181 TAGGGGGAGGGCGGAGGCGCCGACGACCGCGGCACTTACCGTTCGCGGCGTGGCGCCCGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TAGGGGGAGGGCGGAGGCGCCGACGACCGCGGCACTTACCGTTCGCGGCGTGGCGCCCGG 240 Qy 241 TGGTCCCCAAGGGGAGGGAAGGGGGAGGCGGGGCGAGGACAGTGACCGGAGTCTCCTCAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TGGTCCCCAAGGGGAGGGAAGGGGGAGGCGGGGCGAGGACAGTGACCGGAGTCTCCTCAG 300 Qy 301 CGGTGGCTTTTCTGCTTGGCAGCCTCAGCGGCTGGCGCCAAAACCGGACTCCGCCCACTT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CGGTGGCTTTTCTGCTTGGCAGCCTCAGCGGCTGGCGCCAAAACCGGACTCCGCCCACTT 360 Qy 361 CCTCGCCCCTGCGGTGCGAGGGTGTGGAATCCTCCAGACGCTGGGGGAGGGGGAGTTGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCTCGCCCCTGCGGTGCGAGGGTGTGGAATCCTCCAGACGCTGGGGGAGGGGGAGTTGGG 420 Qy 421 AGCTTAAAAACTAGTACCCCTTTGGGACCACTTTCAGCAGCGAACTCTCCTGTACACCAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AGCTTAAAAACTAGTACCCCTTTGGGACCACTTTCAGCAGCGAACTCTCCTGTACACCAG Qy 481 GGGTCAGTTCCACAGACGCGGGCCAGGGGTGGGTCATTGCGGCGTGAACAATAATTTGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GGGTCAGTTCCACAGACGCGGGCCAGGGGTGGGTCATTGCGGCGTGAACAATAATTTGAC Qy 541 TAGAAGTTGATTCGGGTGTTTCCGGAAGGGGCCGAGTCAATCCGCCGAGTTGGGGCACGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TAGAAGTTGATTCGGGTGTTTCCGGAAGGGGCCGAGTCAATCCGCCGAGTTGGGGCACGG 600 Qy 601 AAAACAAAAAGGGAAGGCTACTAAGATTTTTCTGGCGGGGGTTATCATTGGCGTAACTGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AAAACAAAAAGGGAAGGCTACTAAGATTTTTCTGGCGGGGGTTATCATTGGCGTAACTGC 660 Qy 661 AGGGACCACCTCCCGGGTTGAGGGGGCTGGATCTCCAGGCTGCGGATTAAGCCCCTCCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 AGGGACCACCTCCCGGGTTGAGGGGGCTGGATCTCCAGGCTGCGGATTAAGCCCCTCCCG 720 Qy 721 TCGGCGTTAATTTCAAACTGCGCGACCGTTTCTCACCTGCCTTGCGCCAAGGCAGGGGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TCGGCGTTAATTTCAAACTGCGCGACCGTTTCTCACCTGCCTTGCGCCAAGGCAGGGGGC Qy 781 GGGACCCTATTCCAAGAGGTAGTAACTAGCAGGACTCTAGCCTTCCGCAATTCATTGAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GGGACCCTATTCCAAGAGGTAGTAACTAGCAGGACTCTAGCCTTCCGCAATTCATTGAGC 840 Qy 841 GCATTTACGGAAGTAACGTCGGGTACTGTCTCTGGCCGCAAGGGTGGGAGGAGTACGCAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GCATTTACGGAAGTAACGTCGGGTACTGTCTCTGGCCGCAAGGGTGGGAGGAGTACGCAT 900 Qy 901 TTGGCGTAAGGTGGGGCGTAGAGCCTTCCCGCCATTGGCGGCGGATAGGGCGTTTACGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TTGGCGTAAGGTGGGGCGTAGAGCCTTCCCGCCATTGGCGGCGGATAGGGCGTTTACGCG 960 Qy 961 ACGGCCTGACGTAGCGGAAGACGCGTTAGTGGGGGGGAAGGTTCTAGAAAAGCGGCGGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ACGGCCTGACGTAGCGGAAGACGCGTTAGTGGGGGGGAAGGTTCTAGAAAAGCGGCGGCA Qy 1021 GCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGGTCCCGTGCGGAGGTGCTCCTCGCAGAGT 1080 Qy 1081 TGTTTCTCGAGCAGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TGTTTCTCGAGCAGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGT 1140 Qy 1141 CCGCGGA----GATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGA ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 CCGCGGAGATCGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGA 1200 Qy 1197 GTCCGCGATGGAGGTAACGGGTTTGAAATCAATGAGTTATTGAAAAGGGCATGGCGAGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 GTCCGCGATGGAGGTAACGGGTTTGAAATCAATGAGTTATTGAAAAGGGCATGGCGAGGC 1260 Qy 1257 CGTTGGCGCCTCAGTGGAAGTCGGCCAGCCGCCTCCGTGGGAGAGAGGCAGGAAATCGGA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 CGTTGGCGCCTCAGTGGAAGTCGGCCAGCCGCCTCCGTGGGAGAGAGGCAGGAAATCGGA 1320 Qy 1317 CCAATTCAGTAGCAGTGGGGCTTAAGGTTTATGAACGGGGTCTTGAGCGGAGGCCTGAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CCAATTCAGTAGCAGTGGGGCTTAAGGTTTATGAACGGGGTCTTGAGCGGAGGCCTGAGC 1380 Qy 1377 GTACAAACAGCTTCCCCACCCTCAGCCTCCCGGCGCCATTTCCCTTCACTGGGGGTGGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 GTACAAACAGCTTCCCCACCCTCAGCCTCCCGGCGCCATTTCCCTTCACTGGGGGTGGGG Qy 1437 GATGGGGAGCTTTCACATGGCGGACGCTGCCCCGCTGGGGTGAAAGTGGGGCGCGGAGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GATGGGGAGCTTTCACATGGCGGACGCTGCCCCGCTGGGGTGAAAGTGGGGCGCGGAGGC 1500 Qy 1497 GGGAATTCTTATTCCCTTTCTAAAGCACGCTGCTTCGGGGGCCACGGCGTCTCC 1550 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 GGGAATTCTTATTCCCTTTCTAAAGCACGCTGCTTCGGGGGCCACGGCGTCTCC 1554 It would have been prima facie obvious before the filing date of the instant application for one of ordinary skill in the art to have combined SEQ ID NO: 3, as taught by Zhang, in claim 17; a membrane-bound cytokine or a variant of IL-15, as taught by Desbois, in claim 18; and SEQ ID NO: 14, as taught by DiLeo, in claim 20, in the iNK cell construct of Welstead. Zhang, U.S. 20180273903, Desbois, 2020, Journal for ImmunoTherapy of Cancer, vol. 8, e000632, pages 1 to 13, and DiLeo, US 20090142805A1 One of ordinary skill in the art would have motivated to have combined SEQ ID NO: 3, because Zhang the modified CD16 has a higher affinity for IgG than wildtype CD16. One of ordinary skill in the art would have motivated to have combined SEQ ID NO: 3, into the iNK constructed cell of Welstead, because Zhang the modified CD16 has a higher affinity for IgG than wildtype CD16. One of ordinary skill in the art would have motivated to have combined the fusion molecule IL-15 (RLI) into the iNK constructed cell of Welstead, because Desbois teaches the fusion molecule IL-15 (RLI) which IL-15 covalently linked to an IL-15a, for treatment of advanced/metastatic solid cancer by modulation and activation of NK cells. One of ordinary skill in the art would have motivated to have substituted reference SEQ ID NO: 2, as taught by DiLeo, for SEQ ID NO: 14, as in claim 30, because of the high degree of homology between the sequence, and because DiLeo teaches methylation-free CpG islands as support open state chromatin, for increasing expression in NK cells. Conclusion 1. All examined claims, Claims 11, 14-18, 20, and 21 are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Mark L Shibuya whose telephone number is (571)272-0806. The examiner can normally be reached M-F, 9AM-4:30PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James (Doug) Schultz, can be reached at (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. MARK L. SHIBUYA Primary Patent Examiner Art Unit 1631 /MARK L SHIBUYA/Primary Patent Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Jul 05, 2023
Application Filed
Feb 16, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600985
Compositions and Methods for Controlling Production of Polypeptides in Cells
2y 5m to grant Granted Apr 14, 2026
Patent 12600950
METHOD OF GENERATING MULTIPOTENT STEM CELLS
2y 5m to grant Granted Apr 14, 2026
Patent 12590320
CELLULAR MODELS OF AND THERAPIES FOR OCULAR DISEASES
2y 5m to grant Granted Mar 31, 2026
Patent 12582707
IN-VITRO TRANSCRIPT MRNA AND PHARMACEUTICAL COMPOSITION COMPRISING SAME
2y 5m to grant Granted Mar 24, 2026
Patent 12584106
METHOD FOR PRODUCING OLIGODENDROCYTE-LIKE CELLS
2y 5m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
32%
Grant Probability
57%
With Interview (+24.9%)
3y 9m
Median Time to Grant
Low
PTA Risk
Based on 158 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month