DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 06/12/2026. Claims 1-6, 8-9, 12-13, 16, 18, and 21-28 are pending. Claims 7, 10, 15, 17, 19, and 20 are canceled, and new claims 23-28 are added. Accordingly, claims 1-6, 8-9, 12-13, 16, 18, and 21-28 are examined herein. The election of species requirement mailed on 04/24/2026 is moot in view of amendment.
Election/Restrictions
Applicant's amendment cancelled claim 7 and eliminated species from claims 8, 9, 18, rendering the election of species requirement mailed on 04/24/2026 moot. However, should the applicant amend the claims in the future to recite a plurality of possible vectors, the election of species requirement will be reconsidered at that time.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Acknowledgment is made of applicant's claim for foreign priority based on an application filed in CHINA 202110015598.1 filed on 01/06/2021.
This application is a 371 of PCT/CN2022/070188 filed on 01/05/2022.
Drawings
The drawing is objected to because 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG.”.
In the current case, the view number for Figure 1 is preceded by the word "Fig." instead of
the abbreviation "FIG.".
37 CFR 1.84(p)(1) states “Reference characters (numerals are preferred), sheet numbers, and view numbers must be plain and legible, and must not be used in association with brackets or inverted commas, or enclosed within outlines, e.g., encircled. They must be oriented in the same direction as the view so as to avoid having to rotate the sheet.”
In the current case, the view number for Figure 3 is not oriented in the same direction as the view, i.e. when the sheet is rotated such that the top is on the right to make the view upright, the view number “Fig. 3” is on the left of the sheet and oriented sideways.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-6, 8-9, 12-13, 16, 18, and 21-28 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, the recitation “coding sequence…using E. coli preferred codons” creates ambiguity because “preferred” is a relative term of degree without a standard of measure. The specification fails to define a specific frequency threshold, algorithm, or reference table, e.g. codon adaptation index (CAI), relative codon usage bias (RCUB), or specific percentage cutoffs such as >20% or >30% frequency in E. coli. Nakamura (Nucleic Acids Res. 2000 Jan 1;28(1):292) teaches that raw codon usage frequency tables exist on a continuous spectrum (e.g., per 1,000 codons, see www.kazusa.or.jp/ codon/, page 292, right column, first 2 lines), and there is no universal cutoff dividing a "preferred" codon from any other codon without an arbitrary user-defined threshold.
Claims 2-6, 8-9, 12-13, 16, 18, and 21-28 are also rejected for depending from a rejected claim 1 but failing to remedy the indefiniteness therein.
Claim Rejections - 35 USC § 112 Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-6, 8-9, 12-13, 16, 18, and 21-28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
The independent claim 1 directs to a broad genus of "E. coli preferred codons" used for codon-optimization of a polynucleotide comprising coding sequences of toluene dioxygenase TodC1, TodC2, TodB and TodA. However, the specification lacks adequate structural or operational details defining what constitutes an " E. coli preferred codon". The specification fails to set forth an explicit list of codons, a specific threshold frequency cutoff (e.g., codon usage frequency >30% or Codon Adaptation Index threshold), or a specific algorithm/database baseline to define the boundary of this genus. Because Nakamura (2000) teaches that raw codon usage frequency tables exist on a continuous spectrum (e.g., per 1,000 codons, see www.kazusa.or.jp/codon/, page 292, right column, first 2 lines), and there is no universal cutoff dividing a "preferred" codon from any other codon without an arbitrary user-defined threshold. There is an apparent difference between the codon usage tables and which codons are “preferred”. The specification does not define whether “preferred” is synonymous with higher usage. The knowledge in the art is insufficient to describe the claimed invention. Hence, the generic term encompasses a vast set of possible nucleotide sequences lacking a common structural identifier or clear definition in the specification, the disclosure fails to demonstrate that applicant was in possession of the full scope of the claimed genus encompassing all variants utilizing "E. coli preferred codons" other than those sequences shown in the Examples.
The specification demonstrates 5 total recombinant strain sequences, BL21(DE3)(pET-24a), BL21(DE3)(pET-24a-SEQ1), BL21(DE3)(pET-24a-SEQ2), BL21(DE3)(pET-24a-SEQ12), and BL21(DE3)(pET-24a-SEQ13) in Examples 1-6 (Pages 21-28). The total 5 variants, while representative for select variations that encode proteins showing different solubility (FIG. 2), do not sufficiently represent the full scope of the genus as claimed. The fact that some variants show poor soluble expression of toluene dioxygenase highlights the unpredictability of codon optimization impact on the activity of the encoded proteins.
Regarding the state of the art, Rosano (Microb Cell Fact. 2009 Jul 24;8:41) demonstrates experimentally that maximizing expression rates using high-abundance tRNAs for E. coli strain preferred codons causes many recombinant proteins to accumulate almost exclusively in the insoluble fraction compared to native codon usage (Page 1, Abstract, line 1-3; Page 6, Figure 3). The increased rate of translation may lead to protein misfolding and insolubilization (Page 1, Abstract, line 5-6). These observations highlight the unpredictability of codon optimization for the expression of heterologous proteins in E. coli and contrast the extremely limited examples showcased in the instant specification.
The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claim 1 is overly broad with insufficient evidence of possession at the time of filing to one skilled in the art. Thus, claim 1 does not meet the written description requirement, and the specification demonstrates a clear lack of possession of the full genus as claimed.
Claims 2-6, 8-9, 12-13, 16, 18, and 21-28 are also rejected for depending from the rejected claim 1 and failing to remedy the lack of written description therein.
Claim Rejections - 35 USC § 112 Scope of Enablement
Claims 12, 13, 21, 22, and 28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement, because the specification, while being enabling for performing the claimed methods using host cells comprising the disclosed polynucleotide sequence, SEQ ID NOs: 1 and 2, does not reasonably provide enablement for performing the claimed methods using host cells comprising any other codon-optimized polynucleotide sequence encoding the TodC1C2BA gene complex. The claim contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention
The claimed inventions direct to methods that necessarily depend on the polynucleotide encoding a catalytically functional enzyme complex: adding a compound of formula (1) as substrate... for reaction to produce a fermentation broth containing the compound of formula (2). This limitation cannot be satisfied unless the expressed TodC1C2BA complex is properly folded, cofactor-loaded, and catalytically active. Thus, the methods require a reliable implementation of: i) providing an expression cassette or vector, comprising a polynucleotide encoding the enzyme complex according to claim 1 or 16; ii) culture the host cell comprising the expression cassette or vector according to claim 8 or 18 under conditions suitable for the expression of the polynucleotide; iii) adding compound of formula (1) as substrate to the culture medium containing the host cell of i) for reaction to give a fermentation broth containing the compound of formula (2). Claims 12/21 require not merely gene expression, but a functioning multi-subunit metalloenzyme system, i.e. TodC1/TodC2 forming a catalytically active Rieske-type iron-sulfur oxygenase, coupled to functional TodA/TodB electron-transfer components, correctly folded, cofactor-loaded, and catalytically competent to actually convert substrate to product.
The Breadth of the Claims
The limitation "E. coli preferred codons" is undefined in scope, encompassing an enormous genus of degenerate sequences for each of the four coding regions, with no specified codon usage table, frequency threshold, or selection rule distinguishing which members of that genus are claimed. Thus the scopes of the claims 12 and 21 direct to methods involving extremely broad genus of polynucleotides that encode the multi-subunit metalloenzyme system, i.e. TodC1/TodC2 forming a catalytically active Rieske-type iron-sulfur oxygenase, coupled to functional TodA/TodB electron-transfer components, correctly folded, cofactor-loaded, and catalytically competent to actually convert substrate to product.
Guidance of the Specification
The specification discloses functional data for only five total recombinant constructs in Examples 2-6 (Pages 21-28): BL21(DE3)(pET-24a), BL21(DE3)(pET-24a-SEQ1), BL21(DE3)(pET-24a-SEQ2), BL21(DE3)(pET-24a-SEQ12), and BL21(DE3)(pET-24a-SEQ13), of which only two, BL21(DE3)(pET-24a-SEQ1), BL21(DE3)(pET-24a-SEQ2), fall within the scope of claim 1's limitation, “a polynucleotide comprising … sequences that use E. coli preferred codons" and a “first spacer sequence” limitations (See alignment between SEQ ID NO: 1 and SEQ ID NO: 2 below showing the difference), and both embodiments use identical codon-optimized coding sequence but differ in the “second spacer sequence” according to claim 23 “the second spacer sequence comprises GTGATGTC (nucleotides at positions 2028-2035 of SEQ ID NO: 1) or GAAGGAGATATACC (nucleotides at positions 2028-2041 of SEQ ID NO: 2)”.
PNG
media_image1.png
52
842
media_image1.png
Greyscale
PNG
media_image2.png
140
842
media_image2.png
Greyscale
The specification therefore provides working guidance for exactly one specific codon-optimized coding sequence for the Toluene Dioxygenase complex, not a representative sampling across the claimed genus, and no algorithm, codon usage table, or other selection criteria is disclosed to guide a PHOSITA in selecting alternative "E. coli preferred codon" sequences the encode this protein complex.
The State of the Prior Art
Codon-optimization tools were generally known based on the teachings by De Lorme (WO2016053648A1, published on 04/07/2016) on Page 56, Example 11, ¶[000236]. Zylstra (J Biol Chem. 1989;264(25):14940-6; Cited on IDS filed on 10/26/2023; Page 14944, Table III) teaches strategies to express in E. coli the todC1C2BADE genes which encode the first three enzymes in the catabolism of toluene by Pseudomonasputida F1 with codon usage bias of P. putida F1. However, the art does not establish predictability for any sequence satisfying "E. coli preferred codons" reliably yields a correctly folded, cofactor-loaded, catalytically active form of this specific multi-subunit oxygenase system, and De Lorme does not establish all codon optimization outputs reliably produce functional multi-subunit complexes.
The Level of Predictability in the Art
The specification's own comparative data isolate codon optimization as a variable and demonstrates it is not, by itself, sufficient to retain protein function BL21(DE3)(pET-24a-SEQ13) uses the identical codon-optimized coding sequences as BL21(DE3)(pET-24a-SEQ1) and BL21(DE3)(pET-24a-SEQ2) while differing only in spacer architecture (native spacers rather than SEQ ID NO:3), yet performs comparably poorly, and appears to be similar to the non-codon-optimized BL21(DE3)(pET-24a-SEQ12) construct, showing partial TodC1 solubility only, incomplete substrate conversion, substrate remaining, (See Example 2, FIG. 2). This is direct evidence, from Applicant's own data, that codon optimization alone does not reliably predict or produce functional catalytic outcome; outcome depends on unpredictable interaction between codon choice and other construct variables, e.g. the spacer sequence. This directly undercuts any inference that other, untested sequences satisfying "E. coli preferred codons" would perform comparably to the two specific constructs (SEQ1/SEQ2) that happen to combine this codon design with the specific first spacer sequence.
The Quantity of Experimentation necessarily Needed
In light of the high level of unpredictability in the art, and the limited amount of direction provided by the inventor for codon-optimized variants of the polynucleotide encoding the Toluene Dioxygenase complex, and the noticeable absence of working examples other than a single codon-optimized coding sequence that is shared by SEQ ID NO: 1 and SEQ ID NO: 2, the quantity of experimentation necessarily needed to make or use the invention as claimed, based on the disclosure is considerably high. For example, it would be necessary for one skilled in the art to design numerous codon-optimized polynucleotide sequences based on undefined “E. coli preferred codons” and conduct rigorous testing of multi-component protein complex expression profiles in order to evaluate and identify desired enzymatic activities across a wide range of substrate reaction assays. Given the specification's own evidence (SEQ13) that codon optimization outcomes are construct-dependent and unpredictable, a PHOSITA seeking to practice the full scope of "E. coli preferred codons" would face open-ended, unguided experimentation, synthesizing and empirically testing numerous alternative codon assignments for both expression and catalytic function rather than routine confirmatory work. There would be an unreasonable amount of experimentation required by a PHOSITA.
Conclusion of 35 U.S.C. 112(a) Enablement Analysis
After applying the Wands factors and analysis to claims 12 and 21, taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, in view of the applicant’s entire disclosure, it is concluded that the specification is not enabled for the full scope as discussed above. Therefore, claims 12 and21 are rejected under 35 U.S.C. §112(a) for failing to disclose sufficient information to enable a person of skill in the art to use the invention commensurate in scope with these claims. Claims 13, 22, 28 are also rejected for depending from claim 12 or 21 and failing to remedy the lack of full breadth of enablement therein.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-5, 23 are rejected under 35 U.S.C. 103 as being unpatentable over GenBank (GenBank_1993_J04996.1 listed on PTO-892), in view of Hecht (2017; See full citation above in §112 rejection), further in view of De Lorme (WO2016053648A1, published on 04/07/2016), Hénaut (Escherichia coli and Salmonella, Vol. 2, Ch. 114:2047-2066, 1996, Neidhardt FC ed., ASM press, Washington, D.C.), Al-Hawash (Gene Reports 2017;9:46-53; Cited on IDS filed on 12/12/2025), and Hellinga (US9927440B2, issued on 03/27/2018), as evidenced by Bahl (Proc Natl Acad Sci U S A. 1977;74(3):966-70) and Wen (RNA Biol. 2021 Nov;18(11):1489-1500).
GenBank (1993) teaches a polynucleotide, comprising coding sequences of toluene dioxygenase TodC1, TodC2, TodB and TodA, wherein the polynucleotide comprises:
Four nucleotide sequences, from 5'- end to 3'-end, comprising the coding sequence of TodC1 with an amino acid sequence of SEQ ID NO: 4; TodC2, with amino acid sequence of SEQ ID NO: 5; TodB, with an amino acid sequence of SEQ ID NO: 6; and TodA, with an amino acid sequence of SEQ ID NO: 7; See sequence alignment below with each of the 4 protein coding regions of the P.putida F1 toluene dioxygenase gene set forth in GenBank J04996.1, i.e. protein IDs: AAA26005.1 for TodC1, AAA26006.1 for TodC2, AAA26007.1 for TodB, AAA26008.1 for TodA.
Since E. coli has more start codons than the canonical ATG/AUG, as taught by Hecht (Nucleic Acids Res. 2017;45(7):3615-3626; Page 3619, Table 1), and TAA is only one of three canonical stop codons (UAA/TAA, UAG/TAG, and UGA/TGA) used by E. coli (Hecht, page 3615, right column, 4th ¶, lines 4-5), TAA and AUG are not inherent to any of the nucleotide sequences (1)-(4). Although the nested sequence formed between the wildtype TodB and TodA genes is TGAGT, it is routine and obvious for PHOSITAs to switch and compare the performance of alternative stop codons.
Query: SEQ ID NO: 4, Sbjct: protein IDs: AAA26005.1 for TodC1 in GenBank J04996.1
PNG
media_image3.png
660
871
media_image3.png
Greyscale
Query: SEQ ID NO: 5, Sbjct: protein IDs: AAA26006.1 for TodC2 in GenBank J04996.1
PNG
media_image4.png
357
866
media_image4.png
Greyscale
Query: SEQ ID NO: 6, Sbjct: protein IDs: AAA26007.1 for TodB in GenBank J04996.1
PNG
media_image5.png
208
856
media_image5.png
Greyscale
Query: SEQ ID NO: 7, Sbjct: protein IDs: AAA26008.1 for TodA in GenBank J04996.1
PNG
media_image6.png
585
861
media_image6.png
Greyscale
GenBank further teaches that the nucleotide sequences for the TodB gene precede a stop codon TGA at the nucleotide positions 2976-2978, which forms a nested sequence of TGATG at positions 2976-2980 with the start codon of the TodA gene, ATG at the nucleotide positions 2978-2980 of GenBank J04996.1. However, TAA is an art-recognized interchangeable stop codon with TGA or TAG, all used by E. coli, as taught by Hecht (2017;Page 3615, right column, 4th ¶, lines 4-5).
GenBank does not teach: 1) wherein the first, second, third and fourth nucleotide sequences each independently use E. coli preferred codons; 2) a first spacer sequence between the first and second nucleotide sequences comprising, from 5'-end to 3'-end, a T7 promoter, a Lac operator and a prokaryotic ribosome binding site (rbs), wherein the first spacer sequence comprises a nucleotide sequence of SEQ ID NO: 3.
However, De Lorme (2016) discloses genetically engineering microorganisms to increase expression of oxidative enzymes, explicitly identifying toluene dioxygenases (TDO) as an enzyme within its scope (Page 31-32, last and first sentences, respectively; Page 58, Claim 10). De Lorme teaches that an exogenous gene encoding a protein can be codon-optimized for expression in the microorganism (Page 8, ¶[0049]), providing motivation to codon-optimize, and further teaches that replacing native regulatory/spacer sequences with a stronger, inducible promoter, explicitly naming T7 promoters (Page 37, ¶[000169]), together with lac operator regulatory elements (Page 41, ¶[000187]), and an inserted ribosome binding site (Page 42, ¶[000189]), is a known technique for increasing expression of a downstream target gene.
Although independent efforts to develop codon-optimization strategies for expressing exogenous genes in E. coli led to development of diverse embodiments of codon usage bias tables, e.g. one embodiment of codon usage table for E. coli taught by Hénaut (1996; Page 5, Table 2). PHOSITAs are able to follow the available teachings to execute any codon optimization methods known in the art. Al-Hawash (2017) teaches that “In addition to improving yields of desired products, codon randomization provides numerous advantages. … By facilitating elimination of undesirable restriction sites, codon randomization assists assembly of large constructs” (Page 49, last 6 lines; Page 50, first line) and summarizes examples of success (Page 50, Table 2), further corroborating that codon-optimization of a known coding sequence for a new host is a routine technique in the art. None of Hecht, De Lorme, Hénaut, or Al-Hawash teaches 2) a first spacer sequence.
However, Hellinga (2018; See full citation above) teaches a sequence fragment in SEQ ID NO: 5, wherein the “5' segment contained a T7 RNA polymerase promoter (in bold) as well as a Shine-Delgarno ribosome binding site (in italics)” which is “AGAAGGAG” a clearly AG-rich sequence (Column 32, lines 30-32), which matches 100% sequence identity with the claimed SEQ ID NO: 3, alignment:
5'-CGGCGTAGAGGATCGAGATCTCGATCCCGCGAAAT TAATACGACTCACTATA GGGG AATTGTGAGCGGATAACAATT
CCCCTCTAGAAATAATTTTGTTTAACTTTA AGAAGGAG ATATACC-3’
SEQ ID NO: 3, first spacer sequence vs Hellinga SEQ ID NO: 5 110nt/122nt
PNG
media_image7.png
208
841
media_image7.png
Greyscale
Hellinga does not teach specifically that this fragment contains a lac operator sequence. However, Bahl (1977) teaches an embodiment of a minimal lac operator sequence, AATTGTGAGCGGATAACAATT (Page 967, Fig. 1C), which is 100% match with the underlined portion of the fragment above taught by Hellinga (SEQ ID NO: 5). As evidenced by Wen (2021), Shine-Dalgarno (SD) sequences are the core element of prokaryotic ribosome-binding sites (Page 1489, Abstract, line 1). Hence, Hellinga, as evidenced by Bahl and Wen, teaches “a first spacer sequence” that comprises: a T7 promoter, a Lac operator and a prokaryotic ribosome binding site (rbs).
It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined known elements in the art to construct a polynucleotide with optimal TDO gene expression in E. coli. These elements are: the P. putida TDO gene sequences taught by GenBank, stop codon options taught by Hecht, exogenous TDO expression strategies taught by De Lorme, codon optimization techniques taught by Hénaut and Al-Hawash, and the incorporation of T7 promoter, rbs, and lac operator elements for enhancing transgene expression in E. coli taught by Hellinga. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to combine these known functional elements because Hecht, Hénaut, De Lorme, Hellinga, and Al-Hawash collectively teach using exogenous gene expression in E. coli and other microbes based on known gene sequence and known encoded enzyme activities, which is well-established platform in the art to achieve exogenous gene expression scalability and yield because inserting a transgene from an environmental organism like P. putida into E. coli, using known high-performing vector designs with enhanced prokaryotic gene expression feature elements, is a routine, conventional strategy well proven to produce high yields of enzymes. One would have reasonable expectations of success because Al-Hawash describes “Codon optimization can induce high levels of gene expression” and showcases successful examples (Page 51, Conclusion, line 1; Page 49, Table 2) provides PHOSITAs with reasonable expectation of success.
Regarding claim 2, given that the amino acid sequences of TodC1/TodC2/TodB/TodA were already known in the art, taught by GenBank, and given that codon-optimization of a known protein sequence for expression in a specific host using publicly available, routine codon-usage data, e.g. one embodiment of codon usage table for E. coli taught by Hénaut (Page 5, Table 2), was a well-known technique in the art, as demonstrated by De Lorme. More importantly, the specification does not disclose any criticality regarding any specific codon. It would have been obvious to a PHOSITA to generate the claimed nucleotide segments by routine application of E. coli codon-preference tables to the known protein sequences. The relatively low raw nucleotide identity between the claimed segments and the closest prior art nucleotide sequences, i.e. GenBank, reflects only the well-understood degeneracy of the genetic code and known interspecies codon usage differences (P. putida vs. E. coli), rather than any unpredictable or inventive contribution, particularly absent any demonstration in the specification that the specific codon choices produce results different from other codon-optimized variants encoding the identical protein. As the sequence alignments shown above demonstrate, these nucleotides in the claimed regions of SEQ ID NO: 1 are merely synonymous codon substitutions for a known protein sequence, not a distinct invention. Given the finite numbers of solutions predictable for each amino acid codons useable to address the known problem of codon usage bias across species, a common cause for low yield or loss of function during protein production, the facts above form an “obvious-to-try” rationale, providing reasonable expectations of success, i.e. arriving at a polynucleotide encoding the identical protein complex with high yield and preserved known function.
Regarding claim 3, Wen further teaches that “Discovered by Shine and Dalgarno in 1974, the prevalence of AG-rich sequences at the centre of E. coli RBSs promotes translation initiation” regarding the consensus Shine-Delgarno rbs (SD-RBS) sequences often associated with E. coli RBSs (Page 1489, left column, 2nd ¶, lines 1-3), since the benefit of including an SD-RBS is evident in the above discussed commercial vector, pET24a, “promotes translation initiation”, it is obvious for PHOSITAs to at least experiment with including it in some embodiments as a second spacer between the second and third nucleotide sequences, i.e. between the TodC2 and TodB genes to ensure high expression levels of all TDO complex components encoded by the polynucleotide in some embodiments for optimization.
Regarding claim 4, it is obvious for the same reasons stated for claim 2 above. It is further noted, however, claim 4 also implicitly requires the first spacer sequence between the coding sequences for TodC1 and TodC2, e.g. positions 1351-1463 of SEQ ID NO: 1, which is the claimed SEQ ID NO: 3.
1351 tcgagat ctcgatcccg cgaaattaat acgactcact ataggggaat tgtgagcgga taacaattcc cctctagaaa taattttgtt taactttaag aaggagatat acc 1463
This sequence has already been shown to have 100% sequence identity with the SEQ ID NO: 5 of Hellinga in the rejection of claim 1, see sequence alignment above.
Claim 4 also implicitly requires the second spacer sequence between the coding sequences of TodC2 and TodB, e.g. positions 2028-2035 of SEQ ID NO: 1, which is: gtgatgtc (positions 2025-2025 is taa, the stop codon for TodC2). This second spacer sequence is taught by GenBank (1993), as the naturally occurring spacer sequence between TodC2 and TodB gene, nucleotide position 2647-2654 is also gtgatgtc (GenBank_1993_J04996.1.pdf listed in PTO-892).
Regarding claim 5, De Lorme further teaches developing vectors based on an engineered polynucleotide (Page 4, ¶[00017]; FIG. 3; Pages 37-38, ¶[000170]-¶[000174]).
Regarding claim 23, GenBank teaches the second spacer sequence comprises GTGATGTC based on the same reasoning above in the rejection in claim 4.
Claims 6, 8-9, 16, 18, and 24-27 are rejected under 35 U.S.C. 103 as being unpatentable over GenBank (1993), in view of Hecht (2017), De Lorme (2016), Hénaut (1996), Al-Hawash (2017), and Hellinga (2018), as evidenced by Bahl (1977) and Wen (2021), further in view of Novagen (1998, product sheet for the pET24a vector used in the instant specification; See the attached Novagen_1998_pET24a vector map tb070vm.pdf listed in PTO-892), as evidenced by Schäfer (Appl Microbiol Biotechnol. 1997;48(1):47-52.
The teachings of GenBank (1993), Hecht (2017), De Lorme (2016), Hénaut (1996), Al-Hawash (2017), and Hellinga (2018) have been discussed above as applied to claims 1-5, 23, and applied herein. None of GenBank, Hecht, De Lorme, Hénaut, Al-Hawash, and Hellinga teaches the following limitations of claims 6 or 16: a second T7 promoter, a second rbs, or a second Lac operator.
However, Novagen (1998) has been offering a commercial vector pET24a for prokaryotic gene expression since as early as 1998 based on the product sheet (See above, listed in PTO-892), which is widely used for prokaryotic gene expression experiments known in the art, as evidenced by Schäfer (1997; Page 47, Abstract, line 6), which shows that a cloning/expression region sequence includes a T7 promoter, a lac operator, a RBS, and a T7 terminator (Page 1, cloning/expression region map, below).
PNG
media_image8.png
362
977
media_image8.png
Greyscale
It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have further combined the polynucleotide construct of claim 1 or claim 4 with a well characterized and widely used commercial prokaryotic expression vector taught by Novagen (1998). It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results, i.e. robust gene expression in E. coli host cells. One would have been motivated to do so because it is known routine procedure using these specialized prokaryotic gene expression vectors as evidenced by Schäfer (1997; Page 47, Abstract, line 6). One would have reasonable expectations of success because Schäfer describes robust exogenous gene expression in E. coli (Page 51, Fig. 4).
Regarding claim 6, the required element (2) has been rejected as claim 1 above. Novagen teaches the expression vector designed for prokaryotic transgene expression comprising element (1) a T7 promoter 5’ to the multiple cloning sites (MCS) comprising numerous unique restriction sites, e.g. NheI, BAM HI, EcoRI etc. and element (3) a T7 terminator element 3’ to the MCS (vector map above).
Regarding claim 16, the required element (2) has been rejected as claim 4 above. Novagen teaches the same elements (1) and (3) as in claim 6, and further teaches elements (a) a second rbs located between the second T7 promoter and the fist nucleotide sequence, which would have been inserted in one of those unique restriction sites in the MCS region, and (b) a second lac operator located between the second T7 promoter and the second rbs.
Regarding claim 8, De Lorme further teaches “host cells” comprising the vector of claim 6 (Page 38, ¶[000174]).
Regarding claim 18, De Lorme further teaches “host cells” are NEB T7 cells in Example 1 (Page 47, ¶[000210]), as evidenced by NEB (See NEB_T7 Express Competent E. coli (High Efficiency).pdf in PTO-892, NEB T7 cells are engineered to express T7 RNA polymerase, Page 1, 2nd bullet point).
Regarding claim 9, De Lorme further teaches “cloning a recombinant DNA and transformation of microorganisms” and “suitable for maintenance and growth of a bacterial culture are known in the art” (Page 43, ¶[000192]-[000193]), and demonstrates method of such process wherein host cells express the recombinant polynucleotide (Pages 47-50, Examples 1-4).
Regarding claim 24, the same rejection reasoning applied to claim 16 is applied herein.
Regarding claim 25, the Novagen vector variant pET24d, see the vector map above comprising a restriction site NcoI, which comprises a sequence of GAAGGAGATATACC in the second spacer sequence, which is identical to the claimed SEQ ID NO: 9.
Regarding claim 26, the same rejection reasoning applied to claim 16 above is applied herein.
Regarding claim 27, the same rejection reasoning applied to claim 18 above is applied herein.
Claims 12-13, 21-22, and 28 are rejected under 35 U.S.C. 103 as being unpatentable over GenBank (1993), in view of Hecht (2017), De Lorme (2016), Hénaut (1996), Al-Hawash (2017), Hellinga (2018), as evidenced by Bahl (1977) and Wen (2021), and Novagen (1998), as evidenced by Schäfer (1997), further in view of Zylstra (J Biol Chem. 1989;264(25):14940-6;cited on IDS filed on 10/26/2023) and Endoma (Org. Process Res. Dev. 2002; 6 (4): 525–532). See full citations for each art above.
The teachings of GenBank (1993), Hecht (2017), De Lorme (2016), Hénaut (1996), Al-Hawash (2017), and Hellinga (2018) have been discussed above as applied to claims 1-5, 23, and applied herein. None of GenBank, Hecht, De Lorme, Hénaut, Al-Hawash, and Hellinga teaches a process of preparing a compound of formula (2).
Howevever, Zylstra (1989) teaches a process of preparing a compound of formula (2) shown in Fig. 1 (Page 14941), involving:
Step (1), culturing the host cell comprising the polynucleotide of claim 1 or expression cassette of claim 6 or 16 under conditions suitable for the expression of the polynucleotide (Page 14940, Abstract, lines 22-26; Page 14946, Supplementary Material, under Induction/Expression studies).
Step (2), the base reaction underlying this process: toluene dioxygenase converts the substrate toluene of formula (1), cultured in an E. coli host expressing the todC1C2BA genes in strain JM109 transformed with pDTG601, to the corresponding cis-dihydrodiol product of formula (2) made from toluene, i.e. the claimed substrate of formula (1) (Page 14941, Fig. 1; Page 14943, Table II; Fig. 4; Right column, 2nd ¶).
Step (3) recovering the compound of formula (2) from the fermentation broth of step (2) (Page 14946, Supplementary Material, under Induction/Expression studies).
A PHOSITA would have found it obvious to apply this same methodology using the host cells of claims 8 and 18. The recitation by Zylstra “Preliminary studies with isopropyl-P-D-thiogalactopyranoside-induced cells of JM109(pDTG601) showed that they were capable of oxidizing toluene to cis-toluene dihydrodiol” (Page 14943, right column, 2nd ¶, lines 5-9) summarizes the process. Zylstra does not teach additional species of substrates with R representing different chemical groups in formulae (1) and (2).
However, Endoma (2002) teaches a broad range of species representative of the R genus for formulae (1) and (2) using host cells JM109 (pDTG601), the same host cell strain as Zylstra (Page 527, Table 2), e.g. R=Me, which is methyl, a C2 alkyl, and many more.
Regarding claim 12, it would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have further combined the polynucleotide construct of claim 1 or claim 4 with a well characterized and widely used known biocatalysis process taught by Zylstra and Endoma to convert a broad genus of suitable substrates into desirable bioproducts. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results, i.e. robust biocatalysis of desired products using E. coli-based host cells. One would have been motivated to do so because it is known routine procedure using these specialized prokaryotic host cells comprising engineered gene expression vectors as evidenced by Zylstra and Endoma. One would have reasonable expectations of success because Zylstra and Endoma independently describe robust biocatalysis in E. coli using diverse substrates (Zylstra Fig. 1; Endoma, Tables 2-4). Zylstra and Endoma collectively teach the steps of using the host cells prepared in claim 8 comprising the expression cassette or vector of claim 5 or 6, comprising the polynucleotide of claim 1.
Regarding claim 13, both Zylstra and Endoma teach the process according to claim 12, wherein the R is methyl, the compound of formula (1) is toulene, and the compound of formula (2) is cis-(1S,2R)-3-methyl-3,5-cyclohexadiene-1,2-diol (Zylstra Fig. 1; Endoma, Tables 2-3).
Regarding claim 21, Zylstra and Endoma collectively teach the process of using the host cells prepared in claim 18 comprising the expression cassette or vector of claim 4 or 16, comprising the polynucleotide of claim 4, 3, or 1.
Regarding claim 22, Zylstra and Endoma further teach the process of claim 21, wherein the R is methyl, the compound of formula (1) is toulene, and the compound of formula (2) is cis-(1S,2R)-3-methyl-3,5-cyclohexadiene-1,2-diol (Zylstra Fig. 1; Endoma, Tables 2-3).
Regarding claim 28, both Zylstra and Endoma teach the process according to claim 12, wherein the R is methyl, (Zylstra Fig. 1; Endoma, Tables 2-3).
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights