DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received 07/07/2023. Claims 1-15 are currently pending and are examined herein.
Claim Objections
Claims 1 and 3 are objected to because of the following informalities:
The claims recite a microRNA-238 antagonist. However, from the other claims (e.g., claims 4-8) and the examples in the specification (e.g., para [0027]), which disclose miR-328 antagonists, it is clear that this is a typographical error and should be, “microRNA-328”.
Claim 3 is objected to because of the following informalities:
The claim recites the term “an anti-miR-328 oligonucleotide comprises an oligonucleotide sequence”. This is grammatically incorrect and should be, “an anti-miR-328 comprising an oligonucleotide sequence”. Appropriate correction is required.
Claims 6-7 recite the phrase “the anti-miR-328 oligonucleotide is consisted of”. This is grammatically incorrect and should be, “the anti-miR-328 oligonucleotide consists of”. Appropriate correction is required.
Drawings
The drawings are objected to for the following reason.
7 CFR 1.84 (u)(1) states “Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.”
In the current case, Figure 8 has multiple views (pages 8-9), but only the first view is labeled, and the partial views are not identified by a number followed by a capital letter, e.g., FIG. 8A, FIG. 8B, etc.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Information Disclosure Statement
The listing of references in the PCT international search report is not considered to be an information disclosure statement (IDS) complying with 37 CFR 1.98. 37 CFR 1.98(a)(2) requires a legible copy of: (1) each foreign patent; (2) each publication or that portion which caused it to be listed; (3) for each cited pending U.S. application, the application specification including claims, and any drawing of the application, or that portion of the application which caused it to be listed including any claims directed to that portion, unless the cited pending U.S. application is stored in the Image File Wrapper (IFW) system; and (4) all other information, or that portion which caused it to be listed. In addition, each IDS must include a list of all patents, publications, applications, or other information submitted for consideration by the Office (see 37 CFR 1.98(a)(1) and (b)), and MPEP § 609.04(a), subsection I. states, “the list ... must be submitted on a separate paper.” Therefore, the references cited in the international search report have not been considered. Applicant is advised that the date of submission of any item of information in the international search report will be the date of submission of the IDS for purposes of determining compliance with the requirements for the IDS with 37 CFR 1.97, including all timing statement requirements of 37 CFR 1.97(e). See MPEP § 609.05(a).
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Claim Interpretation
The specification does not provide an explicit definition of the term “ocular surface”. Craig et al. (TFOS DEWS II Definition and Classification Report.The Ocular Surface 15 (2017) 276e283.) defines the ocular surface as follows:
the ocular surface is defined as comprising the structures of the eye and adnexa, including the cornea, conjunctiva, eyelids, eyelashes, tear film, main and accessory lacrimal glands, and the meibomian glands.
For the purposes of examination, the term will be interpreted according to its definition in the art, as disclosed by Craig.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2, 4-5, 7-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 2 is unclear over recitation of, “unspecified etiologies”. This language is considered to be indefinite because, being unspecified, it is not clear what etiologies are encompassed by the claim. The specification does not provide a definition for the term or provide examples of what the unspecified etiologies encompass.
Amending the claim to delete the term “unspecified etiologies” would obviate this rejection.
Claims 4, 5, 7 and 8 recite the term “the anti-miR-328 oligonucleotide”. There is insufficient antecedent basis for the term. The instantly rejected claims all depend from claim 2, but claim 2 does not recite an anti-miR-328 oligonucleotide. Claim 1, from which claim 2 depends, does not recite an anti-miR-328 oligonucleotide, either. Instead, it recites a broader genus of microRNA antagonists. It is noted that claim 3 recites wherein the microRNA-238 [sic] antagonist is an anti-miR-328 oligonucleotide. Amending claims 4 and 5 to depend on claim 3 would therefore obviate this rejection.
Claim 8 recites the term “the formulation”. There is insufficient antecedent basis for the term. None of claims 5, 2 or 1, from which claim 8 depends, recite a “formulation”. While claim 1 recites a pharmaceutical composition, it is not clear whether the formulation is intended to be the same thing as the pharmaceutical composition, or whether it is intended to include other elements. Amending the claim to recite “the pharmaceutical composition” instead of “the formulation” would obviate this rejection.
Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein.
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2 and 9-15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Claim 2 recites a method of treating ocular surface damage caused by an eye disease or eye injury in a subject, comprising administering to said subject a pharmaceutical composition comprising a therapeutically effective amount of a miR-238 [sic] antagonist. As described above, this is interpreted as a miR-328 antagonist, and miR-238 as a typographical error. The miR-328 antagonist is generic. The claim does not define the antagonist by any structure, only by function (see MPEP 2173.05(g)). The claim also recites that these products must have a functional outcome of treating ocular surface damage when administered in a therapeutically effective amount. The specification does not disclose a sufficient description of a representative number of species, by disclosure of structure and a known correlation between the claimed structure and function, sufficient to show the applicant was in possession of the claimed genus of miR-328 antagonists with the function of treating ocular damage.
Wen summarizes the state of the art regarding miRNA antagonists (Wen et al. Small Molecules Targeting MicroRNA for Cancer Therapy: Promises and Obstacles. J Control Release. 2015 December 10; 219: 237–247.). Wen teaches various miRNA inhibitors, from antisense oligonucleotides (§ 3.1.1), miRNA sponges (§ 3.1.2), CRISPR/Cas9-based genome editing (§ 3.1.3), and small molecule inhibitors (§ 4). While antisense oligonucleotides, miRNA sponges, and CRISPR guide RNAs all function on similar principles, i.e., antisense binding of a target miRNA, small molecule inhibitors are much more varied and unpredictable in their functionality. Wen notes that while, “it would be promising to develop small molecular weight drugs to target specific miRNAs and inhibit their activities (named SMIR)”, it is also true that, “poor understanding of miRNA X-Ray crystallography or NMR structure as well as the limited availability of miRNA-Dicer or RISC complex structure makes the design of small molecule inhibitor of miRNA much more difficult” (p. 8). Wen further lists several challenges in SMIR design due to a lack of knowledge about miRNA crystal structure and the structure-function characteristics of SMIRs and their miRNA targets (p. 13):
The challenges for development and application of SMIR and SMMR are searching for more potent compounds and the delivery issue. Based on previous researches, people are still far away from being able to efficiently design potent SMIRs and SMMRs with clear understanding of their inhibition mechanisms. According to recently developed SMIRs, we can conclude that what we did was only to discover the new application of previous drugs. Currently designed SMIRs were able to target only a small number of oncomiRs (Table 3). Furthermore, several crucial defects of the current screening strategies or structure-based design techniques cannot be ignored. For instance, molecular beacon-based screening needs further improvement to exclude the false positive which might be caused by the interaction with fluorophore and quencher.
Wen also notes another unpredictable issue with SMIRs, stating, “there is another kind of off-target effect of SMIR need to be solved since single SMIR may target multiple miRNAs.” (p. 13).
In summary, the art shows that the genus of miRNA antagonists includes small molecule inhibitors, but these inhibitors are a large genus with variable and difficult to predict structures, functions, and interactions with their miRNA targets.
In contrast with the breadth, variability, and unpredictability of miRNA antagonists, particularly SMIRs, disclosed by the art, the specification discloses only a handful of specific antisense oligonucleotide sequences (para [0023]). The specification does not disclose any small molecule inhibitors, nor does it provide any guidance as to how a small molecule inhibitor capable of targeting miR-328 may be designed, much less what amount would be therapeutically effective to obtain the recited outcome.
Based on the breadth of the claims, the limited amount of guidance provided by the specification and the art, the high degree of variation among members of the claimed genus, and further the unpredictability in the art, one of ordinary skill in the art would conclude that Applicant was not in possession of the invention as broadly claimed.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
Determining the scope and contents of the prior art.
Ascertaining the differences between the prior art and the claims at issue.
Resolving the level of ordinary skill in the pertinent art.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-4 and 8-15 are rejected under 35 U.S.C. 103 as being unpatentable over U.S. PGPUB 2016/0010087 A1 to Juo (hereinafter ‘Juo’) in view of Yu (Yu et al. PAX6, modified by SUMOylation, plays a protective role in corneal endothelial injury. Cell Death and Disease (2020) 11:683.), as evidenced by Craig (Craig et al. TFOS DEWS II Definition and Classification Report. The Ocular Surface 15 (2017) 276e283.).
Regarding claim 1, Juo teaches a method of treating an ocular condition (myopia) in a subject, comprising administering to said subject a pharmaceutical composition comprising a therapeutically effective amount of a microRNA-238 antagonist:
1 . A method for treating and/or preventing myopia, comprising: administering an RNA interference (RNAi) to a subject, wherein the RNA interference is capable of counteracting another RNA interference, and the other RNA interference is an RNA interference capable of inhibiting an expression of PAX-6 gene, and the RNA interference capable of inhibiting an expression of PAX-6 gene comprises microRNA-328.
Regarding claim 3, Juo teaches wherein the microRNA-238 antagonist is an anti-miR-328 oligonucleotide comprising an oligonucleotide sequence complementary to miR-238, or a precursor thereof:
[0041] …microRNA-328 may comprise an original human microRNA-328 (the sequence of the original human microRNA-328 is CUGGCCCUCUCUGCCCUUCCGU (SEQ ID NO. 3))
[0088] …a locked nucleic acid modified antisense for microRNA-328 (the sequence thereof was GGAAGGGCAGAGAGGGCCA (SEQ ID NO. 7)
Regarding claim 4, Juo wherein the anti-miR-328 oligonucleotide ranges from 15 to 22 nucleotides in length (SEQ ID NO: 7, shown above).
Regarding claims 14 and 15,Juo teaches wherein the pharmaceutical composition is administered to the eye topically (claim 14) in the form of eye drops (claim 15):
[0088] 50 nM locked nucleic acid modified antisense for microRNA-328 was dissolved in PBS buffer while in another experiment group, liposome was used to encapsulate locked nucleic acid modified antisense for microRNA-328. The two medicaments were dropped into different eyes of the mouse, respectively, once a day, for 3 continuous days.
[0109] …locked nucleic acid modified antisense for microRNA-328 could enter into ocular tissues in the form of an eye drop to reach the expected curative effect of treating myopia.
Juo does not teach a method of treating ocular surface damage caused by an eye disease or eye injury wherein the eye disease or eye injury is any of dry eye disease, chemical or physical injury, infection, or neurosensory abnormalities (relevant to claim 2). Nor does Juo teach wherein ocular surface damage is caused by dry eye disease, neurotrophic keratitis, corneal abrasion due to physical injury, chemical injury, or Meibomian gland dysfunction (relevant to claims 9-13).
Yu teaches that, “PAX6…plays a protective role in corneal endothelial injury” (Title). Yu lists, “extra traumas, corneal surgeries, and stresses from glaucoma or endothelial dystrophies” as possible sources of ocular surface damage. Yu further notes that, “inadequate levels of PAX6 protein can induce abnormal differentiation of corneal limbus and delayed healing of injured corneal epithelium” (p. 2/15), describes PAX6 as, “a key factor in corneal endothelial wound healing” and states, “forced PAX6 expression in corneal endothelium that could alleviate the corneal edema induced by injuries via improving the “barrier” function” (p. 14/15). Yu discloses that this was tested in a “scratch” corneal epithelial cell wound model and a corneal freezing injury model in mice, i.e., models of physical injury to the ocular surface (p. 2/15).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have used the miR-328 antagonist to increase PAX6 expression, as taught by Juo, in treatments for ocular surface injury (such as physical by increasing PAX6 expression, as taught by Yu. It was known in the art that PAX6 expression was required for wound repair of the corneal epithelium, and forced (i.e., increased) PAX6 expression alleviated corneal edema induced by injuries, as taught by Yu. It was also known that miR-328 negatively regulated PAX6, as taught by Juo. The ordinary artisan would have been motivated to try treating ocular surface injury using Juo’s miR-328 antagonist and would have had a reasonable expectation of success based on Juo’s teachings that the antagomiR could be successfully administered to the eye to inhibit miR-328 and increase PAX6, and on Yu’s teachings that the results of increased PAX6 expression alleviated injury.
Regarding claim 8, wherein the anti-miR-328 oligonucleotide is at a concentration of 1-500 or 10-160 uM, while neither Juo nor Yu disclose those concentrations, it would have been well within the grasp of the ordinary artisan to test a variety of doses of a pharmaceutical composition to determine the optimal dose to achieve the highest efficacy and lowest toxicity. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense to provide routine optimization.
Claims 5-7 are rejected under 35 U.S.C. 103 as being unpatentable over Juo and Yu, as applied to claims 1-4 and 8-15, further in view of Lennox (Lennox & Behlke. Chemical modification and design of anti-miRNA oligonucleotides. Gene Therapy (2011) 18, 1111-1120.).
Juo and Yu render obvious the method of claims 2 and 3, from which the instantly rejected claims depend, as described above.
Juo and Yu do not teach wherein the anti-miR-328 oligonucleotide is 16-17 nucleotides in length, or consists of SEQ ID NOs: 3 or 4.
However, Juo does teach an anti-miR-328 oligonucleotides which is 19 nucleotides in length, and differs from the recited SEQ ID NOs: by only 2 or 3 nucleotides at the 5’ end:
Juo SEQ ID NO: 7: GGAAGGGCAGAGAGGGCCA
SEQ ID NO: 3 AGGGCAGAGAGGGCCA
SEQ ID NO: 4: AAGGGCAGAGAGGGCCA
Lennox teaches that, “LNA/DNA mixmers were among the most potent antagomiR designs, and that LNA-modified can be made shorter than the target miRNA and retain high potency (p. 1116). Lennox further discloses, “a 16mer LNA/DNA AMO” (anti-miRNA oligonucleotide) which, “showed ~ 10-fold higher potency (Id.). Lennox suggests that, when designing AMOs that are shorter than the target miRNA, truncation is preferably done at the 5’ end of the AMO sequence (corresponding to the 3’-end of the miRNA target) so that when hybridized, the AMO fully spans the miRNA seed region.” (Id.).
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the 19-mer anti-miR-328 oligonucleotide, as taught by Juo, into a shorter 16-17 nucleotide LNA/DNA mixmer, as taught by Lennox. The ordinary artisan would have been motivated by Lennox’s teachings that short LNA/DNA mixmers were among the most potent AMO designs, and that truncation at the 5’ end would have allowed shortening of the AMO without interfering with binding with the miRNA seed region. Given a finite number of possible lengths, it would have been obvious to try shorter mixmers to determine which length had the highest potency and least toxicity.
Conclusion
No claim is allowed at this time.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMANDA M ZAHORIK/Examiner, Art Unit 1636
Prosecution Insights