Prosecution Insights
Last updated: April 19, 2026
Application No. 18/261,319

MODULATION OF CHITINASE PROTEIN EXPRESSION

Non-Final OA §103§112
Filed
Jul 13, 2023
Examiner
MOLOYE, TITILAYO
Art Unit
1632
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Dignity Health
OA Round
1 (Non-Final)
63%
Grant Probability
Moderate
1-2
OA Rounds
3y 11m
To Grant
99%
With Interview

Examiner Intelligence

Grants 63% of resolved cases
63%
Career Allow Rate
336 granted / 530 resolved
+3.4% vs TC avg
Strong +47% interview lift
Without
With
+47.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
44 currently pending
Career history
574
Total Applications
across all art units

Statute-Specific Performance

§101
3.8%
-36.2% vs TC avg
§103
36.6%
-3.4% vs TC avg
§102
14.9%
-25.1% vs TC avg
§112
29.8%
-10.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 530 resolved cases

Office Action

§103 §112
DETAILED ACTION This action is in reply to papers filed 1/16/2024. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Examiner’s Note All paragraph numbers throughout this office action, unless otherwise noted, are from the US PGPub of this application US20240084323A1, Published 3/14/2024. Election/Restrictions Applicant’s election without traverse of Group I (claims 1-2, 4-5, 9, 17, 23-24, 27, 36-38, and 64) in the reply filed on 12/16/2025 is acknowledged. Claims 39, 43-37 and 49 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected inventions, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/16/2025. Drawings The drawings are objected to because Fig. 15 and Fig. 16 are illegible. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 23 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 23 recites, inter alia, “…at least about..” At issue here is that the metes and bounds of this phrase, when read in the context of the claim, is unclear. While the term ‘about’ reasonably provides for one of ordinary skill in the art a means of ascertaining a numerical boundary to the specified parameter; when coupled with 'at least', the term’s boundaries are wholly unclear. Moreover, the claim recites, inter alia, “…with a sequence selected from SEQ ID NO: 87.” This recitation is confusing as a selection requires choosing between at least two elements. Appropriate correction is requested. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Prior Art Rejection 1 Claim(s) 1-2, 4, 24 and 38 are rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009). Choi teaches deletion of Chi311 (a chitinase) in animal models shows reduced melanoma lung metastasis with increased IFNγ, T-bet, Granzyme B-producing CD4 and CD8 T cells in the lung (Pg. 4,para. 59). Thus, towards this end, Choi and colleagues disclose a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer, as an active ingredient, an adeno-associated vector (AAV) (as in claim 1b) (Pg. 1,para. 14) carrying a Chi311 (as in claim 2) siRNA (as in claim 1a(i) (in-part) and claim 24), cells containing the vector (as in claim 38) or a culture medium of the cells (Pg. 1,para. 10). Choi teaches the Chi311 siRNA is a siRNA that specifically binds to the miRNA of the Chi311 gene (as in claim 4) to inhibit Chi311 expression (Pg. 4,para. 64). And although Choi teaches an AAV vector comprising the siRNA, Choi fails to teach the siRNA is operably linked to a promoter (as further in claim 1a(i)). Krykbaev et al. teach isolated nucleic acid molecules that are nucleic acid inhibitors (e.g. antisense, siRNA) of endogenous chitinase-encoding nucleic acid molecules (Pg. 2, para. 11). Krykbaev teaches the antisense nucleic acid molecules can be delivered to cells via vectors (Pg. 2-3, para. 19). Krykbaev teaches that in order to achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred (as further in claim 1a(i)) (Pg. 12, para. 119). When taken with the teachings of Choi et al., wherein Choi teaches a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer, said composition comprising an AAV vector comprising a Chi311 siRNA that specifically binds to the miRNA of the endogenous Chi311 gene such that Chi311 gene expression is reduced, one of ordinary skill in the art would have found it prima facie obvious to operably link a strong promoter, such as a pol II or pol III promoter, to the siRNA because Krykbaev teaches that in order to achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong are preferred. Therefore, the claimed invention, as a whole, was clearly prima facie obvious. Prior Art Rejection 2 Claims 5, 9, 17, 23, 27, 36, 38 and 64 are rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009) as applied to claims 1-2, 4, 24 and 38 above, and further in view of Lewin et al. (WO2006135436A2, Published 12/21/2006 ), and O’Connor et al. (Hum Gene Ther Methods. 2019 Dec 16;30(6):214–225.) Claim interpretation: (1) Claim 23 recites, inter alia, "….. (CBA) promoter comprising a nucleic acid sequence comprising at least about 75% or more, at least about 85% or more, at least about 95% or more, or 100% sequence identity with a sequence selected from SEQ ID NO: 87.." The term "identity" is considered to encompass both global and local alignment identities. Generally, the terms 'identical' or percent 'identity,' in the context of two or more nucleic acids or peptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region). A % nucleotide sequence identity value is determined by the number of matching identical nucleotides divided by the total number of nucleotides of the "longer" sequence in the aligned region. The "longer" sequence is the one having the most actual nucleotides in the aligned region . Accordingly, the term "identity” does not require comparison over the entire length of either of the two molecules being compared. (I1) Claim 64 is drawn to a kit for modifying the expression of a chitinase protein in a target cell, the kit comprising one or more vector-mediated engineered systems of a composition comprising the engineered vector-mediated system of claim 1. Claim 64 recites that the kit is for the treatment of prevention of a neuronal condition in a subject in need thereof. This recitation is an intended use of the kit and is of no significance to the structure of the kit. Accordingly, no patentable weight is assigned to this recitation. The teachings of Choi et al. and Krykbaev et al. are relied upon as detailed above. And although Krykbaev teaches placing the nucleic acid molecule under a pol II or pol III promoters (Pg. 12,para. 119), Krykbaev fails to teach the promoter is a chicken beta promoter (as in claim 23). Lewin et al. teach RNA interference (RNAi) has become a powerful tool for blocking gene expression in mammals and mammalian cells. Lewin teaches this approach requires the delivery of small interfering RNA (siRNA) either as RNA itself or as DNA, using an expression plasmid or virus and the coding sequence for small hairpin RNAs that are processed to siRNAs. However, Lewin warns that current expression systems for the production of siRNA in vivo rely on RNA polymerase III promoters. Moreover, Lewin notes that these promoters are difficult to regulate and leave most of the RNA in the nucleus of the cell where it is inactive for RNA interference (Abstract). Towards this end, Lewin teaches an AAV vector comprising a siRNA for the mRNA encoding chitinase (Pg. 31, para. 129;Pg. 6,para. 32). Lewin teaches the AAV vector includes at least one AAV ITR (as in claim 27, in-part) and a chicken beta actin promoter sequence (as in claim 23, in-part) (Pg. 76, para. 252) positioned upstream of the siRNA and at least one AAV ITR positioned downstream of the siRNA (as in claim 27) (Pg. 10,para. 49). Lewin teaches the AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, e.g. the rep and/or cap genes, but retain functional flanking ITR sequences (as in claim 36) (Pg. 10,para. 40; Pg. 21, para. 90). Lewin teaches a kit comprising the AAV vector (as in claim 64) (Pg. 72, para. 233). And although Lewin teaches a chicken beta actin promoter, none of Choi et al., Krykbaev et al. nor Lewin et al. teach the chicken beta actin promoter is at least about 75% identical to SEQ ID NO: 87 (as in claim 23). Before the effective filing date of the claimed invention, O'Connor et al. taught an AAV vector comprising, inter alia, a chicken β-actin promoter (Pg. 215, Col. 2, para. 1) that is 99.9% identical (as in claim 23) to SEQ ID NO: 87. See below. RESULT 1 LOCUS MK225672 5763 bp DNA circular SYN 26-JUN-2019 DEFINITION Recombinant vector pTR-CB-GFP, complete sequence. ACCESSION MK225672 VERSION MK225672.1 KEYWORDS . SOURCE Recombinant vector pTR-CB-GFP ORGANISM Recombinant vector pTR-CB-GFP other sequences; artificial sequences; vectors. REFERENCE 1 (bases 1 to 5763) AUTHORS O'Connor,D.M., Lutomski,C., Jarrold,M.F., Boulis,N.M. and Donsante,A. TITLE Lot-to-lot Variation in Adeno-associated Virus Serotype 9 (AAV9) Preparations . . . . . repeat_region 4090..4195 /note="mutant" /rpt_type=inverted /rpt_type=terminal regulatory 4242..4521 /regulatory_class="enhancer" /note="CMV enhancer" regulatory 4528..4797 /regulatory_class="promoter" /note="derived from chicken B-actin" intron 4863..4959 /note="modSV40 late 16s int" . . . Query Match 74.3%; Score 1669.4; Length 5763; Best Local Similarity 99.9%; Matches 1670; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 TGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4091 TGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTG 4150 Qy 61 GTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGAATTCACGCGTGGAT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4151 GTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGAATTCACGCGTGGAT 4210 Qy 121 CTGAATTCAATTCACGCGTGGTACCTCTGGTCGTTACATAACTTACGGTAAATGGCCCGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4211 CTGAATTCAATTCACGCGTGGTACCTCTGGTCGTTACATAACTTACGGTAAATGGCCCGC 4270 Qy 181 CTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4271 CTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAG 4330 Qy 241 TAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4331 TAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCC 4390 Qy 301 ACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4391 ACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACG 4450 Qy 361 GTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4451 GTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGC 4510 Qy 421 AGTACATCTACTCGAGGCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4511 AGTACATCTACTCGAGGCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACC 4570 Qy 481 CCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4571 CCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGG 4630 Qy 541 GGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4631 GGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAG 4690 Qy 601 AGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4691 AGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCG 4750 Qy 661 GCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGCGGGATCAGCCAC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4751 GCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGCGGGATCAGCCAC 4810 Qy 721 CGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTTT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4811 CGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTTT 4870 Qy 781 AGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4871 AGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGC 4930 Qy 841 TCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4931 TCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAA 4990 Qy 901 AGCTGCGGAATTGTACCCGCGGCCGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4991 AGCTGCGGAATTGTACCCGCGGCCGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAG 5050 Qy 961 GAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCAC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5051 GAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCAC 5110 Qy 1021 AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5111 AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAG 5170 Qy 1081 TTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5171 TTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACC 5230 Qy 1141 TACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5231 TACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAG 5290 Qy 1201 TCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAAC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5291 TCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAAC 5350 Qy 1261 TACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5351 TACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTG 5410 Qy 1321 AAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTAC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5411 AAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTAC 5470 Qy 1381 AACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5471 AACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTC 5530 Qy 1441 AAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAAC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5531 AAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAAC 5590 Qy 1501 ACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5591 ACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCC 5650 Qy 1561 GCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5651 GCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACC 5710 Qy 1621 GCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCCT 1671 ||||||||||||||||||||||||||||||||||||||||||||||||| | Db 5711 GCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCAT 5761 The combination of prior art cited above in all rejections under 35 U.S.C.103 satisfies the factual inquiries as set forth in Graham v. John Deere Co., 383 U.S. 1,148 USPQ 459 (1966). Once this has been accomplished the holdings in KSR can be applied (KSR International Co. v. Teleflex Inc. (KSR), 550 U.S. 389, 82 USPQ2d 1385 (2007): "Exemplary rationales that may support a conclusion of obviousness include: (A) Combining prior art elements according to known methods to yield predictable results; (B) Simple substitution of one known element for another to obtain predictable results; (C) Use of known technique to improve similar devices (methods, or products) in the same way; (D) Applying a known technique to a known device (method, or product) ready for improvement to yield predictable results; (E) "Obvious to try" - choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success; (F) Known work in one field of endeavor may prompt variations of it for use in either the same field or a different one based on design incentives or other market forces if the variations are predictable to one of ordinary skill in the art; (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention." In the present situation, rationales A and G are applicable. Before the effective filing date of the claimed invention, it would have been prima facie obvious to an artisan of ordinary skill in the art to combine the teachings of Choi et al. in view of Krykbaev et al., wherein the combination teaches a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer, said composition comprising an AAV vector comprising a nucleotide encoding a Chi311 siRNA operably linked to a strong pol II or poll III promoter, one of ordinary skill in the art would have found it prima facie obvious to substitute the generic poll II promoter for the CBA promoter of Lewin et al. A reasonable expectation of arriving at the claimed invention is present in view of the O’Conner’s teaching of a nucleotide encoding CBA. A person of skill in the art would have been motivated to select the CBA promoter because Lewin warns that pol III promoters are difficult to regulate and leave most of the RNA in the nucleus of the cell where it is inactive for RNA interference. Thus, the teachings of the cited prior art in the obviousness rejection above provide the requisite teachings and motivations with a clear, reasonable expectation. The cited prior art meets the criteria set forth in both Graham and KSR. Therefore, the claimed invention, as a whole, was clearly prima facie obvious. Prior Art Rejection 3 Claim 37 is rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009) as applied to claims 1-2, 4, 24 and 38 above, and further in view of Slack et al. (PGPub US20210395777A1, Filed 19/15/2019). The teachings of Choi et al. and Krykbaev et al. are relied upon as detailed above. However, neither Choi et al. nor Krykbaev et al. teach a nucleic acid construct comprising the vector (as in claim 37). Before the effective filing date of the claimed invention, Slack et al. taught methods and systems for use in the production of adeno-associated virus (AAV) particles, including recombinant adeno-associated virus (rAAV) particle (Abstract). At Pg. 26, para. 287, Slack teaches baculovirus expression vectors (BEV) for producing AAV particles in insect cells provide high titers of viral vector product. Elaborating, Slack teaches the method comprises recombinant baculoviruses encoding the viral expression construct and payload construct (as in claim 37) initiate a productive infection of viral vector replicating cells (Pg. 17, para. 192). Slack teaches infectious baculovirus particles released from the primary infection secondarily infect additional cells in the culture, exponentially infecting the entire cell culture population in a number of infection cycles that is a function of the initial multiplicity of infection (Pg. 26,para. 287). In one embodiment, Slack teaches the vector comprises a siRNA (Pg. 31, para. 372; Pg. 9, para. 104). One of ordinary skill in the art would have found it prima facie obvious to use the method of Slack et al. to derive particles of the AAV vector of Choi et al. in view of Krykbaev et al. The skilled artisan would have found it prima facie obvious to do so because high titers are crucial for effective, high-efficiency gene therapy transduction and, in many cases, necessary to overcome neutralizing antibodies. Thus, for the treatment of cancer, as set forth in Choi et al., the combination would have been prima facie obvious. Authorization to Initiate Electronic Communications The examiner may not initiate communications via electronic mail unless and until applicants authorize such communications in writing within the official record of the patent application. See M.P.E.P. § 502.03, part II. If not already provided, Applicants may wish to consider supplying such written authorization in response to this Office action, as negotiations toward allowability are more easily conducted via e-mail than by facsimile transmission (the PTO's default electronic-communication method). A sample authorization is available at § 502.03, part II. Allowable Subject Matter The sequences recited in claims 5, 9 and 17 are free of art. Claim Objections Claims 5, 9 and 17 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TITILAYO MOLOYE whose telephone number is (571)270-1094. The examiner can normally be reached Working Hours: 5:30 a.m-3:00 p.m. M-F. Off first Friday of biweek.. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached on 571- 272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TITILAYO MOLOYE/ Primary Examiner, Art Unit 1632
Read full office action

Prosecution Timeline

Jul 13, 2023
Application Filed
Mar 05, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600968
METHODS AND COMPOSITIONS FOR REPROGRAMMING CELLS
2y 5m to grant Granted Apr 14, 2026
Patent 12584112
ORGANOID TISSUE ENGINEERING
2y 5m to grant Granted Mar 24, 2026
Patent 12582677
METHODS FOR PRODUCING RETINAL TISSUE AND RETINA-RELATED CELL
2y 5m to grant Granted Mar 24, 2026
Patent 12569541
STEM CELLS FOR TRANSPLANTATION AND MANUFACTURING METHOD THEREFOR
2y 5m to grant Granted Mar 10, 2026
Patent 12503677
PLANT FAT-BASED SCAFFOLDS FOR THE GROWTH OF CELL-BASED MEATS AND METHODS OF MAKING SUCH PRODUCTS
2y 5m to grant Granted Dec 23, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
63%
Grant Probability
99%
With Interview (+47.2%)
3y 11m
Median Time to Grant
Low
PTA Risk
Based on 530 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month