DETAILED ACTION
This action is in reply to papers filed 6/17/2026. Claims 1-2,4-5,9,17,23-24,27,36-38 and 64-70 are pending and examined herein.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Examiner’s Note
All paragraph numbers throughout this office action, unless otherwise noted, are from the US PGPub of this application US20240084323A1, Published 3/14/2024.
Drawings
The objection to the Fig. 15 and Fig. 16 are withdrawn in view of the Replacement Drawings filed 6/17/2026.
Withdrawn Rejections
The 112 (b) rejection of claim 23 is withdrawn in view of amendments made to the claim.
Maintained Rejection(s)
The 103(a) rejection of claims 1-2, 4, 24 and 38 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009) is maintained. Applicant’s arguments will be addressed following maintained rejection.
The 103(a) rejection of claims 5, 9, 17, 23, 27, 36, and 64 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009) as applied to claims 1-2, 4, 24 and 38 above, and further in view of Lewin et al. (WO2006135436A2, Published 12/21/2006 ), and O’Connor et al. (Hum Gene Ther Methods. 2019 Dec 16;30(6):214–225.). Applicant’s arguments will be addressed following maintained rejection.
The 103(a) rejection of claim 37 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009) as applied to claims 1-2, 4, 24 and 38 above, and further in view of Slack et al. (PGPub US20210395777A1, Filed 19/15/2019). Applicant’s arguments will be addressed following maintained rejection.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Prior Art Rejection 1
Claim(s) 1-2, 4, 24 and 38 remain and new claim 65-66 is rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009). Although maintained, the rejection has been updated to reflect amendments to the claims.
Claim interpretation: Instant claim 1 is drawn to an engineered vector-mediated system for modifying the expression of a chitinase protein in a target cell in the nervous system, the system comprising: a) a nucleic acid expression construct comprising: i) a promoter operably linked to a nucleic acid sequence encoding a programmable nucleic acid modification system targeted to a nucleotide sequence encoding the chitinase protein; or ii) a nucleotide sequence encoding the chitinase protein operably linked to a promoter; and b) a nucleic acid delivery vector comprising the nucleic acid expression construct for delivering the nucleic acid expression construct to the target cell in the nervous system; wherein expressing the programmable nucleic acid modification system or chitinase protein modifies the expression of the chitinase protein in the target cell in the nervous system.
The recitation “for modifying the expression of a chitinase protein in a target cell in the nervous system” in the preamble is interpreted as an intended use of the engineered vector-mediated system. Consequently, the recitation “target cell in the nervous system” imbues no structural limitation onto the claim. That is, no weight is given to the target cell being in the nervous system because the vector mediated system requires no cell. Note this interpretation to limitations drawn to the specific type of nervous cell, as in claim 65 and claim 66 (in-part).
Moreover, the last ‘wherein’ clause of the claim is an intended result of an intended use. Because the claim does not require use of the vector-mediated system, no weight is given is given to the intended result. The rejection below is made in view of this interpretation.
Choi teaches deletion of Chi311 (a chitinase) in animal models shows reduced melanoma lung metastasis with increased IFNγ, T-bet, Granzyme B-producing CD4 and CD8 T cells in the lung (Pg. 4,para. 59). Thus, towards this end, Choi and colleagues disclose a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer, as an active ingredient, an adeno-associated vector (AAV) (as in claim 1b) (Pg. 1,para. 14) carrying a Chi311 (as in claim 2, claim 66(in-part)) siRNA (as in claim 1a(i) (in-part) and claim 24), cells containing the vector (as in claim 38) or a culture medium of the cells (Pg. 1,para. 10). Choi teaches the Chi311 siRNA is a siRNA that specifically binds to the miRNA of the Chi311 gene (as in claim 4) to inhibit Chi311 expression (Pg. 4,para. 64).
And although Choi teaches an AAV vector comprising the siRNA, Choi fails to teach the siRNA is operably linked to a promoter (as further in claim 1a(i)).
Krykbaev et al. teach isolated nucleic acid molecules that are nucleic acid inhibitors (e.g. antisense, siRNA) of endogenous chitinase-encoding nucleic acid molecules (Pg. 2, para. 11). Krykbaev teaches the antisense nucleic acid molecules can be delivered to cells via vectors (Pg. 2-3, para. 19). Krykbaev teaches that in order to achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred (as further in claim 1a(i)) (Pg. 12, para. 119).
When taken with the teachings of Choi et al., wherein Choi teaches a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer, said composition comprising an AAV vector comprising a Chi311 siRNA that specifically binds to the miRNA of the endogenous Chi311 gene such that Chi311 gene expression is reduced, one of ordinary skill in the art would have found it prima facie obvious to operably link a strong promoter, such as a pol II or pol III promoter, to the siRNA because Krykbaev teaches that in order to achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong are preferred.
Therefore, the claimed invention, as a whole, was clearly prima facie obvious.
Prior Art Rejection 2
Claims 5, 9, 17, 23, 27, 36 and 64 remain rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009) as applied to claims 1-2, 4, 24, 38 and 65-66 above, and further in view of Lewin et al. (WO2006135436A2, Published 12/21/2006 ), and O’Connor et al. (Hum Gene Ther Methods. 2019 Dec 16;30(6):214–225.) Although maintained, the rejection has been updated to reflect amendments to the claims.
Claim interpretation: Claim 64 is drawn to a kit for modifying the expression of a chitinase protein in a target cell, the kit comprising one or more vector-mediated engineered systems of a composition comprising the engineered vector-mediated system of claim 1. Claim 64 recites that the kit is for the treatment of prevention of a neuronal condition in a subject in need thereof. This recitation is an intended use of the kit and is of no significance to the structure of the kit. Accordingly, no patentable weight is assigned to this recitation.
The teachings of Choi et al. and Krykbaev et al. are relied upon as detailed above. And although Krykbaev teaches placing the nucleic acid molecule under a pol II or pol III promoters (Pg. 12,para. 119), Krykbaev fails to teach the promoter is a chicken beta promoter (as in claim 23).
Lewin et al. teach RNA interference (RNAi) has become a powerful tool for blocking gene expression in mammals and mammalian cells. Lewin teaches this approach requires the delivery of small interfering RNA (siRNA) either as RNA itself or as DNA, using an expression plasmid or virus and the coding sequence for small hairpin RNAs that are processed to siRNAs. However, Lewin warns that current expression systems for the production of siRNA in vivo rely on RNA polymerase III promoters. Moreover, Lewin notes that these promoters are difficult to regulate and leave most of the RNA in the nucleus of the cell where it is inactive for RNA interference (Abstract). Towards this end, Lewin teaches an AAV vector comprising a siRNA for the mRNA encoding chitinase (Pg. 31, para. 129;Pg. 6,para. 32). Lewin teaches the AAV vector includes at least one AAV ITR (as in claim 27, in-part) and a chicken beta actin promoter sequence (as in claim 23, in-part) (Pg. 76, para. 252) positioned upstream of the siRNA and at least one AAV ITR positioned downstream of the siRNA (as in claim 27) (Pg. 10,para. 49). Lewin teaches the AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, e.g. the rep and/or cap genes, but retain functional flanking ITR sequences (as in claim 36) (Pg. 10,para. 40; Pg. 21, para. 90). Lewin teaches a kit comprising the AAV vector (as in claim 64) (Pg. 72, para. 233).
And although Lewin teaches a chicken beta actin promoter, none of Choi et al., Krykbaev et al. nor Lewin et al. teach the chicken beta actin promoter is at least 75% identical to SEQ ID NO: 87 (as in claim 23).
Before the effective filing date of the claimed invention, O'Connor et al. taught an AAV vector comprising, inter alia, a chicken β-actin promoter (Pg. 215, Col. 2, para. 1) that is 99.9% identical (as in claim 23) to SEQ ID NO: 87. See below.
RESULT 1
LOCUS MK225672 5763 bp DNA circular SYN 26-JUN-2019
DEFINITION Recombinant vector pTR-CB-GFP, complete sequence.
ACCESSION MK225672
VERSION MK225672.1
KEYWORDS .
SOURCE Recombinant vector pTR-CB-GFP
ORGANISM Recombinant vector pTR-CB-GFP
other sequences; artificial sequences; vectors.
REFERENCE 1 (bases 1 to 5763)
AUTHORS O'Connor,D.M., Lutomski,C., Jarrold,M.F., Boulis,N.M. and
Donsante,A.
TITLE Lot-to-lot Variation in Adeno-associated Virus Serotype 9 (AAV9)
Preparations
.
.
.
.
.
repeat_region 4090..4195
/note="mutant"
/rpt_type=inverted
/rpt_type=terminal
regulatory 4242..4521
/regulatory_class="enhancer"
/note="CMV enhancer"
regulatory 4528..4797
/regulatory_class="promoter"
/note="derived from chicken B-actin"
intron 4863..4959
/note="modSV40 late 16s int"
.
.
.
Query Match 74.3%; Score 1669.4; Length 5763;
Best Local Similarity 99.9%;
Matches 1670; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 TGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4091 TGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTG 4150
Qy 61 GTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGAATTCACGCGTGGAT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4151 GTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGAATTCACGCGTGGAT 4210
Qy 121 CTGAATTCAATTCACGCGTGGTACCTCTGGTCGTTACATAACTTACGGTAAATGGCCCGC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4211 CTGAATTCAATTCACGCGTGGTACCTCTGGTCGTTACATAACTTACGGTAAATGGCCCGC 4270
Qy 181 CTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4271 CTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAG 4330
Qy 241 TAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4331 TAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCC 4390
Qy 301 ACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4391 ACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACG 4450
Qy 361 GTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4451 GTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGC 4510
Qy 421 AGTACATCTACTCGAGGCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4511 AGTACATCTACTCGAGGCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACC 4570
Qy 481 CCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGG 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4571 CCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGG 4630
Qy 541 GGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAG 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4631 GGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAG 4690
Qy 601 AGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCG 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4691 AGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCG 4750
Qy 661 GCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGCGGGATCAGCCAC 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4751 GCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGCGGGATCAGCCAC 4810
Qy 721 CGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTTT 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4811 CGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTTT 4870
Qy 781 AGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGC 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4871 AGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGC 4930
Qy 841 TCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAA 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4931 TCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAA 4990
Qy 901 AGCTGCGGAATTGTACCCGCGGCCGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAG 960
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4991 AGCTGCGGAATTGTACCCGCGGCCGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAG 5050
Qy 961 GAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCAC 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5051 GAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCAC 5110
Qy 1021 AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAG 1080
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5111 AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAG 5170
Qy 1081 TTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACC 1140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5171 TTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACC 5230
Qy 1141 TACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAG 1200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5231 TACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAG 5290
Qy 1201 TCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAAC 1260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5291 TCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAAC 5350
Qy 1261 TACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTG 1320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5351 TACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTG 5410
Qy 1321 AAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTAC 1380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5411 AAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTAC 5470
Qy 1381 AACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTC 1440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5471 AACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTC 5530
Qy 1441 AAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAAC 1500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5531 AAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAAC 5590
Qy 1501 ACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCC 1560
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5591 ACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCC 5650
Qy 1561 GCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACC 1620
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5651 GCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACC 5710
Qy 1621 GCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCCT 1671
||||||||||||||||||||||||||||||||||||||||||||||||| |
Db 5711 GCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCAT 5761
The combination of prior art cited above in all rejections under 35 U.S.C.103 satisfies the factual inquiries as set forth in Graham v. John Deere Co., 383 U.S. 1,148 USPQ 459 (1966). Once this has been accomplished the holdings in KSR can be applied (KSR International Co. v. Teleflex Inc. (KSR), 550 U.S. 389, 82 USPQ2d 1385 (2007): "Exemplary rationales that may support a conclusion of obviousness include: (A) Combining prior art elements according to known methods to yield predictable results; (B) Simple substitution of one known element for another to obtain predictable results; (C) Use of known technique to improve similar devices (methods, or products) in the same way; (D) Applying a known technique to a known device (method, or product) ready for improvement to yield predictable results; (E) "Obvious to try" - choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success; (F) Known work in one field of endeavor may prompt variations of it for use in either the same field or a different one based on design incentives or other market forces if the variations are predictable to one of ordinary skill in the art; (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention."
In the present situation, rationales A and G are applicable. Before the effective filing date of the claimed invention, it would have been prima facie obvious to an artisan of ordinary skill in the art to combine the teachings of Choi et al. in view of Krykbaev et al., wherein the combination teaches a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer, said composition comprising an AAV vector comprising a nucleotide encoding a Chi311 siRNA operably linked to a strong pol II or poll III promoter, one of ordinary skill in the art would have found it prima facie obvious to substitute the generic poll II promoter for the CBA promoter of Lewin et al. A reasonable expectation of arriving at the claimed invention is present in view of the O’Conner’s teaching of a nucleotide encoding CBA.
A person of skill in the art would have been motivated to select the CBA promoter because Lewin warns that pol III promoters are difficult to regulate and leave most of the RNA in the nucleus of the cell where it is inactive for RNA interference.
Thus, the teachings of the cited prior art in the obviousness rejection above provide the requisite teachings and motivations with a clear, reasonable expectation. The cited prior art meets the criteria set forth in both Graham and KSR.
Therefore, the claimed invention, as a whole, was clearly prima facie obvious.
Prior Art Rejection 3
Claim 37 remains rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009) as applied to claims 1-2, 4, 24, 34, 38 and 65-66 above, and further in view of Slack et al. (PGPub US20210395777A1, Filed 19/15/2019).
The teachings of Choi et al. and Krykbaev et al. are relied upon as detailed above. However, neither Choi et al. nor Krykbaev et al. teach a nucleic acid construct comprising the vector (as in claim 37).
Before the effective filing date of the claimed invention, Slack et al. taught methods and systems for use in the production of adeno-associated virus (AAV) particles, including recombinant adeno-associated virus (rAAV) particle (Abstract). At Pg. 26, para. 287, Slack teaches baculovirus expression vectors (BEV) for producing AAV particles in insect cells provide high titers of viral vector product. Elaborating, Slack teaches the method comprises recombinant baculoviruses encoding the viral expression construct and payload construct (as in claim 37) initiate a productive infection of viral vector replicating cells (Pg. 17, para. 192). Slack teaches infectious baculovirus particles released from the primary infection secondarily infect additional cells in the culture, exponentially infecting the entire cell culture population in a number of infection cycles that is a function of the initial multiplicity of infection (Pg. 26,para. 287). In one embodiment, Slack teaches the vector comprises a siRNA (Pg. 31, para. 372; Pg. 9, para. 104).
One of ordinary skill in the art would have found it prima facie obvious to use the method of Slack et al. to derive particles of the AAV vector of Choi et al. in view of Krykbaev et al. The skilled artisan would have found it prima facie obvious to do so because high titers are crucial for effective, high-efficiency gene therapy transduction and, in many cases, necessary to overcome neutralizing antibodies. Thus, for the treatment of cancer, as set forth in Choi et al., the combination would have been prima facie obvious.
Applicant’s Arguments’/Response to Arguments
Applicant argues: In response, without acquiescing to the correctness of the Examiner's position and solely to advance prosecution, Applicant amends claim 1 to recite, inter alia, "[a]n engineered vector mediated system for modifying the expression of a chitinase protein in a target cell in the nervous system, the system comprising: . . . wherein expressing the programmable nucleic acid modification system or chitinase protein modifies the expression of the chitinase protein in the target cell in the nervous system." Applicant respectfully submits that the cited references, individually or in combination, fail to teach or suggest all of the features recited in amended claim 1. The nervous-system target-cell feature is not merely a statement of intended therapeutic use. Amended claim 1 recites a nucleic acid delivery vector comprising the expression construct "for delivering the nucleic acid expression construct to the target cell in the nervous system," and further recites that expression modifies chitinase expression "in the target cell in the nervous system." The Office Action does not identify any teaching in Choi or Krykbaev of a delivery vector configured for such nervous-system target-cell delivery.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. This is because independent claim 1 does not require target cell in the nervous system nor does independent claim 1 require nucleic acid expression construct in the target cell in the nervous system. At the outset, the claim is drawn to a vector system. A vector system, generally, does not comprise a cell. Moreover, instant claim is a product claim. Therefore, it would be improper for a product claim to recite a (process) step of delivering a nucleic acid expression in a target cell. Turning to the claim, as recited, all that is required by the independent claim 1 is a) nucleic acid expression construct comprising i) a promoter operably linked to a nucleic acid sequence encoding a programmable nucleic acid modification system targeted to a nucleotide sequence encoding the chitinase promoter OR ii) a nucleic sequence encoding the chitinase protein operably linked to a promoter AND b) a nucleic acid delivery vector comprising the nucleic acid expression construct. The claim does not require a cell nor does the claim require a step of delivering the nucleic acid construct into the cell.
Applicant argues: Choi is cited as allegedly teaching a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer that includes an adeno-associated virus carrying a CHBL 1 siRNA. Choi is not directed to modifying expression of a chitinase protein in a target cell in the nervous system, as recited in amended claim 1. There is no teaching or suggestion that the composition of Choi, or any method taught by Choi, would necessarily be capable of modifying expression of a chitinase protein in a target cell in the nervous system, as recited in amended claim 1. To the contrary, Choi repeatedly ties its asserted therapeutic effect to lung-directed delivery, stating that intranasal administration is preferred and that other routes require at least a two-fold higher concentration to obtain the same effect. Choi therefore would not have directed a skilled artisan toward a nervous-system-targeted vector-mediated system, but instead teaches a locally delivered pulmonary siRNA-complex strategy for achieving effects in lung tissue.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. As noted, the claim does not require a target cell, let alone a target cell in the nervous system. This is because independent claim 1 does not require target cell in the nervous system nor does independent claim 1 require nucleic acid expression construct in the target cell in the nervous system.
Applicant argues: Krykbaev likewise is relied upon only for the general proposition that chitinase-encoding nucleic acid inhibitors may be delivered by vectors and may be placed under a strong Pol II or Pol III promoter. Nothing in the Office Action identifies a teaching in Krykbaev that would remedy Choi's deficiency with respect to the presently claimed nervous-system target cell and delivery thereto.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. As noted, the claim does not require a target cell, let alone a target cell in the nervous system. This is because independent claim 1 does not require target cell in the nervous system nor does independent claim 1 require nucleic acid expression construct in the target cell in the nervous system.
Applicant argues: This rejection should be withdrawn for at least the reasons discussed above with respect to amended claim 1. The additional teachings of Lewin and O'Connor do not cure the deficiencies of Choi and Krykbaev concerning the claimed nervous-system target cell and delivery of the nucleic acid expression construct to that nervous-system target cell. Lewin and O'Connor are relied upon for promoter and AAV-vector architecture features, not for modifying expression of a chitinase protein in a target cell in the nervous system. Thus, even if Lewin and O'Connor were considered to supply the CBA promoter and AAV ITR features recited in dependent claims 23 and 27, the Office Action still does not explain why a person of ordinary skill would have modified Choi's pulmonary metastasis therapy to arrive at the claimed nervous-system-targeted engineered vector-mediated system.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. As noted, the claim does not require a target cell, let alone a target cell in the nervous system. This is because independent claim 1 does not require target cell in the nervous system nor does independent claim 1 require nucleic acid expression construct in the target cell in the nervous system.
Applicant argues: This rejection should be withdrawn. Slack is relied upon for AA V production methods, not for the substantive engineered vector-mediated system required by amended claim 1. Thus, Slack does not cure the deficiencies of Choi and Krykbaev discussed above. The Office Action does not identify any teaching in Slack that would have led a person of ordinary skill to the claimed nervous system target-cell system.
In Response: Applicant’s arguments have been fully considered, but are not found persuasive. As noted, the claim does not require a target cell, let alone a target cell in the nervous system. This is because independent claim 1 does not require target cell in the nervous system nor does independent claim 1 require nucleic acid expression construct in the target cell in the nervous system.
Because Applicant’s arguments were not found persuasive, the rejection is maintained.
New Rejection(s) Necessitated by Amendments
Prior Art Rejection 4
New claim 67 is rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021) and Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009) as applied to claims 1-2, 4, 24, 38 and 65-66 above, and further in view of Mazur et al. (PgPub US20210015822A1, Filed 7/15/2020).
The teachings of Choi et al. and Krykbaev et al. are relied upon as detailed above. However, none of these references teach the chitinase is Chit-1 and the target cell in the nervous system is an activated microglial cell (as in claim 67).
Before the effective filing date of the claimed invention, Mazur et al. teach methods of treating lung cancer (Pg. 27, Para. 269) with Chit-1 (as in claim 67,in-part) inhibitors (Abstract; Pg. 1, para. 2). Regarding the target cell being an activated microglial cell, as explained in the ‘Claim interpretation’ in ‘Prior Art Rejection 1’, there is no structural requirement for a cell in the vector mediated system of claim 1.
When taken with the teachings of Choi et al. and Krykbaev, wherein the combination teaches a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer, said composition comprising an AAV vector comprising a nucleotide encoding a Chi311 siRNA operably linked to a strong pol II or poll III promoter, one of ordinary skill in the art would have found it prima facie obvious to substitute the Chi311 siRNA for a CHIT1 siRNA in view of Mazur’s teaching that CHIT1 is the predominant chitinase detected in humans (see Mazur at Pg. 1, para. 3).
Accordingly, the combination of Choi et al., Krykbaev et al. and Mazur et al. would have been prima facie obvious.
Prior Art Rejection 5
New claim 68 is rejected under 35 U.S.C. 103 as being unpatentable over Choi et al. (PgPub US20210046151A1, Published 2/18/2021), Krykbaev et al. (PgPub US20090010942A1, Published 1/8/2009),Lewin et al. (WO2006135436A2, Published 12/21/2006 ), and O’Connor et al. (Hum Gene Ther Methods. 2019 Dec 16;30(6):214–225.) as applied to claims 1-2, 4, 5, 9, 17, 23, 24, 27, 36, 38 and 64-66 above (Prior Art Rejection 2), and further in view of Gray et al. (PgPub US20170360960A1, Published 12/21/2021).
The teachings of Choi et al., Krykbaev et al., Lewin et al. and O’Conner et al. are relied upon as detailed above. However, none of these references teach the rAAV vector has tropism to a glial cell or an astrocyte (as in claim 68).
Before the effective filing date of the claimed invention, Gray et al. taught chimeric AAV capsids targeted to the central nervous system, virus vectors comprising the same, and methods of using the vectors to target the central nervous system (Abstract). Gray teaches the cell(s) into which the virus vector can be introduced may be of any type, including but not limited to neural cells (including cells glial cells, astrocytes) (as in claim 68) and lung cells (Pg. 21, para. 225).
When taken with the teachings of Choi et al., Krykbaev et al., Lewin et al. and O’Conner et al., wherein the combination teaches a pharmaceutical composition for preventing or treating pulmonary metastasis of cancer, said composition comprising an AAV vector comprising a nucleotide encoding a Chi311 siRNA operably linked to a CBA promoter, one of ordinary skill in the art would have found it prima facie obvious to substitute the generic AAV vector with the chimeric AAV vector of Gray et al. in view of Gray’s teaching of a tropism for lung cells.
Accordingly, the combination of cited art would have been prima facie obvious.
Authorization to Initiate Electronic Communications
The examiner may not initiate communications via electronic mail unless and until applicants authorize such communications in writing within the official record of the patent application. See M.P.E.P. § 502.03, part II. If not already provided, Applicants may wish to consider supplying such written authorization in response to this Office action, as negotiations toward allowability are more easily conducted via e-mail than by facsimile transmission (the PTO's default electronic-communication method). A sample authorization is available at § 502.03, part II.
Conclusion
Claims 1-2,4-5,9,17,23-24,27,36-38 and 64-68 are rejected.
Claims 69-70 are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TITILAYO MOLOYE whose telephone number is (571)270-1094. The examiner can normally be reached Working Hours: 5:30 a.m-3:00 p.m M-F. Off first friday of biweek..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached on 571- 272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TITILAYO MOLOYE/Primary Examiner, Art Unit 1632