DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Response to Amendment
The amendment filed 12 August 2026 is acknowledged. Claims 62-76 are amended.
Election/Restrictions and Interview Summary
As previously described, the response to the restriction/election requirement dated 16 April 2026 is acknowledged. Applicant elected “In response to the Restriction Requirement, Applicant elects an extracellular domain of CD40L, an intracellular domain of CD40L, and a transmembrane domain of CD40L where the intracellular domain of CD40L is inverted. Applicant further elects SEQ ID NO: 186. SEQ ID NO: 186 includes muCD40L-CD40 DCR. This species election for claim 67 reads on claim 67 and the claims that depend therefrom. Applicant makes this election without traverse” (Remarks 4/16/2026 p. 6). Because the elected species “an extracellular domain of CD40L, an intracellular domain of CD40L, and a transmembrane domain of CD40L where the intracellular domain of CD40L is inverted” did not read on any of the pending claims, the Examiner reached out to the Applicant for clarification in an interview on 1 May 2026. In an interview with Janina Malone on 5/1/2026, it was determined that there was a typographical error in the election, and that the election was intended to read “an intracellular domain of CD40 […] where the intracellular domain of CD40 is inverted”, as recited in amended claim 64. The election is made without traverse.
Regarding claims 74 and 75, the examiner notes that the instantly elected species reads on comprising a cancer antigen binding domain because instantly elected CD40L binds to CD40, which is expressed on multiple myeloma cells and an anti-CD40 antibody has been shown to have anti-cancer activity (Tai, Yu-Tzu, et al. "Human anti-CD40 antagonist antibody triggers significant antitumor activity against human multiple myeloma." Cancer research 65.13 (2005): 5898-5906); therefore, CD40L is considered a cancer antigen binding domain. Therefore, some embodiments of claim 74, and all embodiments of claim 75 (which requires the polynucleotide does not comprise a spacer region, a cancer antigen binding domain, and a viral antigen binding domain), do not read on the elected species.
Claims 63, 65, and 75 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 16 April 2026.
Claim Status
Claims 62-81 are pending. Claims 63 and 65 are withdrawn as directed to an unelected species, the being no allowable generic or linking claim, as described above. Claims 62, 64, and 66-81 are under examination in the instant office action.
Withdrawal of Objections
The objection to the disclosure is withdrawn in view of the amendments to the specification.
The objections to claims 66, 67, 69, and 70 for informalities is withdrawn in view of the amendments to the claims.
Withdrawal of Rejections
The rejection of claims 62, 64, 66-74, and 76-81 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite is withdrawn in view of the amendments to the claims.
The rejection of claims 66 and 67-81 on the basis that they contain an improper Markush grouping of alternatives is withdrawn in view of the amendments to the claims.
Claim Rejections - 35 USC § 112(b)- New, necessitated by amendment
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 67 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Amended claim 67 reads “wherein expression of the protein by an immune cell only increases activation of the immune cell in the presence of a ligand, when compared to an immune cell that does not express the protein in the presence of a ligand”. This is indefinite because it is unclear what is meant by this phrase. One possible interpretation is that the only function of the expression of the protein is that it increases activation of the immune cell in the presence of a ligand, and that the expression of the protein has no other effects or functions. Another possible interpretation is that there is no increase in activation of the immune cell in the presence of the ligand, when compared to an immune cell that does not express the protein in the presence of the ligand. A person of ordinary skill in the art would not be able to determine the metes and bounds of the claim because not only is it unclear which of the two interpretations applies, both limitations are incredibly broad functional limitations which are compared to a relative amount of activation for which the specification and the claim does not sufficiently demonstrate how a person of ordinary skill in the art would ascertain whether this limitation was being met. For example, the specification teaches assaying for activation relative to TCR-only controls in the presence of the ligand OKT3 plus activation for the activation marker CD69. However, there are no controls with no ligand stimulation presented in the specification; additionally, it does not appear that any other potential functions of the DCRs were addressed (e.g. other than activation markers such as CD69 and 4-1BB), and it is unclear how a person of ordinary skill in the art would demonstrate that the claimed receptor does not have any other functions. The Examiner also notes that the phrase “only increases activation of the immune cell in the presence of a ligand” does not limit the ligand to any particular ligand, and encompasses the presence of nearly any compound, including some which are expressed on T cells and Jurkat cells.
Claim Rejections - 35 USC § 112(a)- New Matter
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 67-81 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection.
Claim 67 recites the limitation “wherein expression of the protein by an immune cell only increases activation of the immune cell in the presence of a ligand, when compared to an immune cell that does not express the protein in the presence of the ligand” (Emphasis is the Examiner’s), which is not in the specification of 18261656 or 63138234, or in any claim set. The limitation is not supported in the disclosure.
Claim Rejections - 35 USC § 102- Maintained, modifications necessitated by amendment
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 62, 64, 66, 67, 69-72, 74, 76-77, and 80-81 are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by WO 02/36769 to Dicker et. al. published 10 May 2002.
Claim interpretation: Claim 67 recites a nucleotide encoding a protein comprising an extracellular domain of a stimulatory immune cell protein, an intracellular domain of a different stimulatory immune cell protein, and a transmembrane domain linking the extracellular domain to the intracellular domain, and “wherein the extracellular domain is an extracellular domain of […] CD40L”; “wherein the intracellular domain is an intracellular domain of […] CD40”. The broadest reasonable interpretation of “is” is that it is an open definition and the instant extracellular domain and intracellular domain comprise an extracellular domain of CD40L and an intracellular domain of CD40, respectively. Regarding the limitation “wherein expression of the protein by an immune cell only increases activation of the immune cell in the presence of a ligand, when compared to an immune cell that does not express the protein in the presence of the ligand” (Emphasis is the Examiner’s), this limitation is indefinite as described in the 112(b) above. For the purposes of expedited prosecution, the limitation will be considered as “wherein expression of the protein by an immune cell increases activation of the immune cell in the presence of the ligand”.
Dicker et. al. teaches a nucleic acid encoding CD40/CD40L chimeric polypeptides, wherein the nucleic acid encodes the signaling domain of CD40 and downstream thereof (claim 1;reads on intracellular domain of CD40 (reads on instant claims 67 and 70); the transmembrane receptor of the type II receptor and downstream thereof (claim 1), wherein the transmembrane domain is the transmembrane domain of CD40L (claim 2; reads on wherein the transmembrane domain comprises the transmembrane domain of CD40L, instant claim 67); and the binding and trimerization domain of CD40L (claim 1; reads on extracellular domain of CD40L, instant claims 67 and 69). Dicker et. al. teaches “Ligation of CD40L to CD40 initiates both a CD40-mediated signal (APC (Antigen presenting cell) activation) and a T-cell-stimulating signal via CD40L itself (T cell activation)” (p. 1 lines 23-25); reads on “wherein the expression of the protein by an immune cell increase activation of the immune cell in the presence of a ligand, when compared to an immune cell that does not express the protein in the presence of the ligand” (instant claim 67).
Regarding claims 62 and 66, Dicker et. al. teaches an embodiment where “In a preferred embodiment of the invention (see Fig. 1), the encoded polypeptide consists of the signaling domain of CD40 and the binding and trimerization domain of CD40L as well as the transmembrane domain of CD40L” (p. 3 lines 15-17).
Regarding claim 64, Dicker et. al. teaches the intracellular domain is an inverted intracellular domain (Fig. 1; p. 3 lines 15-17).
Regarding claim 71, Dicker et. al. teaches that the intracellular domain of the CD40 is inverted (See Fig. 1).
Regarding claim 72, Dicker et. al. teaches an embodiment where the intracellular domain of human CD40 is cloned upstream of the murine CD40L to produce a vector pcDNA3-hCD40/mCD40L (see Examples p. 21 “The CD40/CD40L fusion protein” through Example 1 p. 23); this reads on the inverted CD40 domain N-terminal to the extracellular domain because the nucleic acid coding sequence encodes the protein from N-to-C terminus.
Regarding claim 74, Dicker et. al. teaches the protein consisting of only the extracellular domain of CD40L (p. 3 lines 15-22); CD40L binds to CD40, which is not a viral antigen, and therefore the protein does not comprise a viral antigen binding domain.
Regarding claims 76-77 and 80, Dicker et. al. teaches a host cell comprising the vector (p. 6 lines 19-24) and that the invention includes T cells comprising a nucleic acid according to the invention or antigen presenting cells comprising the nucleic acid, including macrophages and dendritic cells (p. 7 lines 14-18; p. 18 lines 1-5) and that “Ligation of CD40L to CD40 initiates both a CD40-mediated signal (APC (Antigen presenting cell) activation) and a T-cell-stimulating signal via CD40L itself (T cell activation)” (p. 1 lines 23-25); reads on “wherein the expression of the protein by an immune cell increase activation of the immune cell in the presence of a ligand, when compared to an immune cell that does not express the protein in the presence of the ligand” (instant claim 67).
Regarding claim 81, Dicker et. al. teaches a HEK293 comprising the nucleic acid in vitro cultured in DMEM. The instant specification teaches “exemplary generally used pharmaceutically acceptable carriers include any and all bulking agents or fillers, solvents or co-solvents, dispersion media, coatings surfactants, antioxidants, preservatives, isotonic agents, absorption delaying agents, salts, stabilizers, buffering agents, chelating agents (e.g. EDTA), gels, binders, disintegration agents, and/or lubricants [0127]. Therefore, DMEM reads on the instant pharmaceutically acceptable carrier.
Response to Arguments
Applicant’s remarks dated 12 August 2026 have been fully considered but are not persuasive.
Regarding claim 62 and its dependents, Applicant argues that because Applicant’s claim recites “consisting of” and Dicker’s preferred embodiment teaches that the CD40 and CD40L fragments are connected by a 2-amino acid linker and other additional embodiments that may comprises linkers (Remarks p. 9-10). This is not persuasive. MPEP §2123 teaches that patents are relevant prior art for all the contains and that a reference may be relied upon for all the it would have reasonably suggested to one having ordinary skill in the art, including “nonpreferred embodiments”. The disclosure of Dicker that the embodiments may comprise a linker also clearly teaches that the linkers are optional, and therefore discloses the embodiment that does not have linkers. The Examiner notes that in the same paragraph cited by Applicant, Dicker et. al. also explicitly states “also linkage of the three domains without linker amino acids is possible” (p. 3 lines 21-22).
Regarding claim 67 and its dependents, Applicant argues that claim 67 requires that “expression of the protein by an immune cell only increases activation of the immune cell in the presence of a ligand, when compared to an immune cell that does not express the protein in the presence of the ligand” and that because Dicker teaches that the extracellular CD40L domain trimerizes spontaneously, that the constitutive activity precludes Dicker from teaching each and every limitations of claim 67. This is not persuasive. First, as describes in the 112(a) and 112(b) above, the limitations “only increases activation of the immune cell in the presence of a ligand” is both new matter and indefinite; therefore, a person of ordinary skill in the art would not be able to determine the metes and bounds of the claims. Second, the Examiner would like to note that “increases activation of the immune cell in the presence of a ligand” is a relative expression and the broadest reasonable interpretation includes any degree of activation compared to the claimed control, which is an immune cell that does not express the protein under the same circumstances. Thus, even if, en arguendo, the phrase “only increases activation of the immune cell in the presence of a ligand” could be interpreted “increases activation in the presence of a ligand, but does not increase activation in the absence of a ligand”, it would be nearly impossible to determine if this were the case, because a person of ordinary skill in the art would understand that there is likely to be at least some activity from expression of the protein even in the absence of the ligand. There is no evidence that the instantly claimed proteins meet this limitation in the instant specification: 1) There are no “no-ligand” controls to compare activity of the DCR proteins of the specification in the absence of e.g. OKT3 or MSLN; 2) Several of the ligands of the DCRs are expressed on T cells or on tumor cells, and therefore are present in the monocultures or co-cultures detailed in the instant specification (there are no knockout controls e.g. 4-1BB is a ligand for all of the 4-1BBL DCRs that is expressed in T cells and therefore is always present in the culture); and 3) there are no measurements in the specification sensitive enough to read on no increase in activation in the absence of ligand (e.g., no increased phosho-CD3-zeta).
Third, Dicker et. al. teaches identical structures to the instantly claimed CD40L ECD-CD40L TM-CD40 ICD chimeric protein, and therefore all of the functions of the protein are characteristics that would be the same. For example, Dicker et. al. teaches that the murine CD40L “ is 260 amino acids in length (MW = 29,396 Da) and starts with a cytoplasmic region of a length of 22 amino acids (Pos. 1-22), followed by a signal anchor of a length of 24 amino acids (Pos. 23-46) and an extracellular, signal-mediating domain of a length of 214 amino acids (Pos. 47-260)” (p. 12 lines 4-11). As shown below, Applicant’s specific nucleic acid embodiment SEQ ID NO: 183 encodes all of these positions 23-260 that would determine the characteristics of trimerization of CD40L:
Alignment of instant SEQ ID NO: 83 with murine CD40L (Uniprot P27548)
RESULT 1
AASEQ2_10132026_161253
Alignment Scores:
Length: 260
Score: 1210.00 Matches: 238
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 72.9% Indels: 0
DB: 1 Gaps: 0
US-18-261-656-186 (1-939) x AASEQ2_10132026_161253 (1-260)
Qy 226 ATTTTCATGTATCTGCTGACCGTCTTTCTCATCACTCAGATGATTGGGAGTGTCCTGTTC 285
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 23 IlePheMetTyrLeuLeuThrValPheLeuIleThrGlnMetIleGlySerValLeuPhe 42
Qy 286 GCGGTCTATCTGCATAGGCGCCTGGACAAGGTCGAAGAGGAGGTCAACCTGCACGAGGAC 345
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 43 AlaValTyrLeuHisArgArgLeuAspLysValGluGluGluValAsnLeuHisGluAsp 62
Qy 346 TTTGTCTTTATCAAGAAGTTGAAGCGGTGCAACAAGGGCGAAGGATCTCTGAGCCTCCTG 405
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63 PheValPheIleLysLysLeuLysArgCysAsnLysGlyGluGlySerLeuSerLeuLeu 82
Qy 406 AACTGTGAAGAAATGCGCCGACAGTTTGAGGATCTGGTAAAAGACATAACGCTTAACAAG 465
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 83 AsnCysGluGluMetArgArgGlnPheGluAspLeuValLysAspIleThrLeuAsnLys 102
Qy 466 GAAGAAAAGAAGGAGAATTCTTTCGAGATGCAACGCGGCGATGAGGATCCACAGATCGCC 525
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 103 GluGluLysLysGluAsnSerPheGluMetGlnArgGlyAspGluAspProGlnIleAla 122
Qy 526 GCGCACGTCGTCTCAGAGGCCAATTCAAACGCAGCCTCAGTACTTCAATGGGCGAAAAAG 585
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 123 AlaHisValValSerGluAlaAsnSerAsnAlaAlaSerValLeuGlnTrpAlaLysLys 142
Qy 586 GGGTATTACACCATGAAGTCTAATCTTGTTATGCTAGAGAATGGGAAGCAGCTGACAGTG 645
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 143 GlyTyrTyrThrMetLysSerAsnLeuValMetLeuGluAsnGlyLysGlnLeuThrVal 162
Qy 646 AAGCGCGAGGGGCTGTACTATGTATATACACAAGTTACCTTCTGCAGCAATAGGGAGCCA 705
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 163 LysArgGluGlyLeuTyrTyrValTyrThrGlnValThrPheCysSerAsnArgGluPro 182
Qy 706 AGTAGCCAGCGCCCCTTTATCGTGGGGCTGTGGCTCAAACCCAGCAGCGGCTCCGAACGT 765
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 183 SerSerGlnArgProPheIleValGlyLeuTrpLeuLysProSerSerGlySerGluArg 202
Qy 766 ATTCTGCTTAAGGCTGCCAACACTCACAGTTCAAGCCAGCTGTGCGAGCAGCAGTCCGTA 825
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 203 IleLeuLeuLysAlaAlaAsnThrHisSerSerSerGlnLeuCysGluGlnGlnSerVal 222
Qy 826 CATCTTGGCGGAGTCTTTGAGCTCCAGGCTGGCGCCTCAGTGTTCGTGAACGTTACCGAA 885
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 223 HisLeuGlyGlyValPheGluLeuGlnAlaGlyAlaSerValPheValAsnValThrGlu 242
Qy 886 GCTTCTCAGGTTATTCACCGGGTGGGCTTTTCTTCCTTTGGACTGCTGAAACTC 939
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 243 AlaSerGlnValIleHisArgValGlyPheSerSerPheGlyLeuLeuLysLeu 260
Dicker et. al. also teaches that the murine CD40 cytoplasmic domain is 74 amino acids long at Pos. 216-289. As shown below, Applicant’s nucleic acid SEQ ID NO: 183 encodes all of these cytoplasmic CD40 positions, excepting the conservative substitution to alter the Ile to a start codon due to the inversion:
Alignment of instant SEQ ID NO: 83 with murine CD40 (Uniprot P27512)
US-18-261-656-186 (1-939) x AASEQ2_10132026_165822 (1-289)
Qy 1 ATGAAAAAAGTGGTTAAGAAACCAAAGGACAACGAAATCCTTCCTCCCGCAGCACGACGA 60
:::|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 215 IleLysLysValValLysLysProLysAspAsnGluIleLeuProProAlaAlaArgArg 234
Qy 61 CAAGACCCTCAAGAGATGGAAGACTATCCCGGCCACAACACCGCAGCTCCAGTCCAAGAA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 235 GlnAspProGlnGluMetGluAspTyrProGlyHisAsnThrAlaAlaProValGlnGlu 254
Qy 121 ACCCTTCATGGGTGTCAACCTGTAACACAGGAAGACGGGAAAGAGTCAAGGATTTCAGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 255 ThrLeuHisGlyCysGlnProValThrGlnGluAspGlyLysGluSerArgIleSerVal 274
Qy 181 CAAGAGCGACAAGTGACTGACAGCATCGCTTTGAGGCCACTGGTT 225
|||||||||||||||||||||||||||||||||||||||||||||
Db 275 GlnGluArgGlnValThrAspSerIleAlaLeuArgProLeuVal 289
Therefore, the chimeric protein of Dicker et. al. is structurally identical to the protein of the Applicant and would have the same properties, including whether or not the protein has constitutive activity. Applicant is reminded that “A chemical composition and its properties are inseparable. In re Spada 15 USPQ2d 1655, 1658 (Fed. Cir. 1990)” (See MPEP §2112.01).
Claim Rejections - 35 USC § 103- Maintained, changes necessitated by amendment
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability should not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim 68, 78-79 and 81 are rejected under 35 U.S.C. 103 as being unpatentable over WO 02/36769 to Dicker et. al. published 10 May 2002 as applied to claims 67 and 76-77 above, and further in view of WO 2022/016114 to Bridgeman et. al. effectively filed 17 July 2020.
The teachings of Dicker et. al. in regards to claim 67 are in the 102 rejection above.
Regarding claim 68, Dicker et. al. does not teach the polynucleotide, wherein the encoded protein further comprises at least a second copy of the intracellular domain, the second copy also linked to the extracellular domain through the transmembrane domain.
This deficiency is resolved by Bridgeman et. al.
Bridgeman et. al. teaches a chimeric molecule providing costimulation for adoptive cell therapy (Abstract), wherein the chimeric protein comprises an extracellular ligand binding domain linked to an intracellular signaling domain be a transmembrane domain; the extracellular domain comprises a protein or receptor or extracellular portion thereof. Bridgeman et. al. teaches that in some embodiments the chimeric protein of the invention comprises two or more CD40 costimulatory domains; or two or more CD40 costimulatory domain signaling components or motifs [0043]. Bridgeman et. al. teaches that the number of costimulatory domains is guided by the cell in which the chimeric protein is to be expressed and/or a desired costimulatory activity [0044].
It would have been obvious for a person of ordinary skill in the art, before the effective filing date, to modify the chimeric protein of Dicker et. al. by adding a second copy of the CD40 intracellular signaling domain as taught by Bridgeman et. al. in order to vary the number of costimulatory domains for the particular cell in which the protein is expressed or the desired costimulatory activity as taught by Bridgeman et. al. This would have a reasonable expectation of success because Bridgeman et. al. teaches that a person of ordinary skill in the art would be able to determine the desired amount of costimulation for the cell type and vary the number of domains accordingly.
Regarding claims 78-79, Dicker et. al. does not explicitly teach a T cell or a CD8+ or a CD4+ T cell comprising the polynucleotide.
This deficiency is resolved by Bridgeman.
Bridgeman et. al. teaches a chimeric molecule providing costimulation for adoptive cell therapy (Abstract), wherein the chimeric protein comprises an extracellular ligand binding domain linked to an intracellular signaling domain be a transmembrane domain; the extracellular domain comprises a protein or receptor or extracellular portion thereof. Bridgeman et. al. teaches the intracellular domain comprises a CD40 signaling domain [0017-0018]. Bridgeman et. al. teaches that expression of the chimeric receptor via an extracellular clustering domain [0015] that acts to modulate cellular activity, in particular T-cell signaling through TCRs [004-005]. Bridgeman et. al. teaches that the cells of the present invention may be any lymphocyte that is useful in adoptive cell therapy, such as a T-cell or a NK cell [0065]. Bridgeman et. al. teaches multiple examples of different chimeric receptors with different extracellular domains, wherein the intracellular domain comprising the CD40 signaling domain increases cytokines (IL-2, IFNg, TNFa) and activation markers (41BB, CD69) compared to NTD controls not expressing the chimeric receptor (see e.g. Fig. 2, Fig. 3A) (reads on claim 78). Regarding claim 79, Bridgeman et. al. teaches that cells may be CD4+ or CD8+ T cells (See [0066-0069]).
Regarding claim 81, Bridgeman et. al. teaches a pharmaceutical composition containing a vector or a protein expressing cell of the invention with a pharmaceutically acceptable carrier, diluent or excipient [00116].
It would have been obvious for a person of ordinary skill in the art, before the effective filing date, to make a CD4+ or a CD8+ T cell comprising the nucleic acid encoding the chimeric receptor of Dicker et. al. to benefit from the T-cell activation and co-stimulation of a receptor comprising an extracellular oligomerization domain and a CD40 intracellular signaling domain for activating T cells as taught by Bridgeman et. al. This would have a predictable effect because Dicker et. al. teaches that the nucleic acid activates immune signaling and teaches it comprised by cells in the immune microenvironment; and that the OX40L extracellular domain forms trimers; and Bridgeman et. al. teaches that such proteins are beneficial for increased T-cell activation in cellular immunotherapy.
Response to Arguments
Applicant argues that as set forth in response to the 102 rejection, Dicker does not teach or suggest claim 67 because Dicker’s chimeric construct is constitutively active, and that Bridgeman does not cure this deficiency. This is not persuasive as described in the response to 102 Arguments section, above.
Allowable Subject Matter
The polynucleotide of claim 73 comprising SEQ ID NO: 186 is free of the prior art. The examiner notes that the other species of polynucleotide sequences in claim 73 have not been rejoined because there is no allowable generic or linking claim.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kathleen CunningChen whose telephone number is (703)756-1359. The examiner can normally be reached Monday - Friday 11-8:30 ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gregory Emch can be reached at (571) 272-8149. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KATHLEEN CUNNINGCHEN/ Examiner, Art Unit 1646
/GREGORY S EMCH/ Supervisory Patent Examiner, Art Unit 1678
Prosecution Insights