Prosecution Insights
Last updated: April 19, 2026
Application No. 18/261,995

NON-INVASIVE CANCER DETECTION BASED ON DNA METHYLATION CHANGES

Non-Final OA §101§103§112
Filed
Jul 18, 2023
Examiner
KIM, YOUNG J
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nucleix Ltd.
OA Round
1 (Non-Final)
65%
Grant Probability
Moderate
1-2
OA Rounds
3y 4m
To Grant
82%
With Interview

Examiner Intelligence

Grants 65% of resolved cases
65%
Career Allow Rate
711 granted / 1098 resolved
+4.8% vs TC avg
Strong +18% interview lift
Without
With
+17.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 4m
Avg Prosecution
61 currently pending
Career history
1159
Total Applications
across all art units

Statute-Specific Performance

§101
5.0%
-35.0% vs TC avg
§103
32.5%
-7.5% vs TC avg
§102
16.6%
-23.4% vs TC avg
§112
33.6%
-6.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1098 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I and species SEQ ID Number 1, directed to lung cancer in the reply filed on January 20, 2026 is acknowledged. Claims 47, 49, 54, and 57 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on January 20, 2026. Priority Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Information Disclosure Statement The IDS received on July 18, 2023 and September 29, 2023 are proper and are being considered by the Examiner. Drawings The drawings received on July 18, 2023 are acceptable. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 40, 41, 45, 50-53, 55, and 56 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites the preamble that connotes a definitive determination (i.e., the presence of cancer in a human subject), but concludes with the steps of “determin[ing] a likelihood that the subject has cancer.” The final step should agree with the preamble. Claim 40 is indefinite for reciting the phrase, “determining the methylation ratio” because the phrase lacks a sufficient antecedent basis. For the purpose of prosecution, the phrase has been construed to mean “determining the methylation value”, adopted from parent claim 37. The office notes that the term, “methylation ratio” occurs again at step (iv), but this instance has been construed to mean that the methylation value is “a methylation ratio”. Claim 41 is indefinite in view of the above claim interpretation for step (iv) because the claim reverts back to referring “the methylation value”. Claim 45 is indefinite because the claim lacks a nexus between the steps of determining a cell-free DNA methylation value and the conclusion of “indicative of the presence of cancer in the subject. The claim simply recites the steps of quantifying methylation values which appears to be “quantifying” the changes. Simply determining the methylation values cannot result in the indication that the subject has cancer. There must be some correlation or comparison or calculation step that allows the final step of determining the indication of, “the presence of cancer”, to which the claim is missing. Claim 50 is indefinite because the claim appears to lack a nexus between the steps of parent claim 37 and the steps of claim 50. Specifically, parent claim 37 is simply directed to determining the methylation profile of at least one of three loci (of SEQ ID NOs: 1-3) of a cfDNA. The claim does not provide any recitation related to cancer. Claim 50, however, recites that the steps of claim 37 being performed identifies the patient as being a lung, colon, breast, bladder, liver, or renal cell cancer patient. In addition, step (ii) is non-specific as to what source of the tumor sample is being analyzed. According to the specification, the tumor source must match that of the cancer to which the cfDNA methylation profile is associated with. This association and nexus is not specifically claimed resulting in a gap in the method to provide a meaningful breadth. Claims 51-53, 55, and 56 are indefinite for the same reason as that of claim 50 in that the parent claim 37 does not result in any correlation of cancer determination. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1, 34, 37-39, 45, and 56 are rejected under 35 U.S.C. 101 because the claimed invention is directed to the judicial exception/abstract idea (i.e., data manipulation) without significantly more. The claims recite a natural correlation that exist between the methylation status of at least one locus from three loci represented by SEQ ID NO: 1-3 and cancer disposition and/or data collection and mainpulation. This judicial exception is not integrated into a practical application as discussed below. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception based on the analysis under the current Patent Eligibility Guidelines (herein, “PEG”) as discussed below. Step 1 Inquiry under PEG Step 1 inquiry under Patent Eligibility Guidelines (herein, “PEG”) determines whether or not the claimed invention is drawn to one of the recognized statutory classes of invention. Claims 1, 34, 37-39, 45, and 56 satisfy the present inquiry as being drawn to a method. Claims are rejected based on either: a) judicial exception of natural correlation; or b) data collection and manipulation, and will be identified separately. Step 2A Inquiry under PEG A recently revised PEG now performs step 2A inquiry under a 2-prong analysis, and the subject claims analyzed accordingly as follows: Prong 1: Prong-1 inquiry under step 2A determines whether the claim(s) recites an abstract idea, a law of nature, or a natural phenomenon. Claims 1, 34, 45, and 56: Claims recite the natural correlation that exist between the methylation profile of loci SEQ ID NO: 1, 2, and/or 3 from a cell-free DNA and cancer. This is admitted by Applicants’ own specification: “The present invention is based, in part, on the identification of three human genomic loci as DNA methylation markers for the detection of multiple cancer types in cell-free DNA samples. These genomic loci, set forth herein as SEQ ID NO: 1 … 2 … 3, were found to have increased methylation levels in cell-free DNA of cancer patients of various types and stages compared to cell-free DNA of subjects with no cancer” (page 5, 2nd para) Some of the claims also recite additional loci (SEQ ID NO: 4-6 and different groups in claim 45) and the determination of their methylation profile. However, these are also natural correlation that exists between the methylation of these loci and cancer or the origin (i.e., source) of the cancer, as admitted by the specification: “The present invention is further based on the surprising finding that human genomic loci, set forth herein as SEQ ID NO: 4 … 5 … 6, that were previously disclosed by the inventors of the present invention to be hypermethylated in lung cancer DNA compared to normal DNA, also have increased methylation levels in cancer types other than lunger cancer, and are therefore useful as general markers of cancer. The inventors of the present invention identified that a certain increase in methylation levels of these marker loci is common to a variety of cancer types and stages, and thus serves as a general indication for the presence of cancer in a subject. A further increase in methylation levels is specifically indicative for the presence of lung cancer in the subject” (page 5, 3rd para) “present invention is further based on the identification of a set of human genomic loci as DNA methylation markers distinguishing between lung cancer and four other cancer types: colorectal, liver, breast, and hematological cancers. These genomic loci, set forth herein as SEQ ID NO: 5, 8-15 are useful for providing an indication of the tissue source of the cancer in a subject identified as likely to have cancer. As exemplified herein below, the tissue-specificity marker loci of the present invention are able to distinguish between lung cancer and the four other cancer types with 88-95% accuracy” (page 6, 2nd para) Claims 37-39: Claims 37 employs a highly generalized language in claiming a step of “determining in the cell-free DNA (cfDNA) sample a methylation value” from at least one loci selected from SEQ ID NO: 1-3. While the claim does not explicitly recite a correlation of the methylation profile to cancer (i.e., natural phenomenon), the usage of the highly generalized language of the determination step embraces data collection, that is, simply obtaining the value of the methylation levels of the recited loci, which by itself is nothing more than data collection and therefore, considered abstract. Claims 38 and 39 recite additional data manipulation steps by which methylated value is determined, but are deemed data manipulation and therefore, considered abstract. Prong 2: Prong-2 inquiry under step 2A determines whether or not the claims recite additional elements that integrate the judicial exception into a practical application in a manner that imposes a meaningful limit on the judicial exception. Claim 1, 34, and 35: Claims 1 and 34 recite the additional element in the form of comparing a methylation value of the at least one marker locus to at least one reference methylation value. However, comparison of a marker that is indicative of a test phenotype to that of reference/control phenotype (i.e., normal/wildtype) in a determination step is not deemed to pose a meaningful limit on the judicial exception as such a step demonstrate the existence of the natural correlation, wherein the comparison step is recited using a highly general way, effectively capturing just the judicial exception. Claim 35 does not recite any additional elements in the claim. Claim 56: Claim 56 recited additional elements in the form of testing additional assays from a matching sample for a mutation(s). However, the testing of mutations that is correlated with a phenotype (i.e., cancer) is also based on a natural correlation and therefore, would not amount to a meaningful application of judicial exceptions. As explained by the Supreme Court, in order to transform a judicial exception into a patent-eligible application, the additional element or combination of elements must do ‘more than simply stat[e] the [judicial exception] while adding the words ‘apply it’”. Alice Corp. v. CLS Bank, 573 U.S. __, 134 S. Ct. 2347, 2357, 110 USPQ2d 1976, 1982-83 (2014) (quoting Mayo Collaborative Servs. V. Prometheus Labs., Inc., 566 U.S. 66, 72, 101 USPQ2d 1961, 1965). Thus, for example, claims that amount to nothing more than an instruction to apply the abstract idea using a generic computer do not render an abstract idea eligible. Alice Corp., 134 S. Ct. at 2358, 110 USPQ2d at 1983. See also 134 S. Ct. at 2389, 110 USPQ2d at 1984 (warning against a § 101 analysis that turns on “the draftsman’s art”) (MPEP 2106.05(f)) Step 2B Inquiry under PEG Step 2B inquiry of the PEG determines whether or not additional elements are provided and whether such elements amount to significantly more than the judicial exception in the claims. Presently, the additional elements as discussed above are recited in a highly generic way, that embrace means of determination which are routine and conventional which are not deemed to add significantly more than the judicial exception itself. Therefore, the present claims lack patent eligibility. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 34, 37-45, 51, and 52 are rejected under 35 U.S.C. 103 as being unpatentable over Frumkin et al. (WO 2019/142193 A1, published July 2019) in view of Pfeifer et al. (US 2009/0305256 A1, published December 2009). With regard to claims 1 and 34, Frumkin et al. teach a method of assessing the presence or likelihood of a subject having cancer (“invention provides … methods … for identification of lung cancer in subjects”, page 2, lines 11-12), comprising: determining in a cell-free DNA sample of the subject a methylation value of at least one marker locus that is hypermethylated in cancer DNA compared to non-cancer DNA (“analyzing DNA from plasma samples”, page 2, lines 12-13; “genomic loci that unexpectedly were found to be highly methylated in DNA from plasma samples of lung cancer patients and not in DNA from plasma samples of healthy subjects”, page 2, lines 16-17); and comparing the methylation value of said at least one methylation locus to at least one reference methylation value selected from a cancer methylation value and a non-cancer methylation value, to determine the likelihood that the subject has cancer (“[s]ignal intensities of the amplified loci are then determined, and a ratio is calculated between the signal intensities of each restriction locus and control locus …”, page 3, lines 4-6; “comparing signal ratios calculated for DNA from a tested subject to one or more reference ratios determined for the same restriction and control loci in known sources, i.e., in normal individuals and/or in cancer patients … the tested sample is identified as derived from a cancer patient or from a healthy subject”, page 3, lines 9-13). With regard to claim 37, Frumkin et al. teach a method comprising the steps of determining in the cell-free DNA sample a methylation value for at least one marker value for at least one marker locus, two loci, or three loci (“analyzing DNA from plasma samples”, page 2, lines 12-13; “genomic loci that unexpectedly were found to be highly methylated in DNA from plasma samples of lung cancer patients and not in DNA from plasma samples of healthy subjects”, page 2, lines 16-17, also “detecting a high probability score with respect to lung cancer ratio”, page 10, lines 17-18). With regard to claim 38, the methylation value is determined by methylation mapping comprising DNA sequencing, real-time PCR or hybridization (see page 4, lines 14-15 for the determination step involving real-time PCR). With regard to claim 40, the determination of methylation value in the form of a methylation ratio comprises: subjecting cfDNA to digestion with at least one methylation-sensitive restriction endonuclease recognizing a sequence within at least one marker locus, thereby obtaining a endonuclease-treated DNA (“digesting DNA from a plasma sample obtained from the human subject with at least one methylation-sensitive restriction endonuclease”, page 9, lines 20-21); co-amplifying from the restriction endonuclease-treated DNA the at least one marker locus and a control locus, thereby generating an amplification product for each locus (“co-amplifying from the restriction endonuclease-treated DNA at least one restriction locus and a control locus … thereby generating an amplification product for each locus”, page 9, lines 21-25); determining a signal intensity for each generated amplification product (“determining a signal intensity for each generated amplification product”, page 9, line 25); and calculating a ratio between the signal intensities of the amplification products of each of said at least one restriction locus and the control locus, thereby measuring a methylation ratio of the at least one marker locus (“calculating a ratio between the signal intensities of the amplification products of the restriction locus and the control locus in said DNA sample”, page 9, lines 26-28); and thereby profiling methylation of the cfDNA (“detecting a high probability score, above a predefined threshold, for said ratio with respect to lung cancer ratio …”, page 9, lines 38-30; profiling of the methylation is accomplished by calculation of ratio and score). With regard to claim 41, the artisans teach determining a Cq for each marker and calculating the difference between the Cq of the control locus and the Cq of the restriction locus, wherein the calculation further comprises applying a composite score derived by the formula (2Cq(control locus)-Cq(restriction locus), see page 26, lines 19-22), as well as arriving at combined score (“individual probability scores calculated for each ratio (for each locus) are combined (e.g., summed or averaged) to give a combined score”, page 31, lines 4-6). With regard to claim 42, the cDNA subjected to digestion is with at least one methylation-sensitive restriction endonuclease and therefore, would necessarily comprise the recited characteristics. As well, each locus is less than 150 bases in length (see page 40, Table 1, also “primers may be designed to generate amplification products of between 70-140 bps in length”, page 20, lines 32-33). With regard to claim 43, the artisans teach SEQ ID NO: 2 which comprises the locus identified by instant SEQ ID NO: 4 (see below): Instant SEQ ID NO: 4 CCGCAGCGCCCGCCACACACCCGCGCCAGAGGTCCAGCGC |||||||||||||||||||||||||||||||||||||||| CGGTCCCGCAGCGCCCGCCACACACCCGCGCCAGAGGTCCAGCGCATGTGCAGTGAAATGGCCTAGCCC Frumkin SEQ ID NO: 2 With regard to claim 44, the artisans teach SEQ ID NO: 3 which comprises the locus identified by instant SEQ ID NO: 5 as being specific to lung tissue (i.e., lung cancer): Instant SEQ ID NO: 5 1 GCGCGGCGGGCGACAGCCCCCCGGATAACCCCGCCGAGGGAGGGGCGCTTGTAAAACCGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 7 GCGCGGCGGGCGACAGCCCCCCGGATAACCCCGCCGAGGGAGGGGCGCTTGTAAAACCGA 66 Frumkin SEQ ID NO: 3 Instant SEQ ID NO: 5 61 GCGG 64 |||| 67 GCGG 70 Frumkin SEQ ID NO: 3 With regard to claim 45, the artisans teach determining a methylation value therefrom and their correlation to lung cancer (see above, also “each calculated ratio … the probability that it represents lung cancer DNA may be determined …”, page 31, lines 1-3). With regard to claim 51 (in-part), the disclosed loci specifically relate to lung cancer and therefore would be obvious to assay for occult or stage 0 status. With regard to deciding to further confirm the diagnosis by means in the form of a low-dose CT of chest (cancer is lung cancer), or pulmonary imaging (claims 51(in-part) and 52), Frumki et al. teach that such means are conventionally known and practiced: “screening tests have been studied to determine … reduce mortality from lung cancer: low-dose computed topography (CT) scan … definitive diagnosis of lung cancer … bronchoscopy or CT-guided biopsy to sample the suspicious tissue (page 1) While Frumkin et al. teach a plurality of loci on cfDNA whose methylation relates to lung cancer, the artisans do not teach the loci represented by SEQ ID NO: 1, 2, or 3. While Frumkin et al. teach various means of detecting the methylation profile/levels of the disclosed loci, the artisans do not teach detection generating read counts (claim 39) Pfeifer et al. teach a method of detecting lung cancer in a subject by determining a methylation profile from a plurality of loci: “method of diagnosing a condition associated with an aberrant methylation of DNA in a sample from a subject by measuring the methylation level of one or more DNA biomarkers form a test sample” (section [0006]) “the method of the present invention is directed to a method of diagnosing a lung cancer” (section [0011]) Pfeifer et al. teach a plurality of loci, one of which is disclosed is OTX1: “Examples of DNA markers associated with a condition are disclosed in Tables 2 and 4 … examples of the DNA markers include … OTX1” (section [0010]) OTX1 locus is represented by SEQ ID NO: 10 which contains instant SEQ ID NO: 1 as represented below: SEQ ID NO:1 1 CCGCGGCGCCCCCGCGTGTCCCCGCAGCCACTCCGCGGAAGCAGCGGCGGGAGCGCACCA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| OTX1 121 CCGCGGCGCCCCCGCGTGTCCCCGCAGCCACTCCGCGGAAGCAGCGGCGGGAGCGCACCA 180 SEQ ID NO:1 61 CCTTCACGCGTTCACAGCTGGACGTGCTCGAGGCGC 96 |||||||||||||||||||||||||||||||||||| OTX1 181 CCTTCACGCGTTCACAGCTGGACGTGCTCGAGGCGC 216 It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Frumkin et al. with the teachings of Pfeifer et al., thereby arriving at the invention as claimed for the following reasons. As discussed above, Frumkin et al. teach a method of assessing the presence of methylation profile, producing a methylation value based therefrom, and correlating the value to a cancer predisposition (i.e., lung cancer). While the artisans did not explicitly disclose every possible loci whose methylation associated with lung cancer, one of ordinary skill in the art would have had a reasonable expectation of success at applying the teachings of Frumkin et al. for other loci known in the art whose methylation profile is associated with lung cancer. The combination of teachings would have yielded a predictable outcome because a methylation profile that is observed and utilized for the derivation of a score (or value) that correlates to cancer disposition of a subject would have been applicable for any loci whose methylation has been known to be associated with cancers. In KSR, the Supreme Court particularly emphasized “the need for caution in granting a patent based on the combination of elements found in the prior art,” Id. at 415, 82 USPQ2d at 1395, and discussed circumstances in which a patent might be determined to be obvious. Importantly, the Supreme Court reaffirmed principles based on its precedent that “[t]he combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” Id. at 415-16, 82 USPQ2d at 1395. The Supreme Court stated that there are “[t]hree cases decided after Graham [that] illustrate this doctrine.” Id. at 416, 82 USPQ2d at 1395. (1) “In United States v. Adams, . . . [t]he Court recognized that when a patent claims a structure already known in the prior art that is altered by the mere substitution of one element for another known in the field, the combination must do more than yield a predictable result.” With regard to determining the methylation profiles of a locus/loci based on means known in the art, such as sequencing means that generate sequence reads would have been obvious involving conventional, alternative means of DNA characterization. Therefore, the invention as claimed is deemed prima facie obvious over the cited references. Claims 50 and 56 are rejected under 35 U.S.C. 103 as being unpatentable over Frumkin et al. (WO 2019/142193 A1, published July 2019) in view of Pfeifer et al. (US 2009/0305256 A1, published December 2009) as applied to claims 1, 34, 37-45, 51, and 52 above, and further in view of Chapman et al. (Lung Cancer, December 2016, vol. 102, pages 122-134). The teachings of Frumkin et al. and Pfeifer et al. have already been discussed above. Frumkin et al. and Pfeifer et al. do not explicitly teach combining their determination with additional diagnostic means for confirmation. Consequently, the artisans do not teach determining mutational status of known genes indicative of cancer, such as KRAS, EGFR, ALK (claims 50 and 56). Chapman et al. teach a well-known knowledge of mutations in EGFR, ALK and KRAS associated with lung cancer: “We investigated the importance of key driver mutations and the association of several patient features … and histological tumor type, with the prevalence of lung cancers in never smokers compared to smokers … EGFR mutations … ALK-EML4 rearrangements of NSCLC patients … KRAS mutations …” (page 124, 2nd column, 2nd paragraph) It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Frumkin et al. and Pfeifer et al. with the teachings of Chapman et al., thereby arriving at the invention as claimed for the motivation of providing additional well-known conventional testing to further confirm the diagnosis made by the method of Frumkin et al. and Pfeifer et al. In re Kerkhoven, the court expressed the following: “It is prima facie obvious to combine two compositions each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition to be used for the very same purpose…[T]he idea of combining them flows logically from their having been individually taught in the prior art.” In re Kerkhoven 626 F.2d 846, 850, 205 USPQ 1069, 1072 (CCPA 1980). Analogously, combining multiple tests to verify the diagnosis made from the practice of one assay would have been obvious for the purpose of providing further validation of the diagnosis. The invention as claimed is deemed prima facie obvious therefore. Claims 53 and 55 are rejected under 35 U.S.C. 103 as being unpatentable over Frumkin et al. (WO 2019/142193 A1, published July 2019) in view of Pfeifer et al. (US 2009/0305256 A1, published December 2009) as applied to claims 1, 34, 37-45, 51, and 52 above, and further in view of Ilie et al. (Virchows Arch., 2016, vol. 468, pages 511-525) or Croce et al. (WO 2011/119553 A1, published September 2011). The teachings of Frumkin et al. and Pfeifer et al. have already been discussed above. Frumkin et al. and Pfeifer et al. do not explicitly teach combining their determination with additional diagnostic means for the purpose of determining treatment regimen. Consequently, the artisans do not teach determining PD-L1 status (claim 53) or MMR status (claim 55) and administering therapy based on the determination. Ilie et al. teach a well-known means of assessing PD-L1 status in patients suffering lung cancer for therapy determination: “monoclonal antibodies blocking the checkpoints programmed cell death (PD-1) receptor and its major binding ligand (PD-L1) have shown great promise in treating many diverse cancer types, with durable responses in some patients with advanced disease, including NSCLC” (page 512, 1st column) “some PD-L1-positive tumours have demonstrated higher response rates suggesting that identifying patients with PD-L1 expression may enrich responder populations to these agents” (page 512, 1st column) “About 22% of the NSCLC tumours tested expressed PD-L1 in at least 50% of tumour cells and these had a response rate of 41% … study data showed a clear link between PD-L1 expression and the efficacy of pembrolizumab for patients with NSCLC …” (page 513, 1st column) Croce et al. teach a well-known means of assessing MMR and MSI status for determining response of patients with lung cancer: “Mismatched nucleotides may arise from polymerase mis-incorporation errors, recombination between heteroallelic parental chromosomes, or chemical and physical damage of the DNA” (section [0005]) “Inactivation of mismatch repair (MMR) is the cause of the common cancer predisposition” (section [0010]) “treat MMR dysfunction in patient in need of such treatment … MMR dysfunction is selected from … non small cell lung carcinoma …” (section [0019]) It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Frumkin et al. and Pfeifer et al. with the teachings of Ilie et al. or Croce et al., thereby arriving at the invention as claimed for the motivation of providing additional well-known conventional testing to confer a treatment regimen that would be effective for the diagnosed condition. As discussed above, assaying PD-L1 or MMR status when considering treatment had been known, therefore, one of ordinary skill in the art, upon diagnosis of lung cancer, would have been naturally led to further incorporate assays that are considered when deciding a treatment, such as the ones disclosed by Ilie et al. or Croce et al. The invention as claimed is deemed prima facie obvious therefore. Conclusion No claims are allowed. Inquiries Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Young J. Kim whose telephone number is (571) 272-0785. The Examiner can best be reached from 7:30 a.m. to 4:00 p.m (M-F). The Examiner can also be reached via e-mail to Young.Kim@uspto.gov. However, the office cannot guarantee security through the e-mail system nor should official papers be transmitted through this route. If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Gary Benzion, can be reached at (571) 272-0782. Papers related to this application may be submitted to Art Unit 1681 by facsimile transmission. The faxing of such papers must conform with the notice published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 CFR 1.6(d)). NOTE: If applicant does submit a paper by FAX, the original copy should be retained by applicant or applicant’s representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED, so as to avoid the processing of duplicate papers in the Office. All official documents must be sent to the Official Tech Center Fax number: (571) 273-8300. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (571) 272-1600. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /YOUNG J KIM/Primary Examiner Art Unit 1637 March 6, 2026 /YJK/
Read full office action

Prosecution Timeline

Jul 18, 2023
Application Filed
Mar 06, 2026
Non-Final Rejection — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12590329
Novel Replicase Cycling Reaction (RCR)
2y 5m to grant Granted Mar 31, 2026
Patent 12590330
METHODS FOR INDEXING SAMPLES AND SEQUENCING MULTIPLE POLYNUCLEOTIDE TEMPLATES
2y 5m to grant Granted Mar 31, 2026
Patent 12577627
SELECTIVE DETECTION OF DIFFERENT DENGUE VIRUS RNA SEROTYPES USING TANDEM TOEHOLD-MEDIATED DISPLACEMENT REACTIONS
2y 5m to grant Granted Mar 17, 2026
Patent 12571059
COMPOSITIONS AND METHODS FOR DETECTION OF EPSTEIN BARR VIRUS (EBV)
2y 5m to grant Granted Mar 10, 2026
Patent 12560604
BACTERIAL BIOSENSOR SYSTEM
2y 5m to grant Granted Feb 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
65%
Grant Probability
82%
With Interview (+17.7%)
3y 4m
Median Time to Grant
Low
PTA Risk
Based on 1098 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month