DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received Jul 25, 2023. Claims 1-15 are currently pending and examined herein.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Claims 1-15 are granted priority to the International Patent Application PCT/JP2022/002705 filed on Jan 25, 2022.
Claim Objections
Claims 12 and 14 are objected to because of the following informalities:
Claims 12 and 14 recite “wherein all nucleotides including” thymine, cytosine and thymine, respectively. The recitation of “all nucleotides” already includes thymine and cytosine, therefore, the recitation specific nucleotides is redundant and is recommended to be removed.
Claim 12 also recites “wherein all nucleotides…. are nucleotide analogs modified by bridging between the 2’-position and the 4’-position of ribose” in lines 1-4, and further recites “nucleotides comprising the 5th, 10th, 15th, and 20th adenines...” in line 5. The recitation of “all nucleotides” already includes adenines at recited specific positions. Therefore, the recitation of position-specific adenines is redundant and is recommended to be removed.
Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claim 1 is rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., law of nature, natural phenomenon, or product of nature) without significantly more. The inventor discloses and claims naturally occurring sequences. The judicial exception is not integrated into a practical application and the claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception.
Regarding claim 1, see the subject matter eligibility test below:
Step 1: Are the claims directed to a process, machine, manufacture, or composition of matter?
Claims 1-15 recite "a preventive or therapeutic agent…comprising an antisense oligonucleotide…”. Thus, the claimed invention is directed to a process, machine, manufacturer or composition of matter.
Step 2A, Prong 1: Do the claims recite an abstract idea, law of nature, or natural phenomenon?
Claim 1 recites an antisense oligonucleotide comprising at least one of the base sequences of SEQ ID NOs: 1 to 4. NC_000008.11 (Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly, from base 118131825 to 139313970, NCBI Reference Sequence, Constructed Sequence Date: Nov 22, 2020) BLAST alignments show all four sequences are complementary to SAMD12 gene and nearby regions comprising repetitive repeats, as further supported by the specification teaching the specific target sites of SEQ ID NOs: 1 to 4 in relative to SAMD12 gene (Table 3, FIG. 1).
Markedly Different Characteristics Analysis (MPEP 2106.04(c).ll.)
MPEP 2106.04(c) states "when the nature-based product is derived from a naturally occurring thing, then the naturally occurring thing is the counterpart", which is the natural DNA sequence of SAMD12 gene and nearby regions in chromosome 8.
The identified appropriate characteristic for analysis is “the ability of complementary nucleotide sequences to bind to each other".
The instantly recited antisense oligonucleotides lacks markedly different characteristics because “a characteristic must be changed as compared to nature, and cannot be an inherent or innate characteristic of the naturally occurring counterpart or an incidental change in a characteristic of the naturally occurring counterpart. Myriad, 569 U.S. at 580, 106 USPQ2d at 1974-75.”. In other words, the chemical bonds at each end of the claimed nucleic acid were severed in order to isolate it from the chromosome on which it occurs in nature, but it has the same nucleotide sequence as the natural gene. “Isolated but otherwise unchanged genes were not eligible, because they were not different enough from what exists in nature to avoid improperly tying up the future use". Further, a fragment of a natural sequence also lacks markedly different characteristics: "The court disagreed, concluding that the primers' structural characteristics were not markedly different than the corresponding strands of DNA in nature, because the primers and their counterparts had the same genetic structure and nucleotide sequence. The patentee also argued that the primers had a different function than when they are part of the DNA strand because when isolated as a primer, a primer can be used as a starting material for a DNA polymerization process. The court disagreed, because this ability to serve as a starting material is innate to DNA itself, and was not created or altered by the patentee" (University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 113 USPQ2d 1241 (Fed. Cir. 2014).
Thus, claim 1 refers to a judicial exception because SEQ ID NOs: 1 to 4 are products of nature that lack any markedly different structural or functional characteristics as compared to its closest naturally occurring counterpart. In the screenshots below, the top strand is 5’ to 3’ from right to left.
SEQ ID NO: 1: TGAAATGAAATGAAATGAAA
PNG
media_image1.png
182
412
media_image1.png
Greyscale
SEQ ID NO: 2: TGAAATGAAATAAAATAAAA
PNG
media_image2.png
217
479
media_image2.png
Greyscale
SEQ ID NO: 3: GTAGTTGACACTTAGTAGGT
PNG
media_image3.png
145
674
media_image3.png
Greyscale
SEQ ID NO: 4: AGGATAAGGATAGAAGGCTT
PNG
media_image4.png
143
726
media_image4.png
Greyscale
Step 2A, Prong 2: Do the claims recite additional elements that integrate the judicial exception into a practical application?
Claim 1 does NOT recite any additional elements, and therefore, it does not include recite additional elements that integrate the judicial exception into a practical application.
Step 2B: Do the claims recite additional elements that amount to significantly more than the judicial exception?
Claim 1 does NOT recite any additional elements, and therefore, it does not include additional elements that are sufficient to amount to significantly more than the judicial exception.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 12-15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 12 recites “wherein all nucleotides…. are nucleotide analogs modified by bridging between the 2’-position and the 4’-position of ribose” in lines 1-4, and further recites “other nucleotides are all nucleotide analogs in which the 2’-position of ribose is modified” in lines 8-9. It is unclear how “the 2’-position of ribose is modified” relates to “modified by bridging between the 2’-position and the 4’-position of ribose.
Claim 14 recites “wherein all nucleotides… modified by bridging between the 2’-position and the 4’-position of ribose” in lines 1-3, and further recites “all other nucleotides are nucleotide analogs in which the 2’-position of ribose is modified” in line 4. It is unclear how “the 2’-position of ribose is modified” relates to “modified by bridging between the 2’-position and the 4’-position of ribose.
Those claims included in the statement of rejection but not otherwise discussed are rejected for depending from a rejected claim but failing to remedy the indefiniteness therein.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
In making a determination of whether the application complies with the written description requirement of 35 U.S.C. 112, first paragraph, it is necessary to understand what Applicant has possession of and what Applicant is claiming. Claim 1 is drawn to possession of a preventive or therapeutic agent for benign adult familial myoclonus epilepsy (BAFME), comprising an antisense oligonucleotide (ASO) comprising at least one of the bases sequences of SEQ ID NOs: 1 to 4. The breadth of the claim is drawn to possession antisense oligonucleotides that comprise at least one of the full lengths of SEQ ID NOs: 1 to 4, with or without additional nucleotides at either or both ends, as well as with or without chemical modifications. Thus, the claims encompass a genus of antisense oligonucleotides (ASOs) that (1) is therapeutically effective for BAFME and (2) comprises one of the base sequences of SEQ ID NOs: 1 to 4.
The specification discloses species of ASOs: i) fully modified mixmers in which all nucleotides are substituted with 2’-O-methyl (2’-OME) and every third nucleotide is further substituted with β-D-ENA, and ii) gapmers comprising β-D-ENA-modified nucleotides at both ends (wings) with a central DNA gap comprising unsubstituted nucleotides. All species disclosed comprised of phosphorothioate moieties substituting phosphodiester moieties of internucleoside linkage. The specification further discloses a recognized correlation between structure and function, in which ASOs comprising SEQ ID NO: 1 to 4 and chemical modifications reduced number of RNA aggregates that are considered to cause onset of BAFME in undifferentiated iPS cells derived from BAFME patients (Example 1, FIG 2A and 2B). The specification failed to disclose actual reduction to practice of any species that lacks chemical modifications while retaining the recognized correlation and functioning as a preventive or therapeutic agent. In fact, the specification teaches “gapmer ASO in which a gap region consisting of not more than 4 consecutive RNase H active type nucleotides is sandwiched between wing regions of RNAse H inactive type nucleotides” ([0084]), and “the base sequences of SEQ ID NOs: 1 to 4 all have 20 full-length nucleotides, in this embodiment, the number of nucleotides in the wing region….is 5 for each.” ([0087]). Therefore, the specification suggests chemical modifications are critical in ASO to function as claimed, and in view of the wide variant species encompassed by the genus, the limited species described in Table 3 is not enough and does not constitute a representative number of species to describe the whole genus.
The state of the art recognizes that incorporation of chemical modifications in ASOs is critical for increasing resistance to degradation by nucleases and reducing pro-inflammatory effects. Crooke et al (Antisense technology: an overview and prospectus; Nature Reviews Drug Discovery, 2021, 20:427-453) teaches “unmodified PS ASOs have since been largely abandoned because of their limited potency and their pro-inflammatory effects following systemic administration.” (pg. 432, right-column, fourth paragraph) because “the phosphodiester backbone of unmodified DNA and RNA oligonucleotides is highly susceptible to degradation by nucleases in vivo.” (pg. 430, right-column) and phosphorothioate (PS) linkages alone in ASO is not sufficient. Crooke supports the teachings of the specification in which PS ASOs “typically have a central region of eight to ten deoxynucleotides flanked by several 2’-modified nucleotides” (FIG. 2c) (pg. 433, left-column, fifth paragraph). Therefore, the state of the art recognizes ASOs without any chemical modifications are not therapeutic, and this is evidence that an embodiment within the scope of the claim failed to function as required by the claim.
Dependent claim 2 further recites “the antisense oligonucleotide comprises at least one RNase H inactive type nucleotide analog”. Under the broadest reasonable interpretation, claim 2 encompasses a genus of ASO comprising one or more RNase H inactive type nucleotide analog, with species including only one to 20 nucleotide analogs. The specification and state of art teach several, at least five, modified nucleotides at each wing region are required (see discussion above). Similarly, claim 7 recites “wherein all adjacent nucleotides...of the antisense oligonucleotides are linked by a modified internucleoside bond”, which structure aligns with PS ASO described by Crooke wherein the phosphodiester backbone of all nucleotides is modified to phosphorothioate. However, Crooke teaches PS modifications alone in ASO is not sufficient to achieve desired therapeutic activity (see discussion above), and the specification does not disclose actual reduction to practice of any species with modified internucleoside bone alone.
Additional dependent claims 3-6, and 8 recite specific chemical modifications but the species within the recited genus in claims 1 and 2 remains the same. Further, dependent claim 9 recites “wherein the antisense oligonucleotide is RNase H active type”, referred by the specification “when a hetero double strand is formed with the target RNA, the target RNA is cleaved by RNase H activity between nucleosides and the target RNA is degraded” ([0083]). Under the broadest reasonable interpretation, claim 9 encompasses a genus with species i) lacking any chemical modifications, ii) gapmers, and iii) ASOs with phosphorothioate modifications only. See discussion above regarding lack of representative species within claimed genus and teachings of the state of art.
Based on the preponderance of the evidence, including the relevant teachings of the specification, the absence of working examples, and the state of prior art including the knowledge of correlation of chemical modifications to ASOs activity, one skilled in the art would conclude that Applicant was NOT in possession of the claimed genus of i) therapeutic ASOs comprising the base sequences SEQ ID NOs: 1 to 4, with or without chemical modification, and ii) therapeutic ASOs comprising the base sequences SEQ ID NOs: 1 to 4 with at least one RNase H inactive type nucleotide analog.
On the contrary, claims 10 is drawn to possession of limited number of species of gapmer ASOs consisting of SEQ ID NOs: 1 to 4 with 5 modified nucleotides at each “wing” region. Similarly, claim 11 recites “wherein the antisense oligonucleotide…consisting of…SEQ ID NOs: 1 to 3 is RNase H inactive type”, referred by the specification “when a hetero double strand is formed with the target RNA, internucleoside linkages of the target RNA are not cleaved by RNAse H activity and the target RNA is not degraded. Therefore, claim 11 and dependent claims 12-15 are drawn to possession of limited number of species of “mixmer” ASOs wherein all nucleotides modified. Based on the preponderance of the evidence, including the relevant teachings of the specification, and the state of prior art including the knowledge of correlation of chemical modifications to ASOs activity, one skilled in the art would conclude that Applicant was in possession of the species recited in claims 10-15.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-4 are rejected under 35 U.S.C. 103 as being unpatentable over van Blitterswijk et al (Repeat expansions in myoclonic epilepsy; Nature Genetics, 2018, 50:477-482) and Riboldi et al (Antisense Oligonucleotide Therapy for the Treatment of C9ORF72 ALS/FTD Diseases; Mol Neurobiol, 2014, 50:721-732), in view of NC_000008.11 (Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly, from base 118131825 to 139313970, NCBI Reference Sequence, Constructed Sequence Date: Nov 22, 2020).
Regarding claim 1, van Blitterswijk teaches that abnormal TTTCA- and TTTA- repeat expansions consisting of between 440 and 3,680 repeat units occur in intron 4 of SAMD12 gene located on chromosome 8q24 in individuals with benign adult familial myoclonic epilepsy (BAFME) (pg. 477, left column). van Blitterswijk further teaches that similar repeat expansions are also found in TNRC6A and RAPGEF2 genes in BAFME (Fig. 1). van Blitterswijk explains that these repeat expansions likely act through a gain-of-function mechanism, resulting in the formation of RNA foci (repeat-containing RNA structures that aggregate in the nucleus) that trap numerous proteins that are unable to function properly (pg. 478, left-column). van Blitterswijk further teaches that “this finding creates possibilities toward targeted therapies (for example, through use of antisense oligonucleotides) (pg. 478, right-column).
However, van Blitterswijk does not teach designing antisense oligonucleotides (ASOs).
Riboldi teaches the use of ASOs to target a hexanucleotide repeat expansions in intron 1 of the C9ORF72 gene, which is the most common genetic cause of both familial and sporadic amyotrophic lateral sclerosis and frontotemporal dementia (pg. 725, right column, second paragraph). In particular, Riboldi discloses ASOs are designed to target GGGGCC repeat sequence, intronic region downstream of the repeat sequence or exon 2, region in intron 1 adjacent to the repeat sequence, upstream of exon 2, and downstream exons, and these ASOs successfully reduced RNA foci (Table 1 and Fig. 1) which also contributes to the cause of BAFME. Riboldi also teaches antisense modification patterns that enhance stability and activity suitable for therapeutic ASOs (Table 1; pg. 725, right-column; pg. 726, left-column).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have developed ASOs targeting repeat expansions associated with BAFME as suggested by van Blitterswijk, while following the teachings of Riboldi regarding the design of ASOs that also target repeat expansions associated with neurological diseases. Riboldi provides guidance on developing ASO that target repeat sequences and regions flanking repeat expansions, as well as suitable chemical modification patterns for therapeutic activity. One would have been motivated to have done so for the advantage of decreasing RNA foci aggregates in the nucleus of cells affected by BAFME as suggested by van Blitterswijk. One would have had a reasonable expectation of success in doing so because Riboldi teaches ASO development for repeat expansions of neurological diseases.
However, neither Riboldi van Blitterswijk teach the instantly recited SEQ ID NOs: 1 to 4.
NC_000008.11 teaches SEQ ID NOs: 1 to 4 are complementary to genome sequence of SAMD12 gene in the following manner: SEQ ID NO: 1 is complementary to adjacent of AAAAT repeat sequence or TTTTA- repeat expansion as taught by van Blitterswijk (pg. 477, left-column), SEQ ID NO: 2 is complementary to adjacent of AAAGT repeat sequence or TTTCA repeat expansions as taught by van Blitterswijk, SEQ ID NOs: 3 and 4 are complementary to intron 4 of SAMD12 gene, where abnormal TTTCA- and TTTTA- repeat expansions occur as taught by van Blitterswijk. Alignments of SEQ ID NOs: 1 to 4 to SAMD12 gene and nearby regions comprising repetitive repeats are illustrated above in 35 U.S.C. 101. NC_000008.11also teaches the intronic and exonic sequences of SAMD12 gene and surrounding regions containing the repeat expansions are known in the art.
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have modified Riboldi’s ASOs to instantly recited SEQ ID NOs: 1 to 4 because it would have merely amounted to choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success (“obvious to try”). One would have been motivated to have done so because the target sequence SAMD12, repeat expansion location and sequences, and surrounding sequences were known, and developing ASOs for repeat expansions would have been routine and predictable given that Riboldi teaches targeting various regions including the repeat sequence, upstream, downstream, and adjacent of the repeat sequence. One would have had a reasonable expectation of success in doing so because Riboldi teaches ASO development to target repeat expansions and ASO design is constrained to a finite number of predictable target regions within a known transcript given that ASO design is not open-ended. Therefore, only a finite number of effective ASOs can be designed, and the instantly recited sequences represent one of a limited number of predictable ASO candidates that would have been obtained through routine optimization.
Regarding claims 2-4, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk and NC_000008.11 is discussed above as applied to claim 1. Riboldi further teaches the ASO comprises at least one 2’-O-methyl (2’-OME) or MOE chemical modification (i.e.,RNAse H inactive type nucleotide analog, 2’-position of ribose is modified, 2’-OMe-nucleotide analog, MOE-nucleotide analog) (Table 1).
Claims 5-8, 11-15 are rejected under 35 U.S.C. 103 as being unpatentable over Riboldi et al (Antisense Oligonucleotide Therapy for the Treatment of C9ORF72 ALS/FTD Diseases; Mol Neurobiol, 2014, 50:721-732), van Blitterswijk et al (Repeat expansions in myoclonic epilepsy; Nature Genetics, 2018, 50:477-482), and NC_000008.11 (Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly, from base 118131825 to 118621963, NCBI Reference Sequence, Constructed Sequence Date: Nov 22, 2020) as applied to claims 1-4 above, and further in view of Christou et al (Systemic Evaluation of Chimeric LNA/2’-O-Methyl Steric Blockers for Myotonic Dystrophy Type 1 Therapy; Nucleic Acid Therapeutics, 2020, 30(2):80-93).
Regarding claim 5, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk and NC_000008.11 is discussed above as applied to claim 3. Riboldi teaches wherein the RNAse H inactive type nucleotide analog is one in which a 2’-position of ribose is modified (e.g., 2’-OME) (Table 1).
However, Riboldi does not teach wherein the nucleotide analog is modified by bridging between 2’-position and 4’-position of ribose and that this nucleotide analog is selected form a group consisting of β-D-oxy-LNA, β-D-ENA, and R type cEt.
Christou teaches chimeric LNA/2’OMe ASOs to target repeat expansion of DMPK gene for myotonic dystrophy type I (Abstract), which exhibits superior potency compared with their locked-nucleic-acid (LNA) (i.e., β-D-oxy-LNA) or 2’OMe counterparts (pg. 82, left-column, first paragraph).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have modified Riboldi’s ASOs to comprise LNA nucleotide analogs because it would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to have done so for the advantage of increasing ASO potency. One would have had a reasonable expectation of success in doing so because Riboldi and Christou both teach ASOs with chemical modification patterns and target sequences to repeat expansions in neurological diseases.
Regarding claims 6-8, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk and NC_000008.11 is discussed above as applied to claim 1.
However, Riboldi does not teaches wherein at least adjacent nucleotides are linked by a modified internucleoside bond, and particularly selected from a group consisting of a phosphothioate bond, a phosphodithioate bond, and a boranophosphate bond.
Christou teaches phosphothiate (PS) modifications are incorporated in backbone of all ASOs (Table 1), which “substitutes sulfur for a nonbridging oxygen in the phosphate backbone and confers significant resistance to nuclease degradation (pg. 81, left-column, second paragraph).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have modified Riboldi’s ASOs to comprise PS backbone because it would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results. One would have been motivated to have done so for the advantage of increasing ASO stability. One would have had a reasonable expectation of success in doing so because Riboldi and Christou both teach ASOs with chemical modification patterns and target sequences to repeat expansions in neurological diseases.
Regarding claim 11, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk and NC_000008.11 is discussed above as applied to claim 1. The broadest reasonable interpretation of the instant claim is an ASO consisting of a base sequence of SEQ ID NOs: 1 to 3 wherein all nucleotides are RNAse H inactive type, in other words, all nucleotides are incorporated with chemical modifications.
However, Riboldi does not teach ASOs wherein all nucleotides are RNase H inactive type.
Christou teaches chimeric LNA/2’OMe ASOs wherein chemical modifications are incorporated into all nucleotides (Table 1).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have modified Riboldi’s ASO to comprise chemical modifications in all nucleotides because it would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to have done so for the advantage of increasing ASO stability, binding affinity and resistance to endonuclease degradation. One would have had a reasonable expectation of success in doing so because Riboldi already teach ASOs wherein some nucleotides are chemically modified and Christou teach ASOs wherein all nucleotides are chemically modified.
Regarding claims 12-15, the obviousness to modify Riboldi’s ASO wherein all nucleotides are chemically modified is discussed above as applied to claim 11. Christou further teaches all ASOs are modified by bridging between 2’-position and 4’-position of ribose (e.g., LNA) and by modifying 2’-position of ribose (e.g., 2’-OMe) (Table 1).
However, Christou does not teach nucleotides comprising 5th, 10th, 15th, and 20th adenines from 5’-terminal are nucleotide analogs modified by bridging between 2’-position and 4’-position of ribose, and wherein the nucleotide analog is β-D-ENA because the base sequence of Christou ASO does not comprise of adenines at the recited positions.
Christou does teach wherein all adenine nucleotide is modified by LNA (e.g., ASO LNAa/2’OMe18h and LNAa/2’OMe11) (Table 1). Christou further teaches “the combination of 2’OMe monomers with a limited number of LNA nucleotides (one at every third position) aims at minimizing potential toxicity, while retaining a high binding affinity” (pg. 82, left-column, first paragraph). Although the instant claims recite 5th, 10th, 15th, and 20th adenines from 5’-terminal are modified, the specification teaches these modifications occur at every third position (Table 3, ASO 3009-2M, 3009-3M, and SAMD12-M4), supporting Christou’s teachings.
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have modified Riboldi’s ASO to comprise specific chemical modifications in the recited positions because it would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to have done so for the advantage of increasing ASO stability, binding affinity and resistance to endonuclease degradation as taught by Christou. One would have had a reasonable expectation of success in doing so because Riboldi already teach ASOs wherein some nucleotides are chemically modified and Christou teach ASOs with specific modification patterns.
Claims 9 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Riboldi et al (Antisense Oligonucleotide Therapy for the Treatment of C9ORF72 ALS/FTD Diseases; Mol Neurobiol, 2014, 50:721-732), van Blitterswijk et al (Repeat expansions in myoclonic epilepsy; Nature Genetics, 2018, 50:477-482), and NC_000008.11 (Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly, from base 118131825 to 139313970, NCBI Reference Sequence, Constructed Sequence Date: Nov 22, 2020) as applied to claims 1 above, and further in view of Grunweller et al (Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2’-O-methyl RNA, phosphorothioates and small interfering RNA; NAR, 2003, 31(12): 3185-3193).
Regarding claims 9-10, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk and NC_000008.11 is discussed above as applied to claim 1. Riboldi teaches ASOs with MOE modification in Gapmer design, which comprises 3-5 modified nucleotides on both 5’- and 3’- ends (wings) of the ASO of 20 nucleotides long as recited in the instant claims.
However, Riboldi does not teach exactly both ends of the ASO comprises 5 modified nucleotides with a central gap comprising nucleotides 6th to 15th.
Grunweller teaches ASO gapmers wherein five nucleotides of each 5’- and 3’-end comprise of LNA modifications leaving a central gap with unmodified nucleotides (i.e., RNAse H active type). Grunweller emphasized “gapmer with five LNA monomers at either end being superior to the gapmer with only 4 nt end blocks” (pg/ 3191, left-column, second paragraph).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have modified Riboldi’s ASO to comprise five modified nucleotides at either ends of gapmer ASO because it would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results. One would have been motivated to have done so for the advantage of increasing ASO affinity and thermal stability. One would have had a reasonable expectation of success in doing so because Riboldi already teaches ASO gapmers with chemical modification patterns at both terminals.
Subject Matter Eligibility
Claims 2-15 pass the subject matter eligibility test because oligonucleotide modifications are interpreted as imparting markedly different structural or functional characteristics as compared to its closest naturally occurring expression system. Therefore, these claims are NOT directed to judicial invention.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to QIWEN SU-TOBON whose telephone number is (571)272-0331. The examiner can normally be reached Monday - Friday, 9:30am - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammel can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
QIWEN SU-TOBON
Examiner
Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636