DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received June 16, 2026. Claims 2-3, 10, 12, and 14-15 cancelled. Claims 1, 4-9, 11, and 13 are currently pending and examined herein.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Claims 1, 4-9, 11, and 13 are granted priority to the International Patent Application PCT/JP2022/002705 filed on Jan 25, 2022.
Withdrawn Claim Rejections - 35 USC § 101
Claim 1 pass the subject matter eligibility test in view of the amendments because oligonucleotide modifications are interpreted as imparting markedly different structural or functional characteristics as compared to its closest naturally occurring expression system. Claim 1 is NOT directed to judicial invention and the previous 35 USC 101 rejection has been withdrawn.
Withdrawn Claim Rejections - 35 USC § 112
Previous Office Action mailed 03/17/2026 stated that Applicant was in possession of limited number of species of gapmer ASOs consisting of SEQ ID NOs: 1 to 4 with 5 modified nucleotides at each “wing” region. This limitation, previously recited in claim 10, has been incorporated into instant claim 1. Further, previous claim 11 and dependent claims 12-15 were drawn to possession of limited number of species of “mixmer” ASOs wherein all nucleotides modified. These limitations have also been incorporated into instant claim 1. Thus, in view of the amendments to claim 1, the previous 35 USC 112(a) has been withdrawn.
Claim Interpretation
Claim 1 recites “(3) other nucleotides in any of SEQ ID NOs: 1 to 3 are nucleotide analogs in which the 2’-position of ribose is modified”. In view of limitations (1) and (2) recited in the same claim, the “other nucleotides” in limitation (3) is interpreted as (i) any nucleotide other than thymine and cytosine in SEQ ID NO: 3, or (ii) any nucleotide other than thymine and the 5th, 10th, 15th, and 20th adenine from the 5’ terminal in SEQ ID NOs: 1 and 2.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1 and 9 are rejected under 35 U.S.C. 103 as being unpatentable over van Blitterswijk et al (Nature Genetics, 2018, 50:477-482) Riboldi et al (Mol Neurobiol, 2014, 50:721-732) and Grunweller et al (NAR, 2003, 31(12): 3185-3193), in view of NC_000008.11 (Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly, from base 118131825 to 139313970, NCBI Reference Sequence, Constructed Sequence Date: Nov 22, 2020).
Regarding claim 1, van Blitterswijk teaches that abnormal TTTCA- and TTTA- repeat expansions consisting of between 440 and 3,680 repeat units occur in intron 4 of SAMD12 gene located on chromosome 8q24 in individuals with benign adult familial myoclonic epilepsy (BAFME) (pg. 477, left column). van Blitterswijk further teaches that similar repeat expansions are also found in TNRC6A and RAPGEF2 genes in BAFME (Fig. 1). van Blitterswijk explains that these repeat expansions likely act through a gain-of-function mechanism, resulting in the formation of RNA foci (repeat-containing RNA structures that aggregate in the nucleus) that trap numerous proteins that are unable to function properly (pg. 478, left-column). van Blitterswijk further teaches that “this finding creates possibilities toward targeted therapies (for example, through use of antisense oligonucleotides) (pg. 478, right-column).
However, van Blitterswijk does not teach designing antisense oligonucleotides (ASOs).
Riboldi teaches the use of ASOs to target a hexanucleotide repeat expansions in intron 1 of the C9ORF72 gene, which is the most common genetic cause of both familial and sporadic amyotrophic lateral sclerosis and frontotemporal dementia (pg. 725, right column, second paragraph). In particular, Riboldi discloses ASOs are designed to target GGGGCC repeat sequence, intronic region downstream of the repeat sequence or exon 2, region in intron 1 adjacent to the repeat sequence, upstream of exon 2, and downstream exons, and these ASOs successfully reduced RNA foci (Table 1 and Fig. 1) which also contributes to the cause of BAFME. Riboldi also teaches antisense modification patterns that enhance stability and activity suitable for therapeutic ASOs (Table 1; pg. 725, right-column; pg. 726, left-column), particularly ASOs gapmers that contain modified nucleic acid residues to induce RNase H-mediated degradation (pg. 725, right-column, last paragraph).
However, Riboldi does not specify the modification pattern of ASO gapmers.
Grunweller teaches ASO gapmers wherein five nucleotides of each 5’- and 3’-end comprise of LNA modifications leaving a central gap with unmodified nucleotides (i.e., RNAse H active type). Grunweller emphasized “gapmer with five LNA monomers at either end being superior to the gapmer with only 4 nt end blocks” (pg/ 3191, left-column, second paragraph).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have developed ASOs targeting repeat expansions associated with BAFME as suggested by van Blitterswijk, while following the teachings of Riboldi regarding the design of ASOs, particularly gapmers, that also target repeat expansions associated with neurological diseases in combination with teachings of Grunweller to arrive at ASO gapmers comprising instantly recited limitation (a). Riboldi provides guidance on developing ASO that target repeat sequences and regions flanking repeat expansions, as well as suitable chemical modification patterns for therapeutic activity. Grunwell provides guidance on a specific modification pattern of ASO for superior activity. Thus, one seeking to inhibit repeat expansions would have been motivated to prepare ASOs using known modification architecture of Riboldi and Grunweller and assess ASO activities through routine screening strategies. One would have been motivated to have done so for the advantage of decreasing RNA foci aggregates in the nucleus of cells affected by BAFME as suggested by van Blitterswijk. One would have had a reasonable expectation of success in doing so because Riboldi teaches ASO development for repeat expansions of neurological diseases, particularly one type of ASO known as gapmer, and Grunweller teaches specific positions that are modified in ASO gapmers. Further, one would have had a reasonable expectation that at least some ASOs comprising the known modification architecture would retain biological activity because the purpose of the modifications is to improve properties including nuclease resistance and binding affinity, rather than to change target specificity of the ASO.
However, neither Riboldi or van Blitterswijk teach the instantly recited SEQ ID NOs: 1 to 4.
NC_000008.11 teaches SEQ ID NOs: 1 to 4 are complementary to genome sequence of SAMD12 gene in the following manner: SEQ ID NO: 1 is complementary to adjacent of AAAAT repeat sequence or TTTTA- repeat expansion as taught by van Blitterswijk (pg. 477, left-column), SEQ ID NO: 2 is complementary to adjacent of AAAGT repeat sequence or TTTCA repeat expansions as taught by van Blitterswijk, SEQ ID NOs: 3 and 4 are complementary to intron 4 of SAMD12 gene, where abnormal TTTCA- and TTTTA- repeat expansions occur as taught by van Blitterswijk. Sequence alignments are illustrated below. NC_000008.11also teaches the intronic and exonic sequences of SAMD12 gene and surrounding regions containing the repeat expansions are known in the art.
SEQ ID NO: 1: TGAAATGAAATGAAATGAAA
PNG
media_image1.png
182
412
media_image1.png
Greyscale
SEQ ID NO: 2: TGAAATGAAATAAAATAAAA
PNG
media_image2.png
217
479
media_image2.png
Greyscale
SEQ ID NO: 3: GTAGTTGACACTTAGTAGGT
PNG
media_image3.png
145
674
media_image3.png
Greyscale
SEQ ID NO: 4: AGGATAAGGATAGAAGGCTT
PNG
media_image4.png
143
726
media_image4.png
Greyscale
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have modified Riboldi’s ASOs to instantly recited SEQ ID NOs: 1 to 4 because it would have merely amounted to choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success (“obvious to try”). One would have been motivated to have done so because the target sequence SAMD12, repeat expansion location and sequences, and surrounding sequences were known, and developing ASOs for repeat expansions would have been routine and predictable given that Riboldi teaches targeting various regions including the repeat sequence, upstream, downstream, and adjacent of the repeat sequence. One would have had a reasonable expectation of success in doing so because Riboldi teaches ASO development to target repeat expansions and ASO design is constrained to a finite number of predictable target regions within a known transcript given that ASO design is not open-ended. Therefore, only a finite number of effective ASOs can be designed, and the instantly recited sequences represent one of a limited number of predictable ASO candidates that would have been obtained through routine optimization.
Regarding claim 9, the obviousness to develop ASO for BAFME in view of teachings of van Blitterswijk, Riboldi, Grunweller and NC_000008.11 is discussed above as applied to claim 1.
Claims 1, 4-8, 11, and 13 are rejected under 35 U.S.C. 103 as being unpatentable over van Blitterswijk et al (Nature Genetics, 2018, 50:477-482) Riboldi et al (Mol Neurobiol, 2014, 50:721-732) and NC_000008.11 (cited supra), in view of Sobue (US 2021/0230598 A1; Pub Date: 29 Jul 2021).
Regarding claim 1, the obviousness to develop ASOs for BAFME in view of teachings of van Blitterswijk, Riboldi, and NC_000008.11 is discussed above as applied to claim 1.
However, the prior art does not teach recited limitations (1) to (3).
Sobue teaches ASOs wherein all pyrimidine (cytosine, thymine or uracil) nucleotides contained in the ASO are 2’-O, 4’-C-ethylene-bridged nucleic acids (ENA) while the purine (adenine or guanine) nucleotides are 2’-O-methyl (2’-OMe) modified nucleic acids ([0063]-[0064]). Therefore, Sobue teaches ASOs wherein all thymines and cytosines in the ASO are nucleotide analogs modified by bridging between the 2’-position and the 4’-position of ribose (i.e., instantly recited limitations (1) and (2)), and wherein the other nucleotides are nucleotide analogs in which the 2’-position of ribose is modified (i.e., instantly recited limitation (3)). Sobue further teaches the ENA-modified ASOs have remarkably superior activity than respective MOE modified ASOs having the same nucleotide sequences (FIG. 2; [0018]).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filling date of the invention to have modified Riboldi’s ASOs to comprise the recited modification pattern as taught by Sobue because it would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results. One would have been motivated to have done so for the advantage of obtaining ASOs that exhibit superior potency. Riboldi teaches the importance of screening ASOs comprising diverse modification architectures when targeting repeat expansions (Table 1). Sobue also demonstrates that optimal ASOs can be selected through routine screening assays one possible modification pattern that successfully enhanced ASO activity. Thus, it would have been obvious to prepare ASOs comprising the known target sequence and evaluate the known modification architecture as taught by Sobue to identify an effective configuration. One would have had a reasonable expectation that at least some ASOs comprising the known modification architecture would retain biological activity because the purpose of the modifications is to improve properties including nuclease resistance and binding affinity, rather than to change target specificity of the ASO.
Regarding claim 4, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk, NC_000008.11, and Sobue is discussed above as applied to claim 1. Sobue further teaches wherein the nucleotide analog in which the 2’-position of ribose is modified is 2’-OMe-nucleotide ([0064]).
Regarding claim 5, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk, NC_000008.11, and Sobue is discussed above as applied to claim 1. Sobue further teaches wherein the nucleotide analog modified by bridging between the 2’-position and the 4’-position of ribose is β-D-ENA ([0063]).
Regarding claims 6-8, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk, NC_000008.11, and Sobue is discussed above as applied to claim 1. Sobue further teaches wherein all phosphate groups of the ASO are phosphorothioated, phosphorodithioated or the like ([0068]).
Regarding claim 11, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk, NC_000008.11, and Sobue is discussed above as applied to claim 1. Sobue teaches wherein the ASO is RNase H active type comprising a modification pattern matching with recited limitations (1) to (3) ([0063]-[0064]).
Regarding claim 13, the obviousness to modify Riboldi’s ASO with teachings of van Blitterswijk, NC_000008.11, and Sobue is discussed above as applied to claim 1. Sobue further teaches the recited modified nucleotides as explained in claims 4 and 5, respectively.
Response to Arguments
Applicant argues that “the cited references do not provide a reasonable expectation of success for identifying the specific antisense architecture” (pg. 11, last paragraph).
MPEP 2143.02 teaches that obviousness does not require absolute predictability, but only a reasonable expectation of success is required. As stated in previous (mailed 03/17/2026) Riboldi, Christou, and Grunweller screen multiple architectures for ASOs, particularly Riboldi for ASOs targeting repeat expansions, including but not limited to gapmers, LNA at periodic positions, all cytosines modified as LNAs. In addition, as explained in instant Office Action, Sobue teaches instantly recited architectures. Thus, the prior art provides a finite collection of known ASO architectures for evaluation. One ordinary skill in the art might not know which modification architecture might be optimal, but one would have had a reasonable expectation of success that applying known ASO architectures to known target sequences and screening would identify an active ASO. One would have had a reasonable expectation of success that at least some of the known architectures would yield desirable activity. It is noted that prima facie case of obviousness does not focus on whether one ordinary skill in the art could predict before experimentation which particular architecture would ultimately be the best.
Applicant argues that “changing only the ASO architecture while maintaining the same target sequence can result in a complete reversal of biological activity” on the basis of ASO 3009-1M, ASO 3009-4G, and ASO SAMD12-M1 (pg. 12, para. 2 and 3).
Applicant’s arguments have been fully considered but they are not persuasive because Sobue has demonstrated the ENA-modified ASOs have remarkably superior activity than respective MOE modified ASOs having the same nucleotide sequences (FIG. 2; [0018]). Thus, Applicant’s results would have been expected in view of prior art’s teachings that ASOs having the same target sequence but different modification architecture can exhibit substantially different activities.
Applicant argues that “the claimed antisense oligonucleotides further exhibit unexpected technical effects. In particular ASOs comprising SEQ ID NO: 1” and “ASO 3009-2M” (pg. 12, para. 5; pg. 13, para. 2)
Applicant’s arguments have been fully considered but they are not persuasive because the scope of the claims are not limited to ASOs comprising SEQ ID NO: 1 only. Rather, independent claim encompass ASOs comprising SEQ ID NOs: 1 to 4, each comprising two modification architectures, except SEQ ID NO: 4 that is RNase H active type only. Per MPEP 716.01(d) "the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support". In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980)". Results for ASO comprising SEQ ID NO: 1 does not establish unexpected results for the full scope of ASOs encompassed by the independent claim.
Conclusion
No claims are allowable.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to QIWEN SU-TOBON whose telephone number is (571)272-0331. The examiner can normally be reached Monday - Friday, 9:30am - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/QIWEN SU-TOBON/
Examiner
Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights