DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I, corresponding to claims 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 25, 28, 33, 36, 37, and 96 – 101 in the reply filed on 06/11/2026 is acknowledged. Claims 2, 4, 6, 14, 18, 21, 25, 28, and 36 have been amended. Claims 96 – 101 are new. Claims 1, 46, 48, 76, 86, and 88 are cancelled.
Examiner also acknowledges applicant’s election of species:
Species I: Variable heavy and light regions – SEQ ID NOs: 102 and 103
Species II: Light chain – SEQ ID NO: 111
Species III: Promoter – SEQ ID NO: 35
Species IV: Poly(A) signal – SEQ ID NO: 114
Species V: Light chain ORF – SEQ ID NO: 46
Species VI: Heavy chain ORF – SEQ IN NO: 56
Species VII: Antibody expression cassette – SEQ IN NO: 156
Claims 116, 119, 121, and 122 are withdrawn from further consideration pursuant to 37
CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or
linking claim.
Claims 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 25, 28, 33, 36, 37, and 96 – 101 are under examination.
Priority
This is a National Stage Entry under 35 U.S.C. 371 of International Patent Application
No. PCT/US2022/013935, filed January 26, 2022. This application also claims priority to US
Provisional Application No. 63/141,916, filed on January 26, 2021.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 25, 28, 33, 36, 37, and 96 – 101 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus. See, e.g., Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010); University of California v. Eli Lilly & Co., 119 F.3d 1559, 43 USPQ2d 1398 (Fed. Cir. 1997) at 1406; Juno Therapeutics, Inc. v. Kite Pharma, Inc., 10 F.4th 1330, 1337, 2021 USPQ2d 893 (Fed. Cir. 2021) ("[T]he written description must lead a person of ordinary skill in the art to understand that the inventor possessed the entire scope of the claimed invention. Ariad, 598 F.3d at 1353–54 ('[T]he purpose of the written description requirement is to ensure that the scope of the right to exclude, as set forth in the claims, does not overreach the scope of the inventor's contribution to the field of art as described in the patent specification.' (internal quotation marks omitted).").
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014). The issue is whether the skilled artisan would understand inventor to have invented, and been in possession of, the invention as claimed.
The Federal Circuit has clarified the application of the written description requirement to inventions in the field of biotechnology. See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568,43 USPQ2d l398, 1406 (Fed. Cir. 1997). The Court stated that a written description of an invention requires a precise definition, one that defines the structural features of the chemical genus that distinguishes it from other chemical structures. A definition by function does not suffice to define the genus because it is only an indication of what the genus does, rather than what it is. Further, the Court held that to adequately describe a claimed genus, an applicant must describe a representative number of species of the claimed genus, and that one of skill in the art should be able to “visualize or recognize the identity of the members of the genus.”
I. Lack of written description for antibody or antigen-binding fragments
The claims are broadly drawn to a genus comprising: an antibody or antigen-binding fragments with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 102, 103, 110, 111, 46, 56, or 156, with claims 96, 97, 98, 99, 100, and 101 limiting the sequence identity to 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, 99%, or 100%. There is not sufficient description of the structural features that must be retained to establish a functional relationship with respect to an antibody or antigen-binding fragments that binds to TNFalpha.
The Specification has failed to sufficiently describe the structural features that must be retained by members of the claimed genus as to establish a structure-function relationship with respect to the ability of the antibody or antigen-binding fragments to bind to TNFalpha. The claims define the antibody or antigen-binding fragments based on what it does—not what it is. Additionally, the Specification has failed to sufficiently describe the structural features that must be retained by members of the claimed genus as to establish a structure-function relationship with respect to the ability of the antibody or antigen-binding fragments to bind to TNFalpha. There are no structural limitations assigned to the antibody or antigen-binding fragments and does not establish a structure-function relationship with the ability to bind to an antigen. As such, the claim describes a countless amount of antibodies or antigen binding fragments thereof.
SEQ ID NO: 102 encodes a heavy chain variable region (VH) of an anti-tumor necrosis factor alpha (TNFalpha) antibody or an antigen binding fragment thereof. SEQ ID NO: 102 is 363 nucleic acids in length. A variant sharing 90% identity (the most restrictive scenario) to SEQ ID NO: 102 can have anywhere from 1 to 36 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (436 = 4.7 x 1021) comprising trillions upon trillions of sequences.
SEQ ID NO: 103 encodes a light chain variable region (VL) of an anti-TNFalpha antibody or an antigen binding fragment thereof. SEQ ID NO: 103 is 321 nucleic acids in length. A variant sharing 90% identity (the most restrictive scenario) to SEQ ID NO: 103 can have anywhere from 1 to 32 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (432 = 1.8 x 1019) comprising trillions upon trillions of sequences.
SEQ ID NO: 110 encodes a heavy chain of an anti-TNFalpha antibody. SEQ ID NO: 110 is 1353 nucleic acids in length. A variant sharing 90% identity (the most restrictive scenario) to SEQ ID NO: 110 can have anywhere from 1 to 135 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (4135 = 1.9 x 1081) comprising trillions upon trillions of sequences.
SEQ ID NO: 111 encodes a light chain of an anti-TNFalpha antibody. SEQ ID NO: 111 is 645 nucleic acids in length. A variant sharing 90% identity (the most restrictive scenario) to SEQ ID NO: 111 can have anywhere from 1 to 64 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (464 = 3.4 x 1038) comprising trillions upon trillions of sequences.
SEQ ID NO: 46 encodes an open reading frame related to an anti-TNFalpha antibody. SEQ ID NO: 46 is 705 nucleic acids in length. A variant sharing 90% identity (the most restrictive scenario) to SEQ ID NO: 46 can have anywhere from 1 to 70 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (470 = 1.4 x 1042) comprising trillions upon trillions of sequences.
SEQ ID NO: 56 encodes an open reading frame related to an anti-TNFalpha antibody. SEQ ID NO: 56 is 1407 nucleic acids in length. A variant sharing 90% identity (the most restrictive scenario) to SEQ ID NO: 56 can have anywhere from 1 to 140 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (4140 = 1.94 x 1084) comprising trillions upon trillions of sequences.
SEQ ID NO: 46 encodes an antigen expression cassette related to an anti-TNFalpha antibody. SEQ ID NO: 156 is 4592 nucleic acids in length. A variant sharing 90% identity (the most restrictive scenario) to SEQ ID NO: 156 can have anywhere from 1 to 459 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (4459 = 2.22 x 10276) comprising trillions upon trillions of sequences.
While the instant claims are drawn to a genus that comprises innumerable number of antibodies or antigen binding fragments, the Specification has only adequately described and successfully reduced to practice a singular antibodies or antigen binding fragments (Figure 6, Figure 9 – 13). However, this is not representative of the extremely large genus of antibodies or antigen binding fragments claimed.
The data generated for the select antibodies or antigen binding fragments described in the Specification and Drawings cannot reasonably be extrapolated and applied to support possession of the entire claimed genus of antibodies or antigen binding fragment because no structure-function relationship is established as to nucleic acid sequence and function amongst the claimed genus. As in Ariad, merely drawing a fence around the outer limits of a purported genus is not an adequate substitute for describing a variety of materials constituting the genus and showing that one has invented a genus and not just a species. “A patent is not a hunting license. It is not a reward for the search, but compensation for its successful conclusion.” Brenner v. Manson, 383 U.S. 519, 536 (1966).
Moreover, Rudikoff et al (PNAS, 1982, hereinafter, “Rudikoff”) teaches that highly similar antibody structures do not result in predictable function. Rudikoff teaches the CDR plays a key role in the target affinity of an antibody, showing that even a single amino acid alteration in the CDR can result in loss of antigen-binding function (Section: Implications for Generation of Diversity). Because the properties and function of an antibody are highly dependent upon the amino acid sequences and exact combination of CDRs, wherein, even one amino acid difference in a CDR region leads to different functional properties, different conformations of CDR sequences would result in antibodies or antigen-binding fragments having different properties. Furthermore, Einav et al (bioRxiv, 2020, hereinafter, “Einav”) teaches models of antibody mixtures through simulation. Einav teaches that even though models can be used to account for to help predict the activity of antibody mixtures, it can be “difficult to predict how antibodies will behave when mixed together, even after each has been independently characterized” (Abstract). Thus, when taken with the teachings of Rudikoff and Einav, one of skill in the art would readily appreciate that mere knowledge of structure alone cannot serve as the basis to describe members of the genus that have the recited function because a single antibody’s or antigen-binding polypeptide’s structure is unpredictable.
In the absence of a representative number of examples, the Specification must at least
describe the structural features that are required for the claimed function, in this case binding to a target protein. However, as discussed above, the Specification fails to describe any substantive structural limitations as to establish a structure-function relationship with respect to epitope binding activity. The Specification also fails to describe which regions, domains, etc. of the antibody sequences must be retained in order to bind to the target protein such as TNFalpha. Instead, Applicant merely offers a cursory statement that any antibody or antigen-binding poly peptide that binds to an epitope will work.
Accordingly, the claims as currently written are not adequately described and one of skill in the art would readily appreciate that Applicant was not in possession of the claimed genus at the time of filing.
II. Lack of written description for an innumerable combination of nucleic acids corresponding to a viral vector regulatory genes
The claims are broadly drawn to a genus comprising: a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NOs: 28, 113, 35, or 114. However, the Specification has failed to sufficiently describe the structural features that must be retained by members of the claimed genus as to establish a structure-function relationship with respect to protein function. There is not sufficient description of the structural features that must be retained to establish a functional relationship with respect to viral vector gene regulation.
The broadest reasonable interpretation of the claims encompasses innumerable permeations of the proteins of SEQ ID NOs: 28, 113, 35, or 114. The Specification fails to disclose which regions of SEQ ID NOs: 28, 113, 35, or 114 can be mutated, deleted, truncated, etc., or which regions of SEQ ID NOs: 28, 113, 35, or 114 must be retained with respect to function. The claims improperly define the genus based on what it does—not what it is.
SEQ ID NO: 28 encodes a 2A cleavage site. SEQ ID NO: 28 is 72 nucleic acids in length. A variant sharing 85% identity to SEQ ID NO: 28 can have anywhere from 1 to 10 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (410 = 1048576) comprising millions of sequences.
SEQ ID NO: 113 encodes an IL-2 leader sequence. SEQ ID NO: 113 is 60 nucleic acids in length. A variant sharing 85% identity to SEQ ID NO: 113 can have anywhere from 1 to 9 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (49 = 262144) comprising hundreds of sequences.
SEQ ID NO: 35 encodes a CMV promoter. SEQ ID NO: 35 is 380 nucleic acids in length. A variant sharing 85% identity to SEQ ID NO: 35 can have anywhere from 1 to 57 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (457 = 2.08 x 1034) comprising trillions upon trillions of sequences.
SEQ ID NO: 114 encodes a poly(A) signal. SEQ ID NO: 114 is 130 nucleic acids in length. A variant sharing 85% identity to SEQ ID NO: 114 can have anywhere from 1 to 19 substitutions, deletions or additions in any combination along any length of the sequence. Thus, just for substitutions with canonical nucleic acids alone, the instant claims encompass an enormous genus (410 = 2.7 x 1011) comprising billions of sequences.
While the claims are drawn to a nebulous genus of ill-defined variants, the Specification and Drawings have only adequately described and successfully reduced to practice a 2 cleavage linkers, a single IL-2 leader sequence, 2 CMV promoters, and 3 poly(A) signals (Figure 3, Figure 4, Figure 5).
At best, the Specification contemplates the use of BLAST to identify functional homologs based on sequence homology (¶0251). However, this is not sufficient to describe members of the claimed genus because such methods access online databases that are continually being updated as sequencing technology improves. As a result, they are not a static source of information. Thus, one of skill in the art would readily appreciate that relying on a non-patent source that is continuously subject to change as a means to identify members of the claimed genus does not sufficiently meet the written description requirement.
Moreover, regarding the 2A cleavage linker and the IL-2 leader sequence, Friedberg (Brief Bioinformatics, 7:225-242 (2006)) teaches that homology-based transfer is not reliable for functional annotation even with high alignment percentages (page 227, second column). Friedberg also teaches that identification of functionally significant sub-regions is critical to functional annotation, and that often addition, deletion, or re-shuffling
of domains can lead to errors in annotation (page 227, second column; page 228, first paragraph). Furthermore, Friedberg teaches that sequence-based tools are just not sensitive enough to identify functional protein similarity as databases get larger, and diversity of sequences gets larger (page 228, first full paragraph).
Thorton et al. (Nature Struct. Biol, Struct. Genom. Suppl. Nov., 991-994 (2000), hereinafter “Thorton”) teaches that the same protein structure is often seen in apparently different homologous families with different functions. Thorton further describes examples of little correlation between specific enzyme function and overall protein structure (page 992, right column, at lines 2-10). Thus, when taken with the teachings of Friedberg and Thorton, one of skill in the art would readily appreciate that sequence homology alone cannot serve as the basis to describe members of the genus that have the recited function.
Similarly, regarding the regulatory genes such as CMV promoter, Baliga et al (J Bateriol, 10.1128/jb.181.8.2513-2518.1999, 1999, hereinafter, “Baliga”) teaches the screening of 25,000 different promoter mutants resulting from saturation mutagenesis (Discussion ¶1). Baliga teaches that some mutations enhance transcription and translation while others complete ablate the phenotype (Figure 2 and 5). Furthermore, Baliga teaches that while some point mutations do not affect regulatory activity, when combined with other mutations, the ensemble of mutations can lead to unpredictable outcomes on regulatory function (Figure 3, Section: Saturation mutagenesis of the TATA box and UAS).
Sheets et al (Nucleic Acids Research, 10.1093/nar/18.19.5799, 1990, hereinafter, “Sheets”) teaches that single point mutations have drastic effects on poly(A) tail addition (Abstract). Sheets teaches that while some point mutations can increase the activity of a poly(A) signal, many mutations lead to the abolishment of activity (Figure 2). Thus, when taken with the teachings of Baliga and Sheets, one of skill in the art would readily appreciate that sequence homology alone cannot serve as the basis to describe members of the genus that have the recited function.
In the absence of a representative number of examples, the Specification must at least
describe the structural features that are required for the claimed function, in this case, with regards to SEQ ID NO: 28, 113, 35, and 114, viral vector gene regulation.
However, as discussed above, the Specification fails to describe any substantive structural limitations as to establish a structure-function relationship with respect to function, let alone the various improved properties required throughout the instant claims. Applicant merely offers a cursory statement that any nucleic acid sequence with 85% identity to SEQ ID NOs: 28, 113, 35, or 114 will work.
Accordingly, the claims as currently written are not adequately described and one of skill in the art would readily appreciate that Applicant was not in possession of the claimed genus before the effective filing date of the claimed invention.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 2, 4, 33, and 100 are rejected under 35 U.S.C. 103 as being unpatentable over Danos et al. (US20200093939A1, hereinafter, “Danos”).
Danos teaches methods and compositions for the delivery of therapeutic monoclonal antibodies and antigen-binding fragments thereof (Abstract). Danos teaches that the antibodies and antigen-binding fragments can be delivered by viral vectors such as AAV (Abstract). Danos teaches these AAV vectors are comprised of promoters, separate heavy and light chains separated by linkers, and with poly (A) signal (Figure 1).
Regarding claims 2, 4, and 100, Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment (Figure 1, 9).
[AltContent: textbox ([img-media_image1.png] Sequence1 is the amino acid translation of SEQ ID NO: 102, Sequence2 is Danos)] Danos teaches the amino acid sequence of the VH and VL of an anti-TNFalpha but does not explicitly teach the nucleic acid sequences of SEQ ID NOs: 102 and 103. However, translating the nucleic acid sequences of instant SEQ ID NOs: 102 and 103 result in the amino acid sequence taught by Danos (reproduced below). Thus, the claimed sequences are reasonably encompassed by Danos.
[AltContent: textbox ([img-media_image2.png] Sequence1 is the amino acid translation of SEQ ID NO: 103, Sequence2 is Danos)]Regarding claim 33, Danos teaches the nucleic acid sequence encoding a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal can be packaged in an AAV2 capsid (¶0418).
In view of the foregoing, all the claimed limitations are found in one reference and are taught to be optional variations to a ‘base’ composition they exemplify. As such, the claimed invention is within the scope of Danos, and thus Danos renders the invention prima facie obvious. The rationale to support this conclusion of obviousness is that Danos provides a teaching, suggestion, and motivation to substitute different variables disclosed within the reference. Furthermore, there is no evidence on the record that indicates that the claimed viral vector exhibits any unexpected results compared to the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claims 6 and 96 are rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Eckelman et al (US20130011398A1, hereinafter, “Eckelman”).
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment. The reference fails to teach the nucleic acid sequence of the heavy chain (HC) and light chain (LC) comprising the sequences SEQ ID NOs: 110 and 111 respectively.
However, Eckelman teaches fusion proteins comprising serpin polypeptides (Abstract). Eckelman teaches these fusion proteins target aberrant serine protease activity or an imbalance of protease-to-protease inhibitor that can lead to protease-mediated tissue destruction and inflammatory responses (¶0003). Eckelman teaches that the fusion proteins can target TNFalpha by encoding an anti-TNFalpha antibody or antigen-binding fragments thereof (¶0154).
Regarding claims 6 and 96, Eckelman teaches the amino acid sequence of the HC and LC but does not explicitly teach the nucleic acid sequences of SEQ ID NOs: 110 and 111. However, translating the nucleic acid sequences of instant SEQ ID NOs: 110 and 111 result in the amino acid sequence taught by Eckelman (reproduced below). Thus, the claimed sequences are reasonably encompassed by Danos.
[AltContent: textbox ([img-media_image3.png] Sequence1 is the amino acid translation of SEQ ID NO: 110, Sequence2 is Eckelman)]
[AltContent: textbox ([img-media_image4.png] Sequence1 is the amino acid translation of SEQ ID NO: 111, Sequence2 is Eckelman)]
Danos and Eckelman are considered to be analogous to the claim invention because they both teach the use of antibodies to target TNFalpha. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment (Figure 1, 9). Eckelman teaches the amino acid sequence of the HC and LC but does not explicitly teach the nucleic acid sequences of SEQ ID NOs: 110 and 111 (see above).
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to use the exact sequence of the HC and LC taught by Eckelman in the viral vector taught by Danos because doing so would ensure proper expression of the antibody or antibody-binding fragments. Furthermore, there is no evidence on the record that indicates that the specific nucleic acid sequences of instant SEQ ID NOs: 110 and 111 exhibits any unexpected results compared to the prior art. One of ordinary skill in the art would have had a reasonable expectation of success of using the sequence taught by Eckelman in the viral vector taught by Danos given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claims 12 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Viapiano et al (US20170015757A1, hereinafter, “Viapiano”).
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment. The reference fails to teach the nucleic acid sequence of an IL-2 leader sequence.
However, Viapiano teaches fusion proteins comprising leader sequences operably linked to antibodies (¶0185). Viapiano teaches these fusion proteins are comprised of antibodies or antigen-binding domains that target fibulin-3(Abstract). VIapiano teaches that the fusion proteins can be sued to treat cancers and other conditions (¶0008).
Regarding claims 12 and 14, Viapiano teaches the amino acid sequence of the IL-2 leader sequence but does not explicitly teach the nucleic acid sequences of SEQ ID NO: 113. However, translating the nucleic acid sequence of instant SEQ ID NO: 113 result in the amino acid sequence taught by Viapiano (reproduced below). Thus, the claimed sequences are reasonably encompassed by Danos.
[AltContent: textbox ([img-media_image5.png] Sequence1 is the amino acid translation of SEQ ID NO: 113, Sequence2 is Viapiano)]
Danos and Viapiano are considered to be analogous to the claim invention because they both teach the use of antibodies to treat diseases and conditions. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment (Figure 1, 9). Viapiano teaches the amino acid sequence of the IL-2 leader sequence but does not explicitly teach the nucleic acid sequences of SEQ ID NO: 113 (see above).
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to use the exact sequence of the IL-12 leader sequence taught by Viapiano in the viral vector taught by Danos because doing so would ensure proper post-translation processing and secretion of the antibody or antibody-binding fragments. Furthermore, there is no evidence on the record that indicates that the specific nucleic acid sequence of instant SEQ ID NO: 113 exhibits any unexpected results compared to the prior art. One of ordinary skill in the art would have had a reasonable expectation of success of using the sequence taught by Viapiano in the viral vector taught by Danos given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claims 16 and 18 are rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Kahland et al (Dissertation, 2015, 10.53846/goediss-5388, hereinafter, “Kahland”).
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment. The reference fails to teach the nucleic acid sequence of a CMV promoter.
However, Kahland teaches methods for transgenesis and genome modification of marmosets (Abstract). Kahland teaches using viral vectors to express transgenes (Abstract). Khaland also teaches the CMV promoter can be used to drive transgene expression (Section: 2.13.2 Lentivirus generation with 293T cells).
Regarding claims 16 and 18, Kahland teaches the nucleic acid sequence of the CMV promoter with 100% sequence identity to SEQ ID NO: 35 (reproduced below, “Query” is SEQ ID NO: 35, “Sbjct” is Kahland).
PNG
media_image6.png
661
952
media_image6.png
Greyscale
Danos and Kahland are considered to be analogous to the claim invention because they both teach viral vectors to modify protein expression within a cell. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment (Figure 1, 9). Kahland teaches the nucleic acid sequence of the CMV promoter with 100% sequence identity to SEQ ID NO: 35 (see above).
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to use the exact sequence of the CMV promoter sequence taught by Kahland in the viral vector taught by Danos because doing so would ensure high expression of the antibody or antibody-binding fragments. Furthermore, there is no evidence on the record that indicates that the specific nucleic acid sequence of instant SEQ ID NO: 35 exhibits any unexpected results compared to the prior art. One of ordinary skill in the art would have had a reasonable expectation of success of using the sequence taught by Kahland in the viral vector taught by Danos given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claim 21 is rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Bensussen et al (iScience, 2020, 10.1016/j.isci.2020.101330, hereinafter, “Bensussen”).
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal. The reference fails to teach the nucleic acid sequence of a poly(A) signal.
However, Bensussen teaches methods delivering florescent synaptic tags to neurons using AAVs and retroviral vectors (Abstract). Bensussen teaches viral vectors encoding various constructs that allow efficient expression of exogenous genes (Abstract). Bensussen also teaches that these AAV vectors contain different regulatory regions that affects transgene expression (Section: Molecular cloning).
Regarding claim 21, Bensussen teaches the nucleic acid sequence of the CMV promoter with 100% sequence identity to SEQ ID NO: 114 (reproduced below, “Query” is SEQ ID NO: 114, “Sbjct” is Bensussen).
PNG
media_image7.png
338
938
media_image7.png
Greyscale
Danos and Bensussen are considered to be analogous to the claim invention because they both teach viral vectors to modify protein expression within a cell. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal (Figure 1, 9). Bensussen teaches the nucleic acid sequence of the poly(A) signal with 100% sequence identity to SEQ ID NO: 114 (see above).
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to use the exact sequence of the poly(A) signal sequence taught by Bensussen in the viral vector taught by Danos because doing so would ensure high expression of the antibody or antibody-binding fragments. Furthermore, there is no evidence on the record that indicates that the specific nucleic acid sequence of instant SEQ ID NO: 114 exhibits any unexpected results compared to the prior art. One of ordinary skill in the art would have had a reasonable expectation of success of using the sequence taught by Bensussen in the viral vector taught by Danos given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claims 25 and 98 are rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Capon et al (US20170008950A1, hereinafter, “Capon”).
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal. The reference fails to teach the nucleic acid sequence of SEQ ID NO: 46.
However, Capon teaches chemical compounds that combine a biologically active payload with a protein-based carrier such as antibody or antigen-binding fragment (¶0007-0009). The carrier can include part of an antibody Fc domain or Fab-related sequence that can bind Fc receptors (Abstract, Figure 13). Capon teaches that these chemical compounds improve flexibility and are extendible decreasing intrinsic immunogenicity (¶0005-0006).
Regarding claims 25 and 98, Capon teaches the amino acid sequence translation of SEQ ID NO: 46 but does not explicitly teach the nucleic acid sequence of SEQ ID NO: 46. However, translating the nucleic acid sequence of SEQ ID NO: 46 result in the amino acid sequence taught by Capon (reproduced below, “Query” is SEQ ID NO: 46, “Sbjct” is Capon).
PNG
media_image8.png
430
1007
media_image8.png
Greyscale
Danos and Capon are considered to be analogous to the claim invention because they both teach the improvement of antibodies. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal (Figure 1, 9). Capon teaches the amino acid sequence translation of SEQ ID NO: 46 (see above).
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to use the exact sequence of SEQ ID no: 46 sequence taught by Capon in the viral vector taught by Danos because doing so would ensure high expression of the antibody or antibody-binding fragments. Furthermore, there is no evidence on the record that indicates that the specific nucleic acid sequence of instant SEQ ID NO: 46 exhibits any unexpected results compared to the prior art. One of ordinary skill in the art would have had a reasonable expectation of success of using the sequence taught by Capon in the viral vector taught by Danos given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Basi (US20220162297A1, hereinafter, “Basi”).
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal. The reference fails to teach the nucleic acid sequence of SEQ ID NO: 56.
However, Basi teaches bispecific heterodimeric antibodies with modified heavy chain IgG constant regions that promote efficient assembly of antibody heavy chain heterodimer pairs (Abstract). Basi teaches various modifications and improvements to adalimumab, an anti-TNFalpha antibody (Figures 6 – 19). Basi also teaches methods to improve product purity and increasing production scale (¶0006).
Regarding claims 28, Basi teaches the amino acid sequence translation of SEQ ID NO: 56 but does not explicitly teach the nucleic acid sequence of SEQ ID NO: 56. However, translating the nucleic acid sequence of SEQ ID NO: 56 result in a amino acid sequence with 91% sequence identity to that taught by Basi (reproduced below, “Qy” is SEQ ID NO: 56, “Db” is Basi).
ength: 470
Score: 2422.00 Matches: 455
Percent Similarity: 99.3% Conservative: 2
Best Local Similarity: 98.9% Mismatches: 3
Query Match: 91.0% Indels: 0
Gaps: 0
US-18-262-880-56 (1-1407) x US-16-625-628-4 (1-470)
Qy 28 CTGGTCCTCCTGACTGGGGTGAGGGCTGAGGTGCAGCTGGTTGAAAGCGGCGGAGGGCTT 87
||| :::||| ||||||::: |||||||||||||||||||||||||||||||||
Db 11 LeuAlaIleLeuLysGlyValGlnCysGluValGlnLeuValGluSerGlyGlyGlyLeu 30
Qy 88 GTTCAACCTGGTAGATCCTTGAGACTTTCTTGCGCCGCTTCTGGCTTCACCTTTGATGAT 147
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 31 ValGlnProGlyArgSerLeuArgLeuSerCysAlaAlaSerGlyPheThrPheAspAsp 50
Qy 148 TATGCAATGCACTGGGTGAGGCAGGCGCCTGGAAAGGGGCTGGAGTGGGTATCAGCCATC 207
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 51 TyrAlaMetHisTrpValArgGlnAlaProGlyLysGlyLeuGluTrpValSerAlaIle 70
Qy 208 ACATGGAACAGTGGCCATATTGACTATGCTGATAGTGTGGAAGGTAGATTCACTATATCC 267
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 71 ThrTrpAsnSerGlyHisIleAspTyrAlaAspSerValGluGlyArgPheThrIleSer 90
Qy 268 CGCGACAATGCCAAAAACTCTTTATACCTGCAGATGAATTCACTACGCGCAGAGGATACT 327
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 91 ArgAspAsnAlaLysAsnSerLeuTyrLeuGlnMetAsnSerLeuArgAlaGluAspThr 110
Qy 328 GCGGTCTATTACTGTGCTAAGGTGTCATATCTCAGCACCGCATCCTCTCTGGACTACTGG 387
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 111 AlaValTyrTyrCysAlaLysValSerTyrLeuSerThrAlaSerSerLeuAspTyrTrp 130
Qy 388 GGACAAGGGACATTGGTTACTGTGAGCTCCGCCTCCACCAAGGGCCCAAGTGTCTTCCCC 447
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 131 GlyGlnGlyThrLeuValThrValSerSerAlaSerThrLysGlyProSerValPhePro 150
Qy 448 CTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAG 507
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 151 LeuAlaProSerSerLysSerThrSerGlyGlyThrAlaAlaLeuGlyCysLeuValLys 170
Qy 508 GACTACTTCCCTGAACCTGTGACAGTGTCTTGGAACTCAGGCGCCCTGACCAGCGGAGTG 567
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 171 AspTyrPheProGluProValThrValSerTrpAsnSerGlyAlaLeuThrSerGlyVal 190
Qy 568 CACACCTTCCCAGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGTGTGGTGACT 627
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 191 HisThrPheProAlaValLeuGlnSerSerGlyLeuTyrSerLeuSerSerValValThr 210
Qy 628 GTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAATGTGAATCACAAGCCCAGC 687
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 211 ValProSerSerSerLeuGlyThrGlnThrTyrIleCysAsnValAsnHisLysProSer 230
Qy 688 AACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCA 747
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 231 AsnThrLysValAspLysLysValGluProLysSerCysAspLysThrHisThrCysPro 250
Qy 748 CCTTGCCCAGCACCTGAACTCCTGGGGGGACCATCAGTCTTCCTCTTCCCCCCAAAACCC 807
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 251 ProCysProAlaProGluLeuLeuGlyGlyProSerValPheLeuPheProProLysPro 270
Qy 808 AAGGACACCCTCATGATCTCCCGCACCCCTGAGGTCACATGTGTGGTGGTGGATGTGAGC 867
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 271 LysAspThrLeuMetIleSerArgThrProGluValThrCysValValValAspValSer 290
Qy 868 CATGAAGACCCTGAGGTCAAGTTCAACTGGTATGTGGATGGTGTGGAGGTGCATAATGCC 927
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 291 HisGluAspProGluValLysPheAsnTrpTyrValAspGlyValGluValHisAsnAla 310
Qy 928 AAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACATACAGAGTGGTCTCTGTCCTCACT 987
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 311 LysThrLysProArgGluGluGlnTyrAsnSerThrTyrArgValValSerValLeuThr 330
Qy 988 GTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCC 1047
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 331 ValLeuHisGlnAspTrpLeuAsnGlyLysGluTyrLysCysLysValSerAsnLysAla 350
Qy 1048 CTCCCAGCCCCTATTGAGAAAACAATCTCCAAAGCCAAAGGGCAGCCCAGGGAACCACAG 1107
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 351 LeuProAlaProIleGluLysThrIleSerLysAlaLysGlyGlnProArgGluProGln 370
Qy 1108 GTGTACACCCTGCCCCCATCCCGCGATGAGCTGACCAAGAACCAGGTCTCCCTGACCTGC 1167
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 371 ValTyrThrLeuProProSerArgAspGluLeuThrLysAsnGlnValSerLeuThrCys 390
Qy 1168 CTGGTCAAAGGCTTCTATCCCAGTGACATTGCTGTGGAGTGGGAGAGCAATGGGCAGCCT 1227
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 391 LeuValLysGlyPheTyrProSerAspIleAlaValGluTrpGluSerAsnGlyGlnPro 410
Qy 1228 GAGAACAACTACAAGACCACACCTCCAGTGCTGGACTCTGATGGCTCCTTCTTCCTCTAC 1287
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 411 GluAsnAsnTyrLysThrThrProProValLeuAspSerAspGlySerPhePheLeuTyr 430
Qy 1288 TCCAAGCTCACTGTGGACAAGAGCAGGTGGCAGCAGGGGAATGTCTTCTCATGCAGTGTG 1347
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 431 SerLysLeuThrValAspLysSerArgTrpGlnGlnGlyAsnValPheSerCysSerVal 450
Qy 1348 ATGCATGAGGCTCTGCACAACCACTACACACAGAAGAGCCTCTCCCTGTCTCCTGGTAAA 1407
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 451 MetHisGluAlaLeuHisAsnHisTyrThrGlnLysSerLeuSerLeuSerProGlyLys 470
Danos and Basi are considered to be analogous to the claim invention because they both teach the improvement of antibodies. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal (Figure 1, 9). Basi teaches a amino acid sequence a 91% sequence identity of the nucleic acid translation of SEQ ID NO: 56 (see above).
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to use the sequence of SEQ ID no: 56 sequence taught by Basi in the viral vector taught by Danos because doing so would ensure high expression of the antibody or antibody-binding fragments. Furthermore, there is no evidence on the record that indicates that the specific nucleic acid sequence of instant SEQ ID NO: 56 exhibits any unexpected results compared to the prior art. One of ordinary skill in the art would have had a reasonable expectation of success of using the sequence taught by Basi in the viral vector taught by Danos given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claim 36 is rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Carson (US20130243789A1, hereinafter, “Carson”).
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal. The reference fails to teach a host cell comprising the rAAV of claim 2 or a composition comprising the rAAV of claim 2 and a carrier.
However, Carson teaches constructs and methods for the expression of antibodies and antigen-binding fragments within a recombinant host cell (Abstract). Carson teaches that these antibodies can be packaged within AAVs (¶0029). Carson also teaches an antibody expression cassette comprising a promoter, a sequence encoding a VH, a linker comprising cleavable sequence, a VL (Figs. 1-3, ¶0027, ¶0192 - 0193, ¶0207). Carson teaches the linker cleavable sequence is 2A (¶0026), the antibody encoded is a TNF-α antibody such as adalimumab (¶0040), and a promoter such as CMV (¶0123).
Regarding claim 36, Carson teaches host cells infected with a vector that comprises heavy and light chains of an antibody (¶0031).
Danos and Carson are considered to be analogous to the claim invention because they both teach the use of viral vectors to deliver anti-TNFalpha antibodies or antigen binding fragments to host cells. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal (Figure 1, 9). Carson teaches host cells infected with a vector that comprises heavy and light chains of an antibody (¶0031).
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to infect host cells with the rAAV, as taught by Danos and Carson, because doing so would a host cell would continually express and produce an antibody or antigen-binding fragments. One of ordinary skill in the art would have had a reasonable expectation of success of infecting a host cell with a rAAV given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claim 37 is rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Wilson et al (US20180363000A1, hereinafter, “Wilson”).
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal. The reference fails to teach a composition comprising the rAAV of claim 2 and a carrier.
However, Wilson teaches constructs and methods for lowering cholesterol in a subject by administering an AAV encoding anti-PCSK9 antibody (Abstract). Wilson aims to reduce the need for repeated antibody injections by enabling longer-lasting expression from a single vector dose (¶0003). Wilson teaches the vector can be comprised of a CMV promoter, an antibody coding sequence with leader sequences, furin-2A cleavage sites, and a poly(A) sequence (¶0036, ¶0059, ¶0060).
Regarding claim 37, Wilson teaches a carrier, such as buffered saline, can be delivered with a viral vector encoding an antibody or antigen-binding fragments (¶0089).
Danos and Wilson are considered to be analogous to the claim invention because they both teach the use of viral vectors to deliver antibodies or antigen binding fragments to host cells. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal (Figure 1, 9). Wilson teaches a carrier, such as buffered saline, can be delivered with a viral vector encoding an antibody or antigen-binding fragments (¶0089).
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to infect host cells with the rAAV, as taught by Danos, with a carrier, as taught by Wilson, because doing so would increase the likelihood of stability of the rAAV in a different environment. One of ordinary skill in the art would have had a reasonable expectation of success of infecting a host cell with a rAAV and a carrier given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claims 97 and 99 are rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Wilson and Viapiano.
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal. The reference fails to teach a composition comprising an antibody expression cassette is comprised of an IL-10 leader sequence operably linked to a nucleotide sequence at least 85% identical to SEQ ID NO: 102, a furin-2A cleavage site, a IL-2 leader sequence operably linked to a nucleotide sequence at least 85% identical to SEQ ID NO: 103.
However, Danos teaches sequences 100% identical to SEQ ID NOs 102 and 103 (see above). Wilson teaches a leader sequence operably linked to the heavy and/or light chain of an antibody (¶0059). Wilson also teaches the leader sequence can be a cytokine such as “IL-2, IL12, IL18, or the like” (¶0059). Wilson teaches a furin cleavage site and Viapiano teaches a 2A cleavage site (see above).
Danos, Wilson, and Viapiano are considered to be analogous to the claim invention because they teach the use antibodies or antigen binding fragments to treat disease or conditions. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal (Figure 1, 9). Viapiano teaches the amino acid sequence of the IL-2 leader sequence but does not explicitly teach the nucleic acid sequences of SEQ ID NO: 113 (see above). Wilson teaches the leader sequence can be a cytokine such as “IL-2, IL12, IL18, or the like” (¶0059). Thus, Wilson teaches that an IL based leader sequence can be swapped with another IL leader sequence such as IL-10.
Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to an engineer a sequence comprising a IL-10 leader sequence operably linked to a nucleotide sequence at least 85% identical to SEQ ID NO: 102, a furin-2A cleavage site, and an IL-2 leader sequence operably linked to a nucleotide sequence at least 85% identical to SEQ ID NO: 103 because doing so would produce separate VH and VL proteins that are properly trafficked within a host cell. One of ordinary skill in the art would have had a reasonable expectation of success of using this general antibody cassette scheme given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claim 101 is rejected under 35 U.S.C. 103 as being unpatentable over Danos as applied to claims 2, 4, 33, and 100 above, and further in view of Capon, Wilson, and Basi.
As discussed above, claims 2, 4, 33, and 100 were rendered prima facie obvious by the teachings of Danos. Danos teaches a recombinant AAV that encodes a promoter, a leader sequence to a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- tumor necrosis factor alpha (anti-TNFalpha) antigen-binding fragment thereof, followed by a proteolytic cleave linker, and a second leader sequence that is operably linked to a light chain variable region (VL) of an anti-TNFalpha antigen-binding fragment followed by a poly(A) signal. The reference fails to teach a composition comprising an antibody expression cassette is comprised of an ORF comprising a nucleotide sequence at least 90% identical to SEQ ID NO: 46, a furin-2A cleavage site, and a nucleotide sequence at least 90% identical to SEQ ID NO: 56.
However, Capon teaches the amino acid sequence translation of SEQ ID NO: 46 but does not explicitly teach the nucleic acid sequence of SEQ ID NO: 46. However, translating the nucleic acid sequence of SEQ ID NO: 46 result in a amino acid sequence taught by Capon (see above). Wilson teaches a furin-2A cleavage site (¶0060). Basi teaches the amino acid sequence translation of SEQ ID NO: 56 but does not explicitly teach the nucleic acid sequence of SEQ ID NO: 56. However, translating the nucleic acid sequence of SEQ ID NO: 56 result in an amino acid sequence with 91% sequence identity to that taught by Basi (see above)
Danos, Capon, Wilson, and Basi are considered to be analogous to the claim invention because they teach the use antibodies or antigen binding fragments to treat disease or conditions. Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to engineer a sequence at least 90% identical to SEQ ID NO: 46, a furin-2A cleavage site, and a nucleotide sequence at least 90% identical to SEQ ID NO: 56 because doing so would produce separate HC and LC proteins within a host cell. One of ordinary skill in the art would have had a reasonable expectation of success of using this general antibody cassette scheme given that this method was well known, has been successfully demonstrated, and commonly used as evidenced by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Conclusion
NO CLAIMS ARE ALLOWED
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Danyal H Alam whose telephone number is (571)272-1102. The examiner can normally be reached M - F 9am - 5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DANYAL HASSAN ALAM/Examiner, Art Unit 1672
/THOMAS J. VISONE/Supervisory Patent Examiner, Art Unit 1672
Prosecution Insights