DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s election without traverse of Group I, claims 1-4, 6, 9, 13, 14 and 29 and biomarkers FGA, D21S11, D18S51, vWA, D3S1358 and TH01 (SEQ ID NOS: 11-12, 17-18, 25, 26, 33, 34, 35, 36 and 39-40 in the reply filed on 2/19/2026 is acknowledged. Claims 5, 7-8, 10-12 have been canceled. Claims 15-17, 21-24, 26, 28, 30-33, 35-36 have been withdrawn consideration as being drawn to a non-elected invention.
Priority
This application is a 371 of PCT/US2022/020493 filed 03/16/2022 which claims benefit of 63/161,568 filed 03/16/202.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 8/2/2023 is acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
The drawings were received on 8/2/2023. These drawings are found acceptable by the Examiner.
Specification
The disclosure is objected to because of the following informalities:
(a) The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code at paragraphs [0051] and [0098]. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-4, 6, 9, 13, 14 and 29 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
(a) Claims 1-4, 6, 9, 13, 14 and 29 are indefinite at the recitation of “nucleic acid contributor” in the claims 1, 9 and 29 because a limiting definition is not provided in the specification and one would not be apprised of the scope of the claimed limitation in the context of the instant invention. In other words, the metes and bounds of the claimed limitation cannot be clearly ascertained.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-4, 6, 9, 13, 14, and 29 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claimed invention is not directed to patent eligible subject matter. Based upon consideration of all of the relevant factors with respect to the claim as a whole, claim(s) 1-4, 6, 9, 13, 14, and 29 is/are determined to be directed to an abstract idea. The rationale for this determination is explained below:
The claims are drawn to a method for determining nucleic acid contributors to a biological sample or specimen from nucleic acids obtained from single cells in the biological sample or specimen by determining one or more macrohaplotypes, comprising the steps of: obtaining or having obtained a biological sample or specimen; generating amplicons or obtaining a sequence of amplicons from the biological sample or specimen to obtain two or more markers selected from Short Tandem Repeat (STR), Single Nucleotide Polymorphisms (SNPs), Insertion-Deletions (Indels), or combinations thereof, from a paternal, maternal, or both chromosomes; calculating from the one or more macrohaplotypes one or more nucleic acid contributors to the biological sample or specimen; comparing the one or more macrohaplotypes to a reference or known macrohaplotype profile from a subject suspected of contributing nucleic acids to the biological sample or specimen; and identifying a number of contributors to the biological sample or specimen (claim 1). The claims 2-4, 6, 9, 13, 14 and 29 embodies the limitations of the claim 1 recited above).
According to the Updates to the interim Eligibility Guidance an initial two step analysis is required for determining statutory eligibility.
Step 1 requires a determination of whether the claims are directed to a process, machine, manufacture, or a composition of matter. In the instant case the Step 1 requirement is satisfied as the claims are directed towards a process/machine.
The Step 2 analysis is a two-part analysis, Step 2A and Step 2B, with the first part Step 2A requiring a determination of whether the claims are directed towards a judicial exception, i.e. a law of nature, natural phenomenon, or an abstract idea.
In the instant case, the claims are drawn to the method(s) recited above comprising steps of calculating data, comparing data, identifying a number of contributors to a biological sample, determining macrophaplotypes, comparing information in a database, generating a list and utilizing probabilistic models and computer processors to analyze data and determine nucleic acid contributors.
The result of Step 2A analysis is that the claims are directed towards a judicial exception, i.e., abstract idea, especially in the claims 1, 4, 6 and 29. The claims recited steps that can be performed in the mind or with the use of paper and pen or with the use of a computer, computer program or software and mathematical calculations/algorithms to obtain sequence information.
The Court has made clear if a claim is directed essentially to a method of calculating, using a mathematical formula, even if the solution is for a specific purpose, the claimed method is non-statutory. In other words, patenting abstract ideas cannot be circumvented by attempting to limit the use [the idea] to a particular technological environment. In the instant case, the use of computer processor and probabilistic mixture model for calculations and profiling are considered mere instructions to implement an abstract idea. The recitation of these steps in the method claims do not offer a meaningful limitation beyond generally linking “the use of the method to a particular technological environment,’ that is, implementation via computer for calculations or use of software and algorithms programs for gathering and analyzing data.” see Alice Corp v. CLS Bank Int’l 573 U.S. (2014).
The second part, Step 2B of the two-step analysis is to determine whether any element or combination of elements, in the claim is sufficient to ensure that the claims as a whole amount to significantly more than the judicial exception. In this case, the steps of obtaining a biological sample, generating amplicons or obtaining a sequence of amplicons from the biological sample and performing long read sequence comprises of well-understood and routine and conventional activity already engaged in by the scientific community. For example, Filippova et al (US 20200211675, July 2020), teach a method of detecting phased variants using long-read sequencing to determine phased information within a sample [0028]]; Li et al (WO 2018236911, (also cited in citation made of record on IDS filed 8/2/2023) teach a method of quantifying and deconvolving nucleic acid mixture samples including one or more contributors having known or unknown genomes (abstract) comprising obtaining a sample and obtaining sequencing information (see claims at pages 114-128); and Babiarz et al (US 20200157629, May 2020) teach a method for amplification of target loci using long-read sequencing [0334].
The additional limitations, which have been found to be known and routine in the art, do not transform the abstract idea into a patent eligible application of the abstract idea such that the claims amount to significantly more than the abstract idea. The Court has made clear that to transform an unpatentable law of nature into patent-eligible application of such a law, one must do more than simply state the law of nature while adding the words “apply it”. Essentially, appending conventional steps or elements, specified at a high level of generality, to laws of nature, natural phenomena, and abstract ideas cannot make those laws, phenomena, and ideas patent-eligible. The Supreme Court also indicated that any additional steps that simply are routine and conventional in the art are insufficient to transform an otherwise patent-ineligible process.
In view of the foregoing, the claims are not drawn to patent eligible subject matter under 35 USC 101.
Claim Rejections - 35 USC § 103
10. Note: Given the ambiguity of the claims as noted above, for the purpose of application of prior art, the claims are given the broadest reasonable interpretation by the examiner.
11. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
12. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
13. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
14. Claim(s) 1, 3, 9, 13 is/are rejected under 35 U.S.C. 103 as being unpatentable over Li et al (EP 3642747, 04/29/2020, citation made of record on IDS filed 8/2/2023) in view of Hart et al (WO 20919051103, 3/14/2019, citation made of record on IDS filed 8/2/2023).
Regarding claim 1, Li et al teach a method for determining nucleic acid contributors to a biological sample or specimen from nucleic acids obtained from single cells in the biological sample or specimen (quantify nucleic acid mixture sample deconvolved from nucleic acid mixture, paragraph [0010]) comprising the steps of: obtaining or having obtained a biological sample or specimen (sample can be biological tissues, cells, paragraph [0007]); generating amplicons (amplify nucleic acid molecules from sample, paragraph [0011]) or obtaining a sequence of amplicons from the biological sample or specimen to obtain two or more markers selected from Single Nucleotide Polymorphisms "SNPs" (analysis includes Indels and STR, paragraph [0724]), or combinations thereof, from a paternal, maternal, or both chromosomes (system can map to chromosome or chromosome of interest, paragraph [00541]); calculating one or more nucleic acid contributors to the biological sample or specimen (one or more contributors to the sample, paragraph [0011]); comparing to a reference or known profile (one or more processors reads maps nucleic acid sequence and reads to one or more polymorphism loci, paragraph [0097]) from a subject suspected of contributing nucleic acids to the biological sample or specimen (mixtures of nucleic acids from two or more individuals identified with processors, paragraph [00149]) and identifying a number of contributors to the biological sample or specimen (one or more fractions of nucleic acid of the one or more contributors, paragraph [0011]).
Li does not teach determining nucleic acid contributors by determining one or more macrohaplotypes.
Hart et al disclose determining nucleic acid contributors by determining one or more macrohaplotypes (mtDNA analysis including haplogroup HV includes creating amplicons of haplogroups and amplify DNA for analysis of sequences when there are one or more contributors in sample, paragraph [0036]; [00274]).
It would have been obvious to one of ordinary skill in the art, at the time the invention was made, to modify the method of Li et al to encompass detection of one or more haplotypes determining nucleic acid contributors, as taught by Hart because inclusion of mitochondrial genome varieties all for improved methods to discriminate identify of individuals (Hart, paragraph [0027]).
Regarding claim 3, Li et al teach wherein the amplicons are 100, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 10000, 50000, 100000 or more base pairs (techniques including 150 kb molecules used, paragraph [0053]).
Regarding claim 8, Li et al teach further comprising determining using a probabilistic mixture model using one or more processors (probabilistic mixture model with one or more processors used for genotypes, paragraph [0013]) one or more genotypes of the one or more contributors (unknown genotypes of contributors determined, paragraph [0007]).
Regarding claim 9, Li et al teach wherein the one or more nucleic acid contributors comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more or more contributors (one or more contributors include two or more contributors, paragraph [0015]).
Regarding claim 13, Hart et al disclose wherein the one or more macrohapotypes comprise at least one of the short tandem repeat (STR), single nucleotide polymorphisms (SNP) and insertion-deletion (Indels) (STR marker, filtered by SNP applied to haplogroup HV (para. [0037], [0260], [0389]).
15. Claim(s) 2, 4, 6 and 29 is/are rejected under 35 U.S.C. 103 as being unpatentable over Li et al in view of Hart as previously applied above in view of Filippova et al (20200211675, July 2020).
Regarding claims 2, 4, 6 and 29, Li et al in view of Hart et al teaches a method for determining nucleic acid contributors as previously discussed above.
Li et al in view of Hart does not teach wherein the step of generating amplicons is by long-read sequencing, determining macrohaplotypes from markers on a paternal or maternal chromosome and comparing the macrohalotypes to database-based information gained from long-read sequencing.
In a general teaching, Filippova et al teach a method wherein amplicons are generated by long-read sequences and phasing of genetic variants (para. [0027] – [0028], [0034] – [0036], [0041] –[0042] and [0047]. Filippova et al teach wherein variant phasing comprise assigning variant alleles to a same nucleic acid strand (haplotype), e.g., different strands of different uniploid organisms or the strands corresponding to the paternal and maternal chromosomes of a diploid organism [0020]. Fillippova et al teach teach capturing, comparing and reporting variants between long sequence reads and a reference sequence ([0029], [0035], [0042] – [0044]. Finally, Fillippova et al teaches analytical systems comprising processors and software programs for analyzing sequencing data ([0092]- [0101]).
Filippova et al teach that long read next generation sequencing enables phasing across long distance genomic scales without relying on trio analysis or statistical inference. The reference teaches by identifying haplotype information, phased sequencing may inform studies of complex traits, which are often influenced by interactions among multiple genes and alleles. Filippova teaches by phasing may also provide valuable information for genetic disease research as disruptions to alleles on a chromosome which can cause some genetic disorder. The reference additional teach that phasing may also help researchers to analyze compound heterozygotes, measure allele-specific expression, and identify variant linkage ([0027]).
It would have been prima facie obvious to one of ordinary skill in the art at the time of the effective filing date of the claimed invention to have been motivated to modify the method of Li et al in view of Hart to encompass generating and analyzing amplicons using long-read sequencing as taught by Filippova et al. The ordinary artisan would have been motivated to do so for the advantages taught by Filippova that long read next generation sequencing enables phasing across long distance genomic scales without relying on trio analysis or statistical inference and further may provide valuable information on genetic disorders and diseases.
16. Claim(s) 14 is/are rejected under 35 U.S.C. 103 as being unpatentable over Li et al in view of Hart as previously applied above in view of Chen et al (CN 110423802, November 2019, translated document) and Bare et al (US 20120108651, May 2012, see alignment below).
Regarding claim 14, Li et al in view of Hart et al teaches a method for determining nucleic acid contributors as previously discussed above.
Li et al in view of Hart do not teach wherein the macrohaplotypes are sequenced using a forward and a reverse primer selected from SEQ ID NOS: 1-40.
In a general teach detecting a nucleic acid contributor in a sample involving Y chromosome STR locus, Chen teaches performing composite amplification on microhaplotype comprising amplification primers that corresponds to STR loci, wherein the loci comprise of DS18S51, D21S11, D3S1358, FGA, TH01 and vWA (see abstract and pages 3-4). Chen also teaches a primer sequence identical to the oligonucleotide sequence of SEQ ID NO: 33. (See STR FGA Primer SEQ ID NO: 46, alignment below).
SEQ ID NO: 33
BGY54723
ID BGY54723 standard; DNA; 21 BP.
XX
AC BGY54723;
XX
DT 26-DEC-2019 (first entry)
XX
DE Human STR FGA PCR primer SEQ: 46.
XX
KW PCR; dna detection; genetic marker; primer; ss.
XX
OS Homo sapiens.
XX
CC PN CN110423802-A.
XX
CC PD 08-NOV-2019.
XX
CC PI Chen L, Zheng W, Wang L, Zhang K, Geng X, Liu Y, Li F, Guo
Qy 1 ATGACTTTGCGCTTCAGGAC 20
||||||||||||||||||||
Db 1 ATGACTTTGCGCTTCAGGAC 20
In another general teaching, Bare teaches methods of detecting genetic polymorphic variants of different locus ([0146], [0262]) using amplification-based techniques ([0041], [0127], [0154] – [0161]. Bare et al teach wherein detection of SNPS associated with FGA (see Table 5). Bare et al teach a sequence for detecting SNP locus
SEQ ID NO: 34
AZV57547
(NOTE: this sequence has 4 duplicates in the database searched)
ID AZV57547 standard; DNA; 28617 BP.
XX
DT 21-JUN-2012 (first entry)
XX
DE Venous thrombosis related human genomic DNA, SEQ ID 350.
XX
OS Homo sapiens.
XX
CC PN US2012108651-A1.
XX
CC PD 03-MAY-2012.
XX
CC PF 01-NOV-2011; 2011US-00286934.
XX
PR 02-NOV-2010; 2010US-0409434P.
XX
CC PA (UYLE-) UNIV LEIDEN MEDICAL CENT LUMC.
CC PA (CELE-) CELERA CORP.
XX
CC PI Bare L, Devlin JJ, Rosendaal FR, Reitsma PH, Bezemer ID;
XX
DR WPI; 2012-F14541/32.
XX
CC PT Determining whether a human's risk for venous thrombosis is reduced by
CC PT treatment with an heterologous hydroxymethylglutaryl-CoA reductase
CC PT inhibitor by testing nucleic acid from the human for the presence or
CC PT absence of an allele.
XX
CC PS Disclosure; SEQ ID NO 350; 142pp; English.
XX
XX
SQ Sequence 28617 BP; 9041 A; 5188 C; 5443 G; 8945 T; 0 U; 0 Other;
Query Match 100.0%; Score 20; Length 28617;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGCTTTGCCAATGTTGTCCA 20
||||||||||||||||||||
Db 1626 AGCTTTGCCAATGTTGTCCA 1607
It would have been obvious to one of ordinary skill in the art at the time of the effective filing date of the claimed invention to have combined the teachings of Li et al in view of Hart with the teachings of Chen and Bare for the identification of macrohaplotypes via sequencing and amplification using known sequences found in STR regions as taught by Chen and Liu. One would have had a reasonable expectation of success given that the sequences have been described in previously published literature and used for amplification-based analyses. The ordinary artisan would have readily recognized that such modifications of the teachings of the combination of the cited prior art are within the ordinary artisan’s capabilities as evidence by the combined teachings of cited prior art.
Double Patenting
17. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
18. Claim 1 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of copending Application No. 18/263906 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because both the claim 1 of the instant invention and the claim 1 of 18/263906 are directed to a method for determining one or more nucleic acid contributors to a biological sample or specimen from nucleic acids obtained from single cells in the biological sample or specimen comprising the steps of: generating amplicons or obtaining a sequence of amplicons from cells in the biological sample, calculating from cells one or more nucleic acid contributors to the biological sample or specimen; comparing the one amplicons from the cells to a reference or known amplicon profile from a subject suspected of contributing nucleic acids to the biological sample or specimen; and identifying a number of contributors to the biological sample or specimen.
The claim 1 of the instant invention differs from the claim 1 of 18/263,906 in that the claim 1 vary slightly in wording. The claim 1 of copending application is broader in scope than the claim 1 of the instant invention as the claim do not recite limitation microhaplotype. However, the instant specification defines that mixture ratio of cells amplified to generate amplicons are the macrohaplotypes. Thus, the claim 1 of copending application 18/263906 falls entirely within the scope of the claim 1 of the instant invention.
As the court stated in In re Goodman, 29 USPQ2d 2010 (CAFC 1993), " a second application-- "containing a broader claim, more generical in its character than the specific claim in the prior patent"--typically cannot support an independent valid patent. Miller, 151, U.S. at 198; See Stanley, 214 F.2d at 153. Thus, the generic invention, as noted above is "anticipated" by the species of the patented invention. Cf., Titanium metal corp. v. Banner, 778 F.2d 775, 227 USPQ 773 (Fed. Cir. 1985) (holding that an earlier species disclosure in the prior art defeats any generic claims). This court's predecessor has held that, without a terminal disclaimer, the species claims preclude issuance of the generical application. "In re Van Ornum, 686 F.2d 937, 944, 214 USPQ 761, 767 (CCPA 1982); Schneller, 397 F.2d at 354". This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
19. No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CYNTHIA B WILDER whose telephone number is (571)272-0791. The examiner can normally be reached Flexible.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, GARY BENZION can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CYNTHIA B WILDER/Primary Examiner, Art Unit 1681
Prosecution Insights