DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s preliminary amendment filed on 01/03/2024 is acknowledged. Specification was amended to correct typographical errors in paragraphs ([0236] and [0258]), and claims were amended to reduce the number of claims and remove multiple dependencies.
Claims 3-27, 29, 31 and 32 have been amended.
Claims 33-47 have been cancelled.
Claims 1-32 are pending and under consideration.
Priority
The priorities claimed by this application from PCT Application No. PCT/JP2021/045184, filed on 12/08/2021, and a Japanese patent application(s) JAPAN 2021-157151, filed on 09/27/2021, and JAPAN 2020-203658, filed on 12/08/2020 are acknowledged.
Information Disclosure Statement
Receipt of the information disclosure statement(s) on 09/01/2023 and 07/03/2025 are acknowledged. The signed and initialed PTO-1449 form(s) have been mailed with this action.
Specification
The use of the term(s):
Primescript Reverse Transcriptase II [0271], [0280], [0312], [0333], [0420], [0450];
PrimeStar GXL DNA Polymerase [0271], [0272], [0274], [0280], [0289], [0308], [0312], [0330], [0333], [0420], [0432], [0440], [0443], [0450], [0451], [0455];
Mighty Mix [0271], [0273], [0308], [0330], [0432], [0440], [0450], [0451];
DH5α [0271], [0273], [0308], [0330], [0432], [0440], [0450], [0451];
QIAprep [0271], [0273], [0308], [0330], [0432], [0440], [0450], [0451];
AmpliScribe T7 [0274], [0308], [0432];
Lipofectamine 3000 [0279], [0288], [0332], [0454];
Sepasol RNA I Super G [0280], [0333], [0450];
BigDye Terminator v3.1 Cycle Sequence Kit [0280], [0289], [0308], [0312], [0330], [0333], [0420], [0440], [0443], [0450], [0451], [0455];
Stop&Glo [0282];
Applied Biosystems 3500 Genetic Anaylzer [0280], [0289], [0308], [0330], [0333], [0420], [0440], [0443], [0450], [0451], [0455];
NEBuffer2 [0308];
TritonX [0270], [0311];
RNeasy Plus Mini Kit [0420], [0443], [0455];
ReverTra Ace (even though it says (registered trademark) in a super script, a TM is appropriate) [0443], [0455];
Nivo multimode microplate reader (also known as VICTOR Nivo) [0458];
which are a trade name or a mark used in commerce, has been noted in this application. The term(s) should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
The disclosure is objected to because of the following informalities:
The title above paragraph [0136] reads, “Advantageous Effect of Invantion”. It would be remedial to edit “Invantion” to “Invention”.
Appropriate correction is required.
Claim Objections
Claim 28 is objected to because of the following informalities: instant claim 28 recites the limitation, “wherein an oligonucleotide composed of the tenth or subsequent nucleotide residues counted in the 3’- direction from the target corresponding nucleotide in the first oligonucleotide has a base sequence in which a 2’-O-alkyl ribonucleotide residue and a bridged nucleotide residue are alternately linked.” (bold added for emphasis). If the tenth nucleotide was chosen, it would not be feasible to have one nucleotide alternately linked. It would be remedial to change the “or” in this claim to “and” for clarity.
Claim 30 is objected to because of the following informalities: instant claim 30 recites the limitation, “wherein an oligonucleotide composed of the second or subsequent nucleotide residues counted in the 5’- direction from the nucleotide residue at the 3’-end of the second oligonucleotide has a base sequence in which a 2’-O-alkyl ribonucleotide residue and a bridged nucleotide residue are alternately linked.” (bold added for emphasis). If the second nucleotide was chosen, it would not be feasible to have one nucleotide alternately linked. It would be remedial to change the “or” in this claim to “and” for clarity.
Claim 31 is objected to because of the following informalities: Line 22 has two parentheses around “…^C(M)) (AD_GRIA2.52e)”. It would be remedial to remove the second parenthesis.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 3 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Instant claim 3 depends upon instant claim 1, which recites in lines 13-15, “the second oligonucleotide has no nucleotide residue corresponding to a nucleotide residue of the target RNA or has a nucleotide residue which does not form a complementary pair with a nucleotide residue of the target RNA, at the 3’ end thereof,” (bold added for emphasis). Instant claim 3 recites, “wherein the 3’-end of the second oligonucleotide has no nucleotide residue corresponding to a nucleotide residue of the target RNA.” By negatively limiting instant claim 1 to the 3’-end of the second oligonucleotide, this broadens the metes and bounds of instant claim 1 to also encompass the 5’-end, thus instant claim 3 is not further limiting.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 32 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 32 recites the broad recitation “…a phosphodiester bond”, and the claim also recites “… a phosphodiester bond (including a phosphorothioate bond)…”, which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1-11, 15, 18, 21-29, and 32 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Wettengel et al (US Patent Application US 2022/0073915 A1, effective filing date is 06/29/2018).
Regarding instant claim 1, Wettengel et al discloses an invention pertaining to artificial chemically-modified nucleic acids for site-directed editing of target RNA. More specifically, the artificial nucleic acid for site-directed editing contains:
(a) a targeting sequence (which reads on instant claim 1’s first oligonucleotide) comprising a nucleic acid sequence complementary or partially complementary to a target sequence in the target RNA (see Fig. 1A and paragraph [0009]);
(b) a recruiting moiety for recruiting a deaminase (which reads on the instant claim 1’s second oligonucleotide) (see Fig. 1A and paragraph [0016]);
(c) the recruiting moiety linked to the 5’-side of the targeting sequence (see Fig. 1A and [0076]);
(d) a target corresponding nucleotide is an adenosine residue (see Fig. 1A and paragraphs [0014] and [0015]);
(e) between 9 and 16 nucleotides linked to the 3’-side of the target corresponding nucleotide residue having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(f) six nucleotides linked to the 5’-side of the target corresponding nucleotide having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(g) no nucleotide residue corresponding to a nucleotide residue of the target RNA or has a nucleotide residue which does not form a complementary pair with a nucleotide residue of the target RNA, at the 3’end thereof (see Fig. 1A, Fig. 3B, Fig. 5A, and Fig. 5B);
(h) anywhere from 6 nucleotides to 200, with preferred embodiments of, “the artificial nucleic acid comprises at least about 15, preferably at least about 20, more preferably at least about 25, even more preferably at least about 30, even more preferably at least about 35, most preferably at least about 40, nucleotides. Alternatively, the length of the artificial nucleic acid is in the range from about 10 to about 200 nucleotides, preferably from about 15 to about 100 nucleotides, more preferably from about 15 to about 70 nucleotides, most preferably from about 20 to about 70 nucleotides.” (paragraph [0018]);
(i) forms a double-stranded structure complementary to the target RNA (see Fig. 1A and paragraph [0019]);
(j) a counter region (see Fig. 8e, Fig. 9b, Fig. 10A-B, and paragraphs [0161], [0164] [0193], [0199]);
(k) the nucleotide linked to the 3’-side of the target-corresponding nucleotide is a 2’-deoxynucleotide residue (see Fig. 10A and paragraph [0050]); and
(l) the third nucleotide in the 3’-direction from the target-corresponding nucleotide is 2'-deoxy-2'-fluoronucleotide (paragraphs [0025], [0026], and [0027] covering variants of nucleotides; and see Fig. 5A, Fig. 7b).
Regarding instant claim 2, Wettengel et al discloses that the length of the artificial nucleic acid is not limited and may include a “short” nucleic acid molecule of (e.g., a 6-mer or 10-mer), as well as longer oligonucleotides up to 200 nucleotides. With preferred embodiments of at least about 15, preferably at least about 20, more preferably at least about 25... (Paragraph [0018]). The minimum number of nucleotides recited in instant claim 1 is the sum of: 1 (target-corresponding nucleotide) + 10 (oligonucleotide linked to the 3’-side of the target corresponding nucleotide) + 3 (oligonucleotide linked to the 5’-side of the target corresponding nucleotide) + 2 (second oligonucleotide) equaling a minimum of 16 nucleotides claimed instant claim 1. Instant claim 2 limits the minimum of the second oligonucleotide to 4 to 8 residues. Therefore, the oligonucleotide claimed is either 18, 19, 20, 21, or 22 nucleotides. Thus, the preferred embodiments of Wettengel et al read on the limitations of instant claim 2.
Regarding instant claim 3, Wettengel et al discloses that the nucleotide 3’ of the recruiting moiety has no nucleotide residue corresponding to a nucleotide of the target RNA (see Fig. 1A, Fig. 3B, Fig. 5A, and Fig. 5B);
Regarding instant claim 4, Wettengel et al discloses that the artificial nucleotide is suitable for site-directed editing of an RNA by a deaminase. More specifically, Wettengel et al discloses preferably an ADAR enzyme selected from a group consisting of ADAR1, ADAR2, or a fragment thereof (Paragraph [0093]).
Regarding instant claim 5, Wettengel et al discloses that modifications can include an abasic site such as a 2’-O-methoxyethyl (Paragraph [0037]).
Regarding instant claim 6, Wettengel et al discloses, “Preferably, the targeting sequence of the artificial nucleic acid comprises at least one backbone modification, wherein a nucleotide comprises a modified phosphate group. The modified phosphate group is preferably selected from the group consisting of a phosphorothioate, a phosphoroselenate, a borano phosphate, a borano phosphate ester, a hydrogen phosphonate, a phosphoroamidate, an alkyl phosphonate, an aryl phosphonate and a phosphotriester, most preferably a phosphorothioate.” (Paragraph [0043]).
Regarding instant claim 7, Wettengel et al discloses, “According to a preferred embodiment, the targeting sequence comprises at least one chemically modified nucleotide, which is chemically modified at the 2′ position. Preferably, the chemically modified nucleotide comprises a substituent at the 2′ carbon atom, wherein the substituent is selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably from 2′-hydrogen (2′-deoxy), 2′-O-methyl, 2′-O-methoxyethyl and 2′-fluoro; and/or wherein the chemically modified nucleotide is selected from the group consisting of a locked nucleic acid (LNA) nucleotide, an ethylene bridged nucleic acid (ENA) nucleotide and an (S)-constrained ethyl cEt nucleotide.” (Paragraph [0042]).
Regarding instant claim 8, Wettengel et al discloses a phosphorothioate bond in the counter region (see Fig. 10A-B; paragraph [0164]).
Regarding instant claim 9, Wettengel et al discloses a phosphorothioate bond modification in the target-corresponding nucleotide (see Fig. 10A-B; paragraph [0164]).
Regarding instant claim 10, Wettengel et al discloses the following 2'-O-alkyl modifications: 2′-O-methyl-2′-deoxyadenosine, 2′-O-methyl-2′-deoxycytidine, 2′-O-methyl-2′-deoxyguanosine, 2′-O-methyl-2′-deoxyuridine, 2′-O-methyl-5-methyluridine, 2′-O-methylinosine, 2′-O-methylpseudouridine (paragraph [0027]). More specifically, Wettengel et al discloses modifications to the 5’-side of the target-corresponding nucleotide as a 2’-OMe in Fig. 6A and 6C, and Paragraph [0158].
Regarding instant claim 11, Wettengel et al discloses nucleotide modifications on the recruiting moiety (recruiting moiety reads on the second oligonucleotide) (paragraph [0024] and Fig. 1, Fig. 3B and, a Fig. 5B).
Regarding instant claim 15, Wettengel et al discloses nucleotide modifications of base sequences on the 5’-end of the target-corresponding residue being 2’-O-Methyl (See Fig. 1A, Fig. 3B, and Fig. 5B).
Regarding instant claim 18, Wettengel et al discloses nucleotide modifications of the recruiting moiety, wherein those modifications are 2’-O-Methyl (See Fig. 3B and Fig. 5B).
Regarding instant claim 22 and 23, Wettengel et al discloses, “Prior to the present invention, it was commonly believed in the field that the nucleotide at the position corresponding to the nucleotide to be edited as well as the two nucleotides flanking said nucleotide in the targeting sequence should not be modified. The excellent results obtained by the inventors when using artificial nucleic acids, wherein the nucleotide triplet opposite the target site comprises at least one chemically modified nucleotide as described herein, were thus all the more unexpected.”, (Paragraph [0048]). Fig. 6B and Fig. 10A-B of Wettengel et al discloses a 3’-side of the target -corresponding nucleotide as a 2’-deoxyadenosine or 2’-deoxyuridine residues unmodified.
Regarding instant claim 25, Wettengel et al discloses, the targeting sequence of the artificial nucleic acid comprises at the position corresponding to a nucleotide to be edited in the target sequence a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site (Paragraph [0064]).
Regarding instant claim 26, which is a product-by-process claim, and therefore reads on an oligonucleotide produced by any means that would provide the same structural characteristics of an oligonucleotide produced by the process recited in the claims (see MPEP § 2113). With regard to the structure implied by the process steps recited in the claim, the originally filed specification states, “In at least one residue, at least three residues, or all the residues in any
oligonucleotide residue (non-counter region) other than the counter region of the first oligonucleotide, at least one of the sugar moiety and the phosphodiester bond may be modified, at least the sugar moiety may be modified, at least the phosphodiester bond may be modified, or the sugar moiety and the phosphodiester bond may be modified.” (see paragraph [0204]). In view of this, the skilled artisan would conclude, absent any evidence to the contrary, that the oligonucleotide of instant claim 26 is the same as an artificial nucleic acid comprising, “…at least one chemically modified nucleotide, wherein the phosphate backbone, which is incorporated into the artificial nucleic acid molecule, is modified. The phosphate groups of the backbone can be modified, for example, by replacing one or more of the oxygen atoms with a different substituent. Further, the modified nucleotide can include the full replacement of an unmodified phosphate moiety with a modified phosphate as described herein. Examples of modified phosphate groups include, but are not limited to, the group consisting of a phosphorothioate…”, as disclosed by Wettengel et al in paragraph [0036].
Regarding instant claim 27, Wettengel et al discloses various modifications in formulae that include a bridged nucleotide in the tenth or subsequent nucleotide resides counted in the 3’- direction from the target-corresponding nucleotide (Paragraph [0057] and formulae d-g, i, and k).
Regarding instant claim 28, Wettengel et al discloses various modifications in formulae that include a nucleotide modification and a bridged nucleotide in the tenth or subsequent nucleotide resides counted in the 3’- direction from the target-corresponding nucleotide alternately linked (Paragraph [0057] and formulae g, i, and k).
Regarding instant claim 29, Wettengel et al discloses an oligonucleotide that contains a bridged nucleotide residue in subsequent residues counted in the 5’ direction of the 3’ end (See Fig. 5B – ASO v25.4 and ASO v25.5).
Regarding instant claim 32, Wettengel et al discloses, “In some embodiments, the artificial nucleic acid comprises a moiety, which enhances cellular uptake of the artificial nucleic acid. Preferably, the moiety enhancing cellular uptake is a triantennary N-acetyl galactosamine (GalNAc3), which is preferably conjugated with the 3′ terminus or with the 5′ terminus of the artificial nucleic acid.” see paragraph [0017].
Therefore, claim(s) 1-11, 15, 18, 22-23, 25-29, and 32 in the instant application are anticipated by Wettengel et al.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim(s) 12-14, 16-17, 19-20, 30, and 31 are rejected under 35 U.S.C. 103 as being obvious over Wettengel et al (US Patent Application US 2022/0073915 A1, effective filing date is 06/29/2018) in view of Shen et al (Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs, Nucleic Acids Research, Vol. 46, Issue 4, Pages 1584-1600, 2017).
The teachings of Wettengel et al are described above and applied as before.
Regarding instant claim(s) 12-14, and 16-17, Wettengel et al discloses a targeting sequence (which reads on instant claim 1’s first oligonucleotide and the nucleotides extending 5’ and 3’, not including the recruiting moiety that reads on the second oligonucleotide), with nucleotides that could be any combination of chemical modifications to the nucleotide bases, see Fig. 5A and paragraphs [0023], [0024], and [0027] for the specific modifications.
Wettengel et al does not disclose modifications of 2’-deoxy-2’fluoro and 2’-O-alkyl ribonucleotides (instant claims 12 and 17) and/or bridged nucleotide residue and 2’-O-alkyl ribonucleotide (instant claim 13 and 16), and/or a 2’-deoxy-2’fluoro and bridged nucleotide residue (instant claim 14) alternately linked on the 3’ (instant claims 12-14) or 5’ (instant claims 16 and 17) side of the target-corresponding nucleotide residue.
Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues on to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
Shen et al also teaches that there are current drugs on the market such as Inclisiran (includes one deoxyribose), Revusiran, Firusiran, and Givosiran that contain both 2’O-methyl and 2’Fluro modifications (Figure 6).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide in Fig. 5A of Wettengel et al with the teachings of Shen et al to arrive at (instant claim 12 and 17) a base sequence of alternately linked 2’-O-Me and 2’-Fluoro, and/or (instant claim 13 and 16) 2’-O-Me and bridged nucleotide modifications, and/or (instant claim 14) 2’-Fluoro and bridged nucleotide modifications, on the 3’ (instant claims 12-14) or 5’(instant claims 16 and 17) side of the target-corresponding nucleotide residue for the purpose of increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing.
Regarding instant claim 19 and 20, Wettengel et al discloses a recruiting moiety (which reads on instant claim 1’s second oligonucleotide), with nucleotides that could be any combination of chemical modifications to the nucleotide bases, see Fig. 1A (ASO v9.5), Fig. 3B (ASO v9.5 and ASO v25), and Fig. 5B (ASO v25.3-5) and paragraphs [0078], [0079], and [0080].
Wettengel et al does not disclose modifications of a bridged nucleotide residue and 2’-O-alkyl ribonucleotide (instant claim 19) and/or 2’-deoxy-2’fluoro and 2’-O-alkyl ribonucleotides (instant claim 20) alternately linked in the recruiting moiety (i.e., the second oligonucleotide).
Shen et al teaches that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify any of the oligonucleotides in Fig. 1A (ASO v9.5), Fig. 3B (ASO v9.5 orASO v25), or Fig. 5B (ASO v25.3-5), with the teachings of Shen et al to arrive at (instant claim 19) a base sequence of alternately linked 2’-O-Me and bridged nucleotide modifications, and/or (instant claim 20) 2’-O-Me and 2’-Fluoro, in the second oligonucleotide for the purpose of increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing.
Regarding instant claim 30, which further limits instant claim 29, wherein Wettengel et al discloses that the recruiting moiety (which reads on instant claim 1’s second oligonucleotide) contains a bridged nucleotide residue in subsequent residues counted in the 5’ direction of the 3’ end (See Fig. 5B – ASO v25.4 and ASO v25.5). Wettengel et al also discloses that the recruiting moiety could contain any combination of chemical modifications to the nucleotide bases, see Fig. 1A (ASO v9.5), Fig. 3B (ASO v9.5 and ASO v25), and Fig. 5B (ASO v25.3-5) and paragraphs [0078], [0079], and [0080].
Wettengel et al does not disclose modifications of a bridged nucleotide residue and 2’-O-alkyl ribonucleotide alternately linked in the recruiting moiety (i.e., the second oligonucleotide) at the second or subsequent nucleotide residue counted in the 5’-direction from the nucleotide residue at the 3’ end of the recruiting moiety.
Shen et al teaches that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify any of the oligonucleotides Fig. 5B (ASO v25.3-5), with the teachings of Shen et al to arrive at (instant claim 30) a base sequence of alternately linked 2’-O-Me and bridged nucleotide modifications in the second oligonucleotide at the second or subsequent nucleotide residue counted in the 5’-direction from the nucleotide residue at the 3’ end for the purpose of increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing.
Regarding instant claim 31, Wettengel et al discloses, “The inventors have found that the artificial nucleic acid is suitable for editing a wide variety of transcripts, e.g. endogenous mRNAs of housekeeping genes as well as endogenous transcripts of disease-related genes (such as STAT1 or SERPINA1).”, (Paragraph [0012]). Wettengel et al discloses designing oligonucleotides with modifications for targeting the E342K mutation in the SERPINA1 gene (see Paragraphs [0192] and [0193]). The E342K mutation (amino acid) corresponds to the G1096A substitution (nucleotide) in SERPIN1A, which is one of the gene targets by the instant claimed invention. More specifically, Wettengel et al discloses three sequences, SEQ ID NO: 80-82, encompassing oligonucleotide(s) with the following modifications: 2’-O-Methyl RNA base, LNA base, and phosphorothioate linkages that teach on the instant claimed AD_A1AT.39 formula.
The most relevant sequence to the instant application is Wettengel et al’s SEQ ID NO: 80 with the following formula: (CAUGGCCCCAGCAGCUUCAGUC)[C]{C}[UUUC](UCG)[UCGA]{T*}[G*][G*]{T*}[C]; wherein (N) represents RNA base, [N] represents 2’-OMe RNA base, * represents phosphorothioate linkage, and {N} represents LNA Base (see Table 1 on Page 29-30).
The instant specification discloses that “The A1AT (also referred to as “SERPINA1A”) gene sequence here used contains the 1129-th to 1153-th base sequences from GenBank accession no. NM_000295.5, and furthermore contains the mutations (rs28929474) of nucleoside, called c.1096G>A (see paragraph [0447] of instant specification).
The DNA sequence from NM_000295.5 is the following:
5’ G-C-T-G-A-C-C-A-T-C-G-A-C-G-A-G-A-A-A-G-G-G-A-C 3’
The mRNA sequence of E342K mutation is the following:
5’ C-G-U-G-A-C-C-A-U-C-G-A-C-A-A-G-A-A-A-G-G-G-A-C 3’, (wherein the bolded and underlined A is the 1096G>A substitution that causes the E342K mutation, also referred to as Z-A1AT as taught by the instant specification at [0449]).
The forward primer used to clone the G1096A mutation in the instant application can be found on page 147, paragraph [0452]:
5’ G-A-C-C-A-T-C-G-A-C-A-A-G-A-A-A-G-G-G-A-C 3’
The transcribed mRNA from this is forward primer is:
3’ C-U-G-G-U-A-G-C-U-C-U-U-C-U-U-U-C-C-C-U-G 5’
Or also,
5’ G-U-C-C-C-U-U-U-C-U-U-C-U-C-G-A-U-G-G-U-C 3’
The instant applications claimed oligonucleotide, referenced as AD_A1AT.39, reads on a slightly modified version of the transcribed 5’ primer. Without the modifications for clarity sake, the oligonucleotide is the following:
5’ G-T-C-C-C-U-U-C-U-(ci)-U-C-G-A-U-G-G-U-C-A-G-C-A 3’
Differences in the oligonucleotide of the claimed formula versus the 5’ transcribed mRNA are the following: (A) the second nucleotide from the 5’ end is a T instead of a U; (B) the U that is eight positions from the 5’ end has been removed; and (C) A-G-C-A has been added to the 3’ end. Upon comparison of AD_A1AT.39 of instant claim 31 to SEQ ID NO:80 (nucleotides #20-40) of Wettengel et al, almost all of the base sequences of the nucleotides are conserved except the following: (a) SEQ ID NO: 80 retains the second nucleotide from the 5’ end, U, from the mRNA sequence, while the T in AD_A1AT.39 could also represent a locked U; (b) SEQ ID NO: 80 retains the eighth nucleotide from the 5’ end, U, from the mRNA sequence, while AD_A1AT.39 lacks it; (c) SEQ ID NO: 80 contains T’s in the 17th and 20th position from the 5’ end (as depicted below) and a locked C at position five from the 5’ end; (d) SEQ ID NO:80 does not contain A-G-C-A at the 3’ end; (e) SEQ ID NO: 80 only contains 2’-O-methyl base modifications (independent of the locked nucleic acid modifications mentioned above in a/c/d), whereas AD1_A1AT.39 contains mixed modifications of 2’-O-methyl and 2’-Fluoro; and (f) SEQ ID NO: 80 only contains four phosphorothioate linkages in the backbone, while backbone linkages in AD1_A1AT.39 are all phosphorothioate.
For ease of comparison, modification legends have been translated between both the instant application and Wettengel et al, wherein [N] represents a 2’-O-methyl, {N} represents a 2’-O, 4’-C-methyl or a Locked Nucleic Acid, <N> represents 2’-fluoro, and * represents a phosphorothioate bond.
Nucleotide # counted from 5’ end
1
2
3
4
5
6
7
8
9
10
11
12
AD_A1AT.39
Nucleotide #1-20
[G*]
{T*}
[C*]
{C*}
[C*]
<U*>
<U*>
[C*]
[U*]
(C*)
(I*)
SEQ ID NO:80
Nucleotide #20-40
(G)
(U)
(C)
[C]
{C}
[U]
[U]
[U]
[C]
(U)
(C)
(G)
Nucleotide # counted from 5’ end
13
14
15
16
17
18
19
20
21
AD_A1AT.39
Nucleotide #1-20
[U*]
<C*>
[G*]
<A*>
[U*]
<G*>
[G*]
<U*>
[C*]
SEQ ID NO:80
Nucleotide #20-40
[U]
[C]
[G]
[A]
{T*}
[G*]
[G*]
{T*}
[C]
Nucleotide # counted from 5’ end
22
23
24
25
AD_A1AT.39
Nucleotide #1-20
{A*}
[G*]
{C*}
[A*]
SEQ ID NO:80
Nucleotide #20-40
Despite SEQ ID NO:80 from Wettengel et al and AD1_A1AT.39 of the instant application containing 16 out of 20 base matches (wherein three mismatches are modified T’s as LNAs versus U’s) as well as many of the same modifications, Wettengel et al does not fully teach the formulae and modifications of AD1_A1AT.39 claimed in instant claim 31.
Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
More specifically, Shen et al teaches that the phosphorothioate modification is the most widely used single alteration in nucleic acid drug development, and that it serves two purposes: (1) to increase stability toward digestion to nucleases, and (2) increase binding to serum proteins (Page 1585, Column 1, Paragraph 3). Shen et al continues on to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
Shen et al also teaches that there are current drugs on the market such as Inclisiran (includes one deoxyribose), Revusiran, Firusiran, and Givosiran that contain both 2’O-methyl and 2’Fluro modifications (Figure 6). As well as Miravirsen contains all phosphorothioate linkages and contains locked nucleic acids (Figure 6).
Thus, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide of SEQ ID NO: 80 of Wettengel et al with the teachings of Shen et al to arrive at the formula of AD1_A1AT.39.
More specifically:
(a/c) There are four occurrences between SEQ ID NO: 80 of Wettengel et al and the instant claimed AD1_A1AT.39 where (1) a locked T is in the second position to the 5’ end of AD1_A1AT.39 where there is a U in SEQ ID NO: 80; (2) a locked U is in the fifth position from the 5’ end of SEQ ID NO: 80, where there is a U in AD1_A1AT.39; (3) a locked T is in the 17th position to the 5’ end of SEQ ID NO: 80 where there is a U modified as a 2’-O-methyl in AD1_A1AT.39; and (4) a locked T is in the 20th position to the 5’ end of SEQ ID NO: 80, where there is a U modified as a 2’-O-methyl in AD1_A1AT.39. Shen et al teaches that 2’-O, 4’-C-methylenated modifications (i.e., locked nucleic acids or bridged) are an especially useful type of modification for increasing the strength of hybridization and reducing the entropic price paid during Watson–Crick base-pairing. Thus, it would have been obvious to one of ordinary still in the art before the effective filing date to modify the nucleic acids within both the 5’ and 3’ regions of the SEQ ID NO: 80 of Wettengel et al with the locked nucleic acid teachings of Shen et al to arrive at the predictable oligonucleotide AD1_A1AT.39 for the purposes of increased hybridization strength and reduced entropic price.
(b) SEQ ID NO: 80 of Wettengel et al retains the U from the mRNA sequence at the 8th position from the 5’ end. The instant specification lacks description as to why said nucleic acid was removed during the process of creating the oligonucleotide. In paragraph [0447] of the instant specification, the only alteration to NM_000295.5 disclosed is the mutation rs28929474, which is accounted for in the primer design of the instant specification at paragraph [0452], whereas the removal of the U in the 8th position from the 5’ side of the primer is not accounted for, and is still present (see primer above). Thus, the lack of U at the 8th position from the 5’ side does not have a justified reason by the Applicant and cannot be considered a modification for the purposes of improvement or differentiation over SEQ ID NO: 80 of Wettengel et al.
(d) AD1_A1AT.39 contains four additional nucleic acids at the 3’ end of the oligonucleotide, A-G-C-A, wherein the A that is four positions in from the 3’ end and the C that is two positions in from the 3’ are both locked nucleic acids. As mentioned above in (a/c) Wettengel et al’s SEQ ID NO: 80 contains locked nucleic acids at positions two and five from the 3’ end and the fifth position from the 5’ end. Thus, it would have been obvious to incorporate two locked nucleic acids onto AD_A1AT.39 within five base pairs of the 3’ end for purpose of nuclease protection as taught by increasing the strength of hybridization and reducing the entropic price paid during Watson–Crick base-pairing and disclosed by Wettengel et al.
(e) AD1_A1AT.39 contains mixed modifications of 2’-O-methyl and 2’-Fluoro, whereas SEQ ID NO: 80 only contains 2’-O-methyl modifications (independent of the locked nucleic acid modifications mentioned above in a/c/d). It would have been obvious to one of ordinary skill in the art before the effective filing date to try the mixed modifications on an oligonucleotide designed for therapeutic relief (e.g., SERPINA1 mutation) as taught by Shen et a on SEQ ID NO: 80 of Wettengel et al to yield the predictable result of increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increasing the thermal stability of complementary hybridization.
(f) AD1_A1AT.39 contains all phosphorothioate linkages in the backbone, while SEQ ID NO: 80 only contains four. It would have been obvious to one of skill in the art before the effective filing date to replace all of the backbone linkages of SEQ ID NO:80 with phosphorothioate linkages as taught by Shen et al to yield the predictable results of increasing stability toward digestion to nucleases, and increasing binding to serum proteins.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide SEQ ID NO:80 of Wettengel et al with the teachings of Shen et al for the purpose of (1) increasing the strength of hybridization, (2) reducing the entropic price paid during Watson–Crick base-pairing, (3) increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, (4) increasing the thermal stability of complementary hybridization, and (5) increasing binding to serum proteins, when modifying 1096G>A of the SERPINA1 gene with endogenous ADAR to correct alpha-1 antitrypsin deficiency.
Claim(s) 12-14, 16-17, 19-20, 30, and 31 in the instant application are obvious over Wettengel et al in view of Shen et al.
Claim(s) 21 and 24 are rejected under 35 U.S.C. 103 as being obvious over Wettengel et al (US Patent Application US 2022/0073915 A1, effective filing date is 06/29/2018) in view of Watkins et al (Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes, Nucleic Acids Research, Vol 33, Issue 19, Pages 6258-6267, 2005) in further view of Wright et al (Stability of RNA duplexes containing inosine/cytosine pairs, Nucleic Acids Research, Vol 46, Issue 22, Pages 12099-12108, 2018).
The teachings of Wettengel et al are described above and applied as before.
Wettengel et al teaches, in Fig. 6B and Fig. 8e that on the 5’ side of the nucleic acid to be modified, a cytosine is in that place. Fig. 8e discloses that on the 5’ side of the nucleic acid to be modified, a guanosine is in that place. Wettengel et al also discloses a guanosine that is 3’ to the target-corresponding nucleic acid in Fig. 6B.
Wettengel et al does not explicitly teach an inosine located on the 3’ side of the target-corresponding nucleic acid.
Watkins et al discloses performing nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes (Abstract). More specifically, Watkins et al demonstrates that, “The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5’ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3’ of I·X is the same.”, (Abstract). Watkins et al suggests that, “The most common application of inosine is in the determination of a mRNA sequence using degenerate hybridization probes…The inosine thermodynamic parameters presented here enable a more accurate design of primers and probes to protein coding regions, or other templates with ambiguous sequences…. Inosine may also be substituted in difficult guanine rich PCR primers to reduce G-quartet formation as well as primer–dimer artifacts.”, (Page 6258, Column 2, Paragraphs 1 and 2). Watkins et al teaches deoxyinosine 3’ of a cytosine (reading on the target corresponding nucleic acid) in Table 4, rows 1 and 2, and Table 5, probes 1, 7, 8, and 18. Where inosine occurs 3’ in the dimer the stabilities are: AI/IA>> CI/IC > TI/ IT >> GI/IG (Page 6265, Column 1, Paragraph 2).
Watkins et al does not teach deoxyinosine in an RNA duplex.
Wright et al discloses performing optical melting experiments on a series of RNA duplexes containing I·C pairs, namely to derive nearest neighbor parameters for a single I·C pair adject to Watson-Crick pairs (Page 12100, Column 2, Paragraph 1). Wright et al teaches that because inosine is the same as guanosine but without the exocyclic amino group, inosine tends to behave as guanosine (Page 12099, Column 1, paragraph 1). Wright et al suggests that because of inosine’s promiscuity, it can be used in an oligonucleotide probe when the exact sequence of the nucleic acid target is unknown. Probes containing deoxyinosine have been used to screen high complexity genomic DNA and cDNA libraries.”, (Page 12099, Column 2, Paragraph 3). More specifically, Wright et al demonstrates that, “The I·C nearest neighbor combinations in every duplex in this study had a stabilizing effect on duplex thermodynamics. This was true for single internal I·C pairs, terminal I·C pairs, and tandem I·C pairs.”, (Page 12102, Column 2, Paragraph 2). Lastly, Wright et al suggests that, “Scientists can use these new nearest neighbor parameters to calculate the stability of ADAR products and to calculate the stability of an RNA duplex in which G-to-I substitution was used to determine the role of the exocyclic amino group of G.”, (Page 12106, Column 2, Paragraph 1).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention (regarding instant claim 21 and 24) to substitute the guanosine at the 3’ location in relation to the target-corresponding nucleic acid in Wettengel et al (in Fig. 8e), with a 2’-deoxyinosine as taught by Watkins et al, for constructing degenerate oligonucleotide probes when an mRNA or nucleic acid target is unknown, as taught by both Watkins et al and Wright et al. One would be motivated to make such a substitution in an oligonucleotide made up of mostly ribonucleic acids due to inosine’s promiscuity, tendency to behave as guanosine, and nearest neighbor contributions (as taught by Watkins et al and Wright et al) for the benefit of increasing stability of RNA duplexes.
Thus, instant claim(s) 21 and 24 are obvious over Wettengel et al in view of Watkins et al in further view of Wright et al.
Conclusion
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure:
Vogel et al (Improving Site-Directed RNA editing In Vitro and in Cell Culture by Chemical Modification of the GuideRNA, 2014, Agnew. Chem. Int. Ed. Vol 53, Pages 6267-6271) teaches that oligonucleotides are often modified at the ribose backbone with 2’-O-methyl groups and terminal phosphothioate groups in combination with cholesterol (Pages 6267, Column 2, Paragraph 3). Vogel et al teaches the recruitment of ADAR1 to the oligonucleotide for direct RNA editing (Page 6267, Column 1, Paragraph 2). Vogel et al further teaches that chemical modifications at select sites can improve pharmacokinetics, target selectivity, toxicity, and immunogenicity. These modifications include 2’-O-methyl, 2’-fluorine, and LNA (Page 6268, Column 1, Paragraph 2).
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637