DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim(s) 1-11, 13-18, 20-32, and 48 are pending and under consideration.
Status of the claim(s): In the reply filed 06/22/2026, (a) claim(s) 12 and 19 were cancelled, (b) claim(s) 1, 3, 28, 30, 31, and 32 were amended, and (c) claim 48 was added.
Applicant’s arguments filed 06/22/2026 have been thoroughly reviewed, but are not persuasive for the reasons that follow. Any rejections and objections not reiterated in this action have been withdrawn. This action is NON-FINAL.
Priority
The priorities claimed by this application from PCT Application No. PCT/JP2021/045184, filed on 12/08/2021, and a Japanese patent application(s) JAPAN 2021-157151, filed on 09/27/2021, and JAPAN 2020-203658, filed on 12/08/2020 are acknowledged.
Specification
The substitute specification filed 06/22/2026 has not been entered because it does not conform to 37 CFR 1.125(b) and (c) because: the statement as to a lack of new matter under 37 CFR 1.125(b) is missing.
Abstract – New
The abstract of the disclosure is objected to because it contains over 150 words. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Minor informalities – New objection
The disclosure is objected to because of the following informalities: paragraph [0092]
line 1 recites “any one of claims 40 to 43.” Claims get amended to recite different
limitations as well as depend from other claims. It would be remedial to amend “claims”
to recite “embodiments”.
Appropriate correction is required.
Response to Arguments – Specification
Due to the substitute specification not being entered, because it does not conform to 37 CFR 1.125(b) and (c) regarding the missing statement as to a lack of new matter under 37 CFR 1.125(b), the previous objections to the specification filed in the Office action mailed 01/22/2026 are maintained.
The previous objection to the specification for minor informalities, i.e., miss-spelling of invention, has been maintained in view of Applicant’s amendments filed 06/22/2026.
The previous objection to the specification for containing the following trademarks below has been maintained in view of Applicant’s amendments filed 06/22/2026.
Primescript Reverse Transcriptase II [0271], [0280], [0312], [0333], [0420], [0450];
PrimeStar GXL DNA Polymerase [0271], [0272], [0274], [0280], [0289], [0308], [0312], [0330], [0333], [0420], [0432], [0440], [0443], [0450], [0451], [0455];
Mighty Mix [0271], [0273], [0308], [0330], [0432], [0440], [0450], [0451];
DH5α [0271], [0273], [0308], [0330], [0432], [0440], [0450], [0451];
QIAprep [0271], [0273], [0308], [0330], [0432], [0440], [0450], [0451];
AmpliScribe T7 [0274], [0308], [0432];
Lipofectamine 3000 [0279], [0288], [0332], [0454];
Sepasol RNA I Super G [0280], [0333], [0450];
BigDye Terminator v3.1 Cycle Sequence Kit [0280], [0289], [0308], [0312], [0330], [0333], [0420], [0440], [0443], [0450], [0451], [0455];
Stop&Glo [0282];
Applied Biosystems 3500 Genetic Anaylzer [0280], [0289], [0308], [0330], [0333], [0420], [0440], [0443], [0450], [0451], [0455];
NEBuffer2 [0308];
TritonX [0270] and [0311] (at line 7 and 11);
RNeasy Plus Mini Kit [0420], [0443], [0455];
ReverTra Ace (even though it says (registered trademark) in a super script, a TM is appropriate) [0443], [0455];
Nivo multimode microplate reader (also known as VICTOR Nivo) [0458].
Response to Arguments – Claim Objections
The previous objection to claim 28 for “the tenth or subsequent nucleotide”, in which Applicant amended to an “and” is moot in view of the amendment to claim 1 filed 06/22/2026 reciting modifications that “alternately link”.
The previous objection to claim 30 for “the second or subsequent nucleotide”, in which
Applicant amended to an “and”, is moot in view of the amendment to claim 1 filed 06/22/2026 reciting modifications that “alternately link”.
The previous objection to claim 31 for the second parenthesis in line 22 around
“…^C(M)) (AD_GRIA2.52e)”, has been withdrawn in view of Applicant’s amendments filed 06/22/2026.
Claim Rejections - 35 USC § 112(b) – Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 1-11, 13-18, 20-32, and 48 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new rejection that is necessitated by amendment to the claims in the reply filed on 06/22/2026.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 1 recites the broad recitation “the nucleotide residue linked to the 3’-side of the target corresponding nucleotide residue is a 2’-deoxynucleotide residue” in lines 22-23, and the claim also recites “the oligonucleotide linked to the 3’-side of the target-corresponding nucleotide residue has a base sequence in which a 2’-deoxy-2’-fluoronucleotide residue and a 2’-O-alkyl ribonucleotide residue are alternately linked. . .” in lines 29-31 which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Accordingly, claim(s) 2-11, 13-18, 20-32, and 48 are rejected for being dependent
upon claim 1.
Response to Arguments – Claim Rejections - 35 USC § 112(b) – Indefiniteness
The previous rejection of claim 32 under 35 U.S.C 112(b) for reciting “recites “… a phosphodiester bond (including a phosphorothioate bond) …” has been withdrawn in view of Applicant’s amendments to the claims filed 06/22/2026.
Claim Rejections - 35 USC § 112(d) – Improper Claim Dependency
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 3 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This rejection was made in the Office action dated 01/22/2026 and has been rewritten to address the amendment to the claims in the reply filed on 06/22/2026.
Claim 3 depends upon claim 1. Claim 1 recites in lines 14-16:
“the second oligonucleotide has no nucleotide residue corresponding to a nucleotide residue of the target RNA or has a nucleotide residue which does not form a complementary pair with a nucleotide residue of the target RNA, at the 3’ end thereof,” (bold added for emphasis).
Claim 3 recites, “wherein the second oligonucleotide has no nucleotide residue corresponding to a nucleotide residue of the target RNA at the 3’-end thereof.”
The removal of “3’-end of” in line 2 and the addition of “at the 3’-end thereof” in line 3 does not change the scope of amended claim 3 or further limit the structure of the oligonucleotide of claim 1. By negatively limiting claim 1 to the 3’-end of the second oligonucleotide, this broadens the metes and bounds of claim 1 to also encompass the 5’-end.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim(s) 13-14 and 20 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This is a new rejection necessitated by the amendment to the claims in the reply filed on 06/22/2026.
Of note, claim 1 was amended in the reply filed 06/22/2026 to incorporate the limitations of now cancelled claim(s) 12 and 19 (underlined) which recite:
“An oligonucleotide, or a pharmaceutically acceptable salt thereof, comprising: a first oligonucleotide identifying a target RNA; and a second oligonucleotide linked to the 5'-side of the first oligonucleotide, wherein the first oligonucleotide consists of a target-corresponding nucleotide residue corresponding to an adenosine residue in the target RNA, an oligonucleotide of 10 to 24 residues, linked to the 3'-side of the target- corresponding nucleotide residue and having a base sequence complementary to the target RNA, an dan oligonucleotide of 3 to 6 residues, linked to the 5'-side of the target- corresponding nucleotide residue and having a base sequence complementary to the target RNA, . . . the oligonucleotide linked to the 3'-side of the target-corresponding nucleotide residue has a base sequence in which a 2'-deoxy-2'-fluoronucleotide residue and a 2'-O-alkyl ribonucleotide residue are alternately linked, and the second oligonucleotide has a base sequence in which a 2'-O-alkyl ribonucleotide residue and a bridged nucleotide residue are alternately linked.”
Claim 13 recites, “wherein the oligonucleotide linked to the 3'-side of the target- corresponding nucleotide residue has a base sequence in which a bridged nucleotide residue and a 2'-O-alkyl ribonucleotide residue are alternately linked.” Claim 14 recites, “wherein the oligonucleotide linked to the 3'-side of the target- corresponding nucleotide residue has a base sequence in which a 2'-deoxy-2'-fluoronucleotide residue and a bridged nucleotide residue are alternately linked.” These dependent claim(s) set forth substitutions that do not further limit claim 1 (regarding the limitations incorporated into claim 1 that were set forth in now cancelled claim 12).
Claim 20 recites, “wherein the second oligonucleotide has a base sequence in which a 2'-O-alkyl ribonucleotide residue and a 2'-deoxy-2'-fluoronucleotide residue are alternately linked.” Claim 20 sets forth substitutions that do not further limit claim 1 (regarding the limitations incorporated into claim 1 that were set forth in now cancelled claim 19).
Response to Arguments - Claim Rejections - 35 USC § 112(d) – Improper Claim Dependency
The previous rejection of claim 3 under 35 U.S.C 112(d) for improper claim dependency has been maintained in view of Applicant’s amendments of the claim filed 06/22/2026.
Applicant's arguments filed 06/22/2026 have been fully considered but they are not persuasive.
The response asserts that the amendment to claim 3 obviates the rejection by reciting that the second oligonucleotide has no nucleotide residue corresponding to a nucleotide residue of the target RNA at the 3’ end thereof.
Merely moving “3’-end” to the end of the claim, and adding “thereof” to recite, “. . . wherein the second oligonucleotide has no nucleotide residue corresponding to a nucleotide residue of the target RNA at the 3’-end thereof.”, does not overcome the improper claim dependency. See above for the re-written claim 3 rejection under 35 U.S.C 112(d) for improper claim dependency.
Response to Arguments - Claim Rejections - 35 USC § 102
The rejection of claim(s) 1-11, 15, 18, 22-23, 25-29, and 32 under 35 U.S.C. 102 (a)(2) as being anticipated by Wettengel et al (US Patent Application US 2022/0073915 A1, effective filing date is 06/29/2018) has been withdrawn in view of Applicant’s amendments filed on 06/22/2026.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim(s) 1-11, 15-18, 22-23, 25-32, and 48 are rejected under 35 U.S.C. 103 as being unpatentable over Wettengel et al (US Patent Application US 2022/0073915 A1, effective filing date is 06/29/2018; cited on PTO 892 filed 01/22/2026) in view of Prakash et al (WO 2015/168618 A2; published November 5th, 2015; pages 1-100) and Shen et al (Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs, Nucleic Acids Research, Vol. 46, Issue 4, Pages 1584-1600, 2017; cited on PTO 892 filed 01/22/2026). This is a new rejection that is necessitated by amendment to the claims in the reply filed on 06/22/2026.
Regarding claim 1, Wettengel et al discloses an invention pertaining to artificial chemically-modified nucleic acids for site-directed editing of target RNA. More specifically, the artificial nucleic acid for site-directed editing contains:
(a) a targeting sequence (which reads on claim 1’s first oligonucleotide) comprising a nucleic acid sequence complementary or partially complementary to a target sequence in the target RNA (see Fig. 1A and paragraph [0009]);
(b) a recruiting moiety for recruiting a deaminase (which reads on the claim 1’s second oligonucleotide) (see Fig. 1A and paragraph [0016]);
(c) the recruiting moiety linked to the 5’-side of the targeting sequence (see Fig. 1A and [0076]);
(d) a target corresponding nucleotide is an adenosine residue (see Fig. 1A and paragraphs [0014] and [0015]);
(e) between 9 and 16 nucleotides linked to the 3’-side of the target corresponding nucleotide residue having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(f) six nucleotides linked to the 5’-side of the target corresponding nucleotide having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(g) no nucleotide residue corresponding to a nucleotide residue of the target RNA or has a nucleotide residue which does not form a complementary pair with a nucleotide residue of the target RNA, at the 3’end thereof (see Fig. 1A, Fig. 3B, Fig. 5A, and Fig. 5B);
(h) anywhere from 6 nucleotides to 200, with preferred embodiments of, “the artificial nucleic acid comprises at least about 15, preferably at least about 20, more preferably at least about 25, even more preferably at least about 30, even more preferably at least about 35, most preferably at least about 40, nucleotides. Alternatively, the length of the artificial nucleic acid is in the range from about 10 to about 200 nucleotides, preferably from about 15 to about 100 nucleotides, more preferably from about 15 to about 70 nucleotides, most preferably from about 20 to about 70 nucleotides.” (paragraph [0018]);
(i) forms a double-stranded structure complementary to the target RNA (see Fig. 1A and paragraph [0019]);
(j) a counter region (see Fig. 8e, Fig. 9b, Fig. 10A-B, and paragraphs [0161], [0164] [0193], [0199]);
(k) the nucleotide linked to the 3’-side of the target-corresponding nucleotide is a 2’-deoxynucleotide residue (see Fig. 10A and paragraph [0050]); and
(l) the third nucleotide in the 3’-direction from the target-corresponding nucleotide is 2'-deoxy-2'-fluoronucleotide (paragraphs [0025], [0026], and [0027] covering variants of nucleotides; and see Fig. 5A, Fig. 7b).
Regarding claim 2, Wettengel et al discloses that the length of the artificial nucleic acid is not limited and may include a “short” nucleic acid molecule of (e.g., a 6-mer or 10-mer), as well as longer oligonucleotides up to 200 nucleotides. With preferred embodiments of at least about 15, preferably at least about 20, more preferably at least about 25... (Paragraph [0018]). The minimum number of nucleotides recited in claim 1 is the sum of: 1 (target-corresponding nucleotide) + 10 (oligonucleotide linked to the 3’-side of the target corresponding nucleotide) + 3 (oligonucleotide linked to the 5’-side of the target corresponding nucleotide) + 2 (second oligonucleotide) equaling a minimum of 16 nucleotides claimed claim 1. Claim 2 limits the minimum of the second oligonucleotide to 4 to 8 residues. Therefore, the oligonucleotide claimed is either 18, 19, 20, 21, or 22 nucleotides. Thus, the preferred embodiments of Wettengel et al read on the limitations of claim 2.
Regarding claim 3, Wettengel et al discloses that the nucleotide 3’ of the recruiting moiety has no nucleotide residue corresponding to a nucleotide of the target RNA (see Fig. 1A, Fig. 3B, Fig. 5A, and Fig. 5B);
Regarding claim 4, Wettengel et al discloses that the artificial nucleotide is suitable for site-directed editing of an RNA by a deaminase. More specifically, Wettengel et al discloses preferably an ADAR enzyme selected from a group consisting of ADAR1, ADAR2, or a fragment thereof (Paragraph [0093]).
Regarding claim 5, Wettengel et al discloses that modifications can include an abasic site such as a 2’-O-methoxyethyl (Paragraph [0037]).
Regarding claim 6, Wettengel et al discloses, “Preferably, the targeting sequence of the artificial nucleic acid comprises at least one backbone modification, wherein a nucleotide comprises a modified phosphate group. The modified phosphate group is preferably selected from the group consisting of a phosphorothioate, a phosphoroselenate, a borano phosphate, a borano phosphate ester, a hydrogen phosphonate, a phosphoroamidate, an alkyl phosphonate, an aryl phosphonate and a phosphotriester, most preferably a phosphorothioate.” (Paragraph [0043]).
Regarding claim 7, Wettengel et al discloses, “According to a preferred embodiment, the targeting sequence comprises at least one chemically modified nucleotide, which is chemically modified at the 2′ position. Preferably, the chemically modified nucleotide comprises a substituent at the 2′ carbon atom, wherein the substituent is selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably from 2′-hydrogen (2′-deoxy), 2′-O-methyl, 2′-O-methoxyethyl and 2′-fluoro; and/or wherein the chemically modified nucleotide is selected from the group consisting of a locked nucleic acid (LNA) nucleotide, an ethylene bridged nucleic acid (ENA) nucleotide and an (S)-constrained ethyl cEt nucleotide.” (Paragraph [0042]).
Regarding claim 8, Wettengel et al discloses a phosphorothioate bond in the counter region (see Fig. 10A-B; paragraph [0164]).
Regarding claim 9, Wettengel et al discloses a phosphorothioate bond modification in the target-corresponding nucleotide (see Fig. 10A-B; paragraph [0164]).
Regarding claim 10, Wettengel et al discloses the following 2'-O-alkyl modifications: 2′-O-methyl-2′-deoxyadenosine, 2′-O-methyl-2′-deoxycytidine, 2′-O-methyl-2′-deoxyguanosine, 2′-O-methyl-2′-deoxyuridine, 2′-O-methyl-5-methyluridine, 2′-O-methylinosine, 2′-O-methylpseudouridine (paragraph [0027]). More specifically, Wettengel et al discloses modifications to the 5’-side of the target-corresponding nucleotide as a 2’-OMe in Fig. 6A and 6C, and Paragraph [0158].
Regarding claim 11, Wettengel et al discloses nucleotide modifications on the recruiting moiety (recruiting moiety reads on the second oligonucleotide) (paragraph [0024] and Fig. 1, Fig. 3B and, a Fig. 5B).
Regarding claim 15, Wettengel et al discloses nucleotide modifications of base sequences on the 5’-end of the target-corresponding residue being 2’-O-Methyl (See Fig. 1A, Fig. 3B, and Fig. 5B).
Regarding claim(s) 16-17, Wettengel et al discloses a targeting sequence (which reads on claim 1’s first oligonucleotide and the nucleotides extending 5’ and 3’, not including the recruiting moiety that reads on the second oligonucleotide), with nucleotides that could be any combination of chemical modifications to the nucleotide bases, see Fig. 5A and paragraphs [0023], [0024], and [0027] for the specific modifications.
Regarding claim 18, Wettengel et al discloses nucleotide modifications of the recruiting moiety, wherein those modifications are 2’-O-Methyl (See Fig. 3B and Fig. 5B).
Regarding claim 22 and 23, Wettengel et al discloses, “Prior to the present invention, it was commonly believed in the field that the nucleotide at the position corresponding to the nucleotide to be edited as well as the two nucleotides flanking said nucleotide in the targeting sequence should not be modified. The excellent results obtained by the inventors when using artificial nucleic acids, wherein the nucleotide triplet opposite the target site comprises at least one chemically modified nucleotide as described herein, were thus all the more unexpected.”, (Paragraph [0048]). Fig. 6B and Fig. 10A-B of Wettengel et al discloses a 3’-side of the target -corresponding nucleotide as a 2’-deoxyadenosine or 2’-deoxyuridine residues unmodified.
Regarding claim 25, Wettengel et al discloses, the targeting sequence of the artificial nucleic acid comprises at the position corresponding to a nucleotide to be edited in the target sequence a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site (Paragraph [0064]).
Regarding claim 26, which is a product-by-process claim, and therefore reads on an oligonucleotide produced by any means that would provide the same structural characteristics of an oligonucleotide produced by the process recited in the claims (see MPEP § 2113). Regarding the structure implied by the process steps recited in the claim, the originally filed specification states, “In at least one residue, at least three residues, or all the residues in any
oligonucleotide residue (non-counter region) other than the counter region of the first oligonucleotide, at least one of the sugar moiety and the phosphodiester bond may be modified, at least the sugar moiety may be modified, at least the phosphodiester bond may be modified, or the sugar moiety and the phosphodiester bond may be modified.” (see paragraph [0204]). In view of this, the skilled artisan would conclude, absent any evidence to the contrary, that the oligonucleotide of claim 26 is the same as an artificial nucleic acid comprising, “…at least one chemically modified nucleotide, wherein the phosphate backbone, which is incorporated into the artificial nucleic acid molecule, is modified. The phosphate groups of the backbone can be modified, for example, by replacing one or more of the oxygen atoms with a different substituent. Further, the modified nucleotide can include the full replacement of an unmodified phosphate moiety with a modified phosphate as described herein. Examples of modified phosphate groups include, but are not limited to, the group consisting of a phosphorothioate…”, as disclosed by Wettengel et al in paragraph [0036].
Regarding claim 27, Wettengel et al discloses various modifications in formulae that include a bridged nucleotide in the tenth or subsequent nucleotide resides counted in the 3’- direction from the target-corresponding nucleotide (Paragraph [0057] and formulae d-g, i, and k).
Regarding claim 28, Wettengel et al discloses various modifications in formulae that include a nucleotide modification and a bridged nucleotide in the tenth or subsequent nucleotide resides counted in the 3’- direction from the target-corresponding nucleotide alternately linked (Paragraph [0057] and formulae g, i, and k).
Regarding claim 29, Wettengel et al discloses an oligonucleotide that contains a bridged nucleotide residue in subsequent residues counted in the 5’ direction of the 3’ end (See Fig. 5B – ASO v25.4 and ASO v25.5).
Regarding claim 30, which further limits claim 29, wherein Wettengel et al discloses that the recruiting moiety (which reads on claim 1’s second oligonucleotide) contains a bridged nucleotide residue in subsequent residues counted in the 5’ direction of the 3’ end (See Fig. 5B – ASO v25.4 and ASO v25.5). Wettengel et al also discloses that the recruiting moiety could contain any combination of chemical modifications to the nucleotide bases, see Fig. 1A (ASO v9.5), Fig. 3B (ASO v9.5 and ASO v25), and Fig. 5B (ASO v25.3-5) and paragraphs [0078], [0079], and [0080].
Regarding claim 32 and 48, Wettengel et al discloses, “In some embodiments, the artificial nucleic acid comprises a moiety, which enhances cellular uptake of the artificial nucleic acid. Preferably, the moiety enhancing cellular uptake is a triantennary N-acetyl galactosamine (GalNAc3), which is preferably conjugated with the 3′ terminus or with the 5′ terminus of the artificial nucleic acid.” see paragraph [0017]. More specifically, Figure 1 nucleotide constructs depict 3’ or 5’ ends with and without phosphorothioate bonds.
Wettengel et al does not teach (a) wherein the oligonucleotide linked to the 3’-side of the target corresponding nucleotide residue has a base sequence in which a 2’-deoxy-2’fluoronucleotide residue and a 2’-O-alkyl ribonucleotide residue are alternately linked; and (b) the second oligonucleotide has a base sequence in which a 2’O-alkyl ribonucleotide residue and a bridge nucleotide residue are alternately linked.
Regarding claim(s) 1, 16-17, and 30, Prakash et al teaches, “In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2’-OMe, 2’-F, 2’-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2’-F and 2’- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.”, (p. 57, lines 4-10).
Moreover, Prakash et al teaches, “In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB)xAy wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; or
ABABBAABBABABAA;
wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2’-F, 2’-OMe, BNA, and MOE.”, (p. 57, lines 11-28). “In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5’ terminal nucleoside, such as those of formula IIc or IIe. In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A)2-(B)x-(A)2-(C)y-(A)3- wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another.”, (p. 58, lines 1-6).
Wettengel et al and Prakash et al do not teach properties of nucleotide modifications.
Regarding claim(s) 1, 16-17, and 30, Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
Shen et al also teaches that there are current drugs on the market such as Inclisiran (includes one deoxyribose), Revusiran, Firusiran, and Givosiran that contain both 2’O-methyl and 2’Fluoro modifications (Figure 6).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide in Fig. 5A of Wettengel et al with the teachings of Prakash et al, i.e., alternating nucleotide residue modifications in differing regions of an oligonucleotide, and the teachings of Shen et al, i.e., the benefits of the modifications to oligonucleotides, to yield the predictable results of an oligonucleotide comprising two oligonucleotides wherein one (the oligonucleotide that is 3’ of the target-corresponding nucleotide) comprises a base sequence of 2’-deoxy-fluoronucleotide and 2’O-methyl nucleic acid residues alternately linked and the other (the second oligonucleotide) comprises a base sequence of 2’O-methyl and bridged nucleic acid residues alternately linked. One would have been motivated to do so because Wettengel et al teaches an oligonucleotide comprised of two oligonucleotides: one that identifies a target RNA and the other that is a recruiting moiety. Wettengel et al teaches that the nucleic acids can be comprised of differing modifications, Prakash et al teaches that oligonucleotides can have alternating modifications in different regions, even up to three different modifications, such as 2’O-methyl, 2’fluoro, and bridged nucleic acid residues, and Shen et al teaches that these modifications increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing. One of skill in the art could look to the teachings of Wettengel et al, in view of Prakash et al and Shen et al and arrived at the claimed invention with a high likelihood of success.
Regarding claim 31, Wettengel et al discloses, “The inventors have found that the artificial nucleic acid is suitable for editing a wide variety of transcripts, e.g. endogenous mRNAs of housekeeping genes as well as endogenous transcripts of disease-related genes (such as STAT1 or SERPINA1).”, (Paragraph [0012]). Wettengel et al discloses designing oligonucleotides with modifications for targeting the E342K mutation in the SERPINA1 gene (see Paragraphs [0192] and [0193]). The E342K mutation (amino acid) corresponds to the G1096A substitution (nucleotide) in SERPIN1A, which is one of the gene targets by the instant claimed invention. More specifically, Wettengel et al discloses three sequences, SEQ ID NO: 80-82, encompassing oligonucleotide(s) with the following modifications: 2’-O-Methyl RNA base, LNA base, and phosphorothioate linkages that teach on the instant claimed AD_A1AT.39 formula.
The most relevant sequence to the instant application is Wettengel et al’s SEQ ID NO: 80 with the following formula: (CAUGGCCCCAGCAGCUUCAGUC)[C]{C}[UUUC](UCG)[UCGA]{T*}[G*][G*]{T*}[C]; wherein (N) represents RNA base, [N] represents 2’-OMe RNA base, * represents phosphorothioate linkage, and {N} represents LNA Base (see Table 1 on Page 29-30).
The instant specification discloses that “The A1AT (also referred to as “SERPINA1A”) gene sequence here used contains the 1129-th to 1153-th base sequences from GenBank accession no. NM_000295.5, and furthermore contains the mutations (rs28929474) of nucleoside, called c.1096G>A (see paragraph [0447] of instant specification).
The DNA sequence from NM_000295.5 is the following:
5’ G-C-T-G-A-C-C-A-T-C-G-A-C-G-A-G-A-A-A-G-G-G-A-C 3’
The mRNA sequence of E342K mutation is the following:
5’ C-G-U-G-A-C-C-A-U-C-G-A-C-A-A-G-A-A-A-G-G-G-A-C 3’, (wherein the bolded and underlined A is the 1096G>A substitution that causes the E342K mutation, also referred to as Z-A1AT as taught by the instant specification at [0449]).
The forward primer used to clone the G1096A mutation in the instant application can be found on page 147, paragraph [0452]:
5’ G-A-C-C-A-T-C-G-A-C-A-A-G-A-A-A-G-G-G-A-C 3’
The transcribed mRNA from this is forward primer is:
3’ C-U-G-G-U-A-G-C-U-C-U-U-C-U-U-U-C-C-C-U-G 5’
Or also,
5’ G-U-C-C-C-U-U-U-C-U-U-C-U-C-G-A-U-G-G-U-C 3’
The instant applications claimed oligonucleotide, referenced as AD_A1AT.39, reads on a slightly modified version of the transcribed 5’ primer. Without the modifications for clarity, the oligonucleotide is the following:
5’ G-T-C-C-C-U-U-C-U-(ci)-U-C-G-A-U-G-G-U-C-A-G-C-A 3’
Differences in the oligonucleotide of the claimed formula versus the 5’ transcribed mRNA are the following: (A) the second nucleotide from the 5’ end is a T instead of a U; (B) the U that is eight positions from the 5’ end has been removed; and (C) A-G-C-A has been added to the 3’ end. Upon comparison of AD_A1AT.39 of instant claim 31 to SEQ ID NO:80 (nucleotides #20-40) of Wettengel et al, almost all of the base sequences of the nucleotides are conserved except the following: (a) SEQ ID NO: 80 retains the second nucleotide from the 5’ end, U, from the mRNA sequence, while the T in AD_A1AT.39 could also represent a locked U; (b) SEQ ID NO: 80 retains the eighth nucleotide from the 5’ end, U, from the mRNA sequence, while AD_A1AT.39 lacks it; (c) SEQ ID NO: 80 contains T’s in the 17th and 20th position from the 5’ end (as depicted below) and a locked C at position five from the 5’ end; (d) SEQ ID NO:80 does not contain A-G-C-A at the 3’ end; (e) SEQ ID NO: 80 only contains 2’-O-methyl base modifications (independent of the locked nucleic acid modifications mentioned above in a/c/d), whereas AD1_A1AT.39 contains mixed modifications of 2’-O-methyl and 2’-Fluoro; and (f) SEQ ID NO: 80 only contains four phosphorothioate linkages in the backbone, while backbone linkages in AD1_A1AT.39 are all phosphorothioate.
For ease of comparison, modification legends have been translated between both the instant application and Wettengel et al, wherein [N] represents a 2’-O-methyl, N} represents a 2’-O, 4’-C-methyl or a Locked Nucleic Acid, <N> represents 2’-fluoro, and * represents a phosphorothioate bond.
Nucleotide # counted from 5’ end
1
2
3
4
5
6
7
8
9
10
11
12
AD_A1AT.39
Nucleotide #1-20
[G*]
{T*}
[C*]
{C*}
[C*]
<U*>
<U*>
[C*]
[U*]
(C*)
(I*)
SEQ ID NO:80
Nucleotide #20-40
(G)
(U)
(C)
[C]
{C}
[U]
[U]
[U]
[C]
(U)
(C)
(G)
Nucleotide # counted from 5’ end
13
14
15
16
17
18
19
20
21
AD_A1AT.39
Nucleotide #1-20
[U*]
<C*>
[G*]
<A*>
[U*]
<G*>
[G*]
<U*>
[C*]
SEQ ID NO:80
Nucleotide #20-40
[U]
[C]
[G]
[A]
{T*}
[G*]
[G*]
{T*}
[C]
Nucleotide # counted from 5’ end
22
23
24
25
AD_A1AT.39
Nucleotide #1-20
{A*}
[G*]
{C*}
[A*]
SEQ ID NO:80
Nucleotide #20-40
Despite SEQ ID NO:80 from Wettengel et al and AD1_A1AT.39 of the instant application containing 16 out of 20 base matches (wherein three mismatches are modified T’s as LNAs versus U’s) as well as many of the same modifications, Wettengel et al does not fully teach the formulae and modifications of AD1_A1AT.39 claimed in instant claim 31.
Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
More specifically, Shen et al teaches that the phosphorothioate modification is the most widely used single alteration in nucleic acid drug development, and that it serves two purposes: (1) to increase stability toward digestion to nucleases, and (2) increase binding to serum proteins (Page 1585, Column 1, Paragraph 3). Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
Shen et al also teaches that there are current drugs on the market such as Inclisiran (includes one deoxyribose), Revusiran, Firusiran, and Givosiran that contain both 2’O-methyl and 2’Fluoro modifications (Figure 6). As well as Miravirsen contains all phosphorothioate linkages and contains locked nucleic acids (Figure 6).
Thus, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the above combined teachings of Wettengel et al (specifically SEQ ID NO: 80), Prakash et al, and Shen et al, with the teachings of Shen et al to arrive at the formula of AD1_A1AT.39.
More specifically:
(a/c) There are four occurrences between SEQ ID NO: 80 of Wettengel et al and the instant claimed AD1_A1AT.39 where (1) a locked T is in the second position to the 5’ end of AD1_A1AT.39 where there is a U in SEQ ID NO: 80; (2) a locked U is in the fifth position from the 5’ end of SEQ ID NO: 80, where there is a U in AD1_A1AT.39; (3) a locked T is in the 17th position to the 5’ end of SEQ ID NO: 80 where there is a U modified as a 2’-O-methyl in AD1_A1AT.39; and (4) a locked T is in the 20th position to the 5’ end of SEQ ID NO: 80, where there is a U modified as a 2’-O-methyl in AD1_A1AT.39. Shen et al teaches that 2’-O, 4’-C-methylenated modifications (i.e., locked nucleic acids or bridged) are an especially useful type of modification for increasing the strength of hybridization and reducing the entropic price paid during Watson–Crick base-pairing. Thus, it would have been obvious to one of ordinary still in the art before the effective filing date to modify the nucleic acids within both the 5’ and 3’ regions of the SEQ ID NO: 80 of Wettengel et al with the locked nucleic acid teachings of Shen et al to arrive at the predictable oligonucleotide AD1_A1AT.39 for the purposes of increased hybridization strength and reduced entropic price.
(b) SEQ ID NO: 80 of Wettengel et al retains the U from the mRNA sequence at the 8th position from the 5’ end. The instant specification lacks description as to why said nucleic acid was removed during the process of creating the oligonucleotide. In paragraph [0447] of the instant specification, the only alteration to NM_000295.5 disclosed is the mutation rs28929474, which is accounted for in the primer design of the instant specification at paragraph [0452], whereas the removal of the U in the 8th position from the 5’ side of the primer is not accounted for, and is still present (see primer above). Thus, the lack of U at the 8th position from the 5’ side does not have a justified reason by the Applicant and cannot be considered a modification for the purposes of improvement or differentiation over SEQ ID NO: 80 of Wettengel et al.
(d) AD1_A1AT.39 contains four additional nucleic acids at the 3’ end of the oligonucleotide, A-G-C-A, wherein the A that is four positions in from the end and the C that is two positions in from the 3’ are both locked nucleic acids. As mentioned above in (a/c) Wettengel et al’s SEQ ID NO: 80 contains locked nucleic acids at positions two and five from the 3’ end and the fifth position from the 5’ end. Thus, it would have been obvious to incorporate two locked nucleic acids onto AD_A1AT.39 within five base pairs of the 3’ end for purpose of nuclease protection as taught by increasing the strength of hybridization and reducing the entropic price paid during Watson–Crick base-pairing and disclosed by Wettengel et al.
(e) AD1_A1AT.39 contains mixed modifications of 2’-O-methyl and 2’-Fluoro, whereas SEQ ID NO: 80 only contains 2’-O-methyl modifications (independent of the locked nucleic acid modifications mentioned above in a/c/d). It would have been obvious to one of ordinary skill in the art before the effective filing date to try the mixed modifications on an oligonucleotide designed for therapeutic relief (e.g., SERPINA1 mutation) as taught by Shen et a on SEQ ID NO: 80 of Wettengel et al to yield the predictable result of increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increasing the thermal stability of complementary hybridization.
(f) AD1_A1AT.39 contains all phosphorothioate linkages in the backbone, while SEQ ID NO: 80 only contains four. It would have been obvious to one of skill in the art before the effective filing date to replace all the backbone linkages of SEQ ID NO:80 with phosphorothioate linkages as taught by Shen et al to yield predictable results of increasing stability toward digestion to nucleases and increasing binding to serum proteins.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify combined teachings of Wettengel et al (the oligonucleotide SEQ ID NO:80), Prakash et al, and Shen et al, with the teachings of Shen et al for the purpose of (1) increasing the strength of hybridization, (2) reducing the entropic price paid during Watson–Crick base-pairing, (3) increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, (4) increasing the thermal stability of complementary hybridization, and (5) increasing binding to serum proteins, when modifying 1096G>A of the SERPINA1 gene with endogenous ADAR to correct alpha-1 antitrypsin deficiency.
Accordingly, claim(s) 1-11, 15-18, 22-23, 25-32, and 48 are unpatentable over Wettengel et al in view of Prakash et al and Shen et al.
Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable over Wettengel et al (supra) in view of Prakash et al (supra) and Shen et al (supra). This is a new rejection that is necessitated by amendment to the claims in the reply filed on 06/22/2026
It is of note that in the amendments filed 06/22/2026, claim 13 substitutes a limitation of amended claim 1 with a different limitation and therefore does not include all of the limitations of the independent claim, see 35 U.S.C. 112(d) rejections above.
Regarding claim 13, Wettengel et al discloses an invention pertaining to artificial chemically-modified nucleic acids for site-directed editing of target RNA. More specifically, the artificial nucleic acid for site-directed editing contains:
(a) a targeting sequence (which reads on claim 13’s first oligonucleotide) comprising a nucleic acid sequence complementary or partially complementary to a target sequence in the target RNA (see Fig. 1A and paragraph [0009]);
(b) a recruiting moiety for recruiting a deaminase (which reads on the claim 13’s second oligonucleotide) (see Fig. 1A and paragraph [0016]);
(c) the recruiting moiety linked to the 5’-side of the targeting sequence (see Fig. 1A and [0076]);
(d) a target corresponding nucleotide is an adenosine residue (see Fig. 1A and paragraphs [0014] and [0015]);
(e) between 9 and 16 nucleotides linked to the 3’-side of the target corresponding nucleotide residue having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(f) six nucleotides linked to the 5’-side of the target corresponding nucleotide having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(g) no nucleotide residue corresponding to a nucleotide residue of the target RNA or has a nucleotide residue which does not form a complementary pair with a nucleotide residue of the target RNA, at the 3’end thereof (see Fig. 1A, Fig. 3B, Fig. 5A, and Fig. 5B);
(h) anywhere from 6 nucleotides to 200, with preferred embodiments of, “the artificial nucleic acid comprises at least about 15, preferably at least about 20, more preferably at least about 25, even more preferably at least about 30, even more preferably at least about 35, most preferably at least about 40, nucleotides. Alternatively, the length of the artificial nucleic acid is in the range from about 10 to about 200 nucleotides, preferably from about 15 to about 100 nucleotides, more preferably from about 15 to about 70 nucleotides, most preferably from about 20 to about 70 nucleotides.” (paragraph [0018]);
(i) forms a double-stranded structure complementary to the target RNA (see Fig. 1A and paragraph [0019]);
(j) a counter region (see Fig. 8e, Fig. 9b, Fig. 10A-B, and paragraphs [0161], [0164] [0193], [0199]);
(k) the nucleotide linked to the 3’-side of the target-corresponding nucleotide is a 2’-deoxynucleotide residue (see Fig. 10A and paragraph [0050]); and
(l) the third nucleotide in the 3’-direction from the target-corresponding nucleotide is 2'-deoxy-2'-fluoronucleotide (paragraphs [0025], [0026], and [0027] covering variants of nucleotides; and see Fig. 5A, Fig. 7b).
Wettengel et al does not teach (a) wherein the oligonucleotide linked to the 3’-side of the target corresponding nucleotide residue has a base sequence in which bridged nucleotide residues and 2’-O-alkyl ribonucleotide residues are alternately linked; and (b) the second oligonucleotide has a base sequence in which 2’O-alkyl ribonucleotide residues and bridge nucleotide residues are alternately linked.
Regarding claim 13, Prakash et al teaches, “In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2’-OMe, 2’-F, 2’-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2’-F and 2’- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.”, (p. 57, lines 4-10).
Moreover, Prakash et al teaches, “In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB)xAy wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; or
ABABBAABBABABAA;
wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2’-F, 2’-OMe, BNA, and MOE.”, (p. 57, lines 11-28). “In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5’ terminal nucleoside, such as those of formula IIc or IIe. In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A)2-(B)x-(A)2-(C)y-(A)3- wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another.”, (p. 58, lines 1-6).
Wettengel et al and Prakash et al do not teach properties of nucleotide modifications.
Regarding claim 13, Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide in Fig. 5A of Wettengel et al with the teachings of Prakash et al, i.e., alternating nucleotide residue modifications in differing regions of an oligonucleotide, and the teachings of Shen et al, i.e., the benefits of the modifications to oligonucleotides, to yield the predictable results of an oligonucleotide comprising two oligonucleotides wherein one (the oligonucleotide that is 3’ of the target-corresponding nucleotide) comprises a base sequence of bridged nucleotide and 2’O-methyl nucleic acid residues alternately linked and the other (the second oligonucleotide) comprises a base sequence of 2’O-methyl and bridged nucleic acid residues alternately linked. One would have been motivated to do so because Wettengel et al teaches an oligonucleotide comprised of two oligonucleotides: one that identifies a target RNA and the other that is a recruiting moiety. Wettengel et al teaches that the nucleic acids can be comprised of differing modifications, Prakash et al teaches that oligonucleotides can have alternating modifications, such as 2’O-methyl, 2’fluoro, and bridged nucleic acid residues, and Shen et al teaches that these modifications increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing. One of skill in the art could look to the teachings of Wettengel et al, in view of Prakash et al and Shen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim 13 is rejected as being unpatentable over Wettengel et al in view of Prakash et al and Shen et al.
Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over Wettengel et al (supra) in view of Prakash et al (supra) and Shen et al (supra). This is a new rejection that is necessitated by amendment to the claims in the reply filed on 06/22/2026
It is of note that in the amendments filed 06/22/2026, claim 14 substitutes a limitation of amended claim 1 with a different limitation and therefore does not include all of the limitations of the independent claim, see 35 U.S.C. 112(d) rejections above.
Regarding claim 14, Wettengel et al discloses an invention pertaining to artificial chemically-modified nucleic acids for site-directed editing of target RNA. More specifically, the artificial nucleic acid for site-directed editing contains:
(a) a targeting sequence (which reads on claim 14’s first oligonucleotide) comprising a nucleic acid sequence complementary or partially complementary to a target sequence in the target RNA (see Fig. 1A and paragraph [0009]);
(b) a recruiting moiety for recruiting a deaminase (which reads on the claim 14’s second oligonucleotide) (see Fig. 1A and paragraph [0016]);
(c) the recruiting moiety linked to the 5’-side of the targeting sequence (see Fig. 1A and [0076]);
(d) a target corresponding nucleotide is an adenosine residue (see Fig. 1A and paragraphs [0014] and [0015]);
(e) between 9 and 16 nucleotides linked to the 3’-side of the target corresponding nucleotide residue having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(f) six nucleotides linked to the 5’-side of the target corresponding nucleotide having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(g) no nucleotide residue corresponding to a nucleotide residue of the target RNA or has a nucleotide residue which does not form a complementary pair with a nucleotide residue of the target RNA, at the 3’end thereof (see Fig. 1A, Fig. 3B, Fig. 5A, and Fig. 5B);
(h) anywhere from 6 nucleotides to 200, with preferred embodiments of, “the artificial nucleic acid comprises at least about 15, preferably at least about 20, more preferably at least about 25, even more preferably at least about 30, even more preferably at least about 35, most preferably at least about 40, nucleotides. Alternatively, the length of the artificial nucleic acid is in the range from about 10 to about 200 nucleotides, preferably from about 15 to about 100 nucleotides, more preferably from about 15 to about 70 nucleotides, most preferably from about 20 to about 70 nucleotides.” (paragraph [0018]);
(i) forms a double-stranded structure complementary to the target RNA (see Fig. 1A and paragraph [0019]);
(j) a counter region (see Fig. 8e, Fig. 9b, Fig. 10A-B, and paragraphs [0161], [0164] [0193], [0199]);
(k) the nucleotide linked to the 3’-side of the target-corresponding nucleotide is a 2’-deoxynucleotide residue (see Fig. 10A and paragraph [0050]); and
(l) the third nucleotide in the 3’-direction from the target-corresponding nucleotide is 2'-deoxy-2'-fluoronucleotide (paragraphs [0025], [0026], and [0027] covering variants of nucleotides; and see Fig. 5A, Fig. 7b).
Wettengel et al does not teach (a) wherein the oligonucleotide linked to the 3’-side of the target corresponding nucleotide residue has a base sequence in which bridged nucleotide residues and 2’-deoxy-fluoronucleotide residues are alternately linked; and (b) the second oligonucleotide has a base sequence in which 2’O-alkyl ribonucleotide residues and bridge nucleotide residues are alternately linked.
Regarding claim 14, Prakash et al teaches, “In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2’-OMe, 2’-F, 2’-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2’-F and 2’- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.”, (p. 57, lines 4-10).
Moreover, Prakash et al teaches, “In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB)xAy wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; or
ABABBAABBABABAA;
wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2’-F, 2’-OMe, BNA, and MOE.”, (p. 57, lines 11-28). “In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5’ terminal nucleoside, such as those of formula IIc or IIe. In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A)2-(B)x-(A)2-(C)y-(A)3- wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another.”, (p. 58, lines 1-6).
Wettengel et al and Prakash et al do not teach properties of nucleotide modifications.
Regarding claim 14, Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide in Fig. 5A of Wettengel et al with the teachings of Prakash et al, i.e., alternating nucleotide residue modifications in differing regions of an oligonucleotide, and the teachings of Shen et al, i.e., the benefits of the modifications to oligonucleotides, to yield the predictable results of an oligonucleotide comprising two oligonucleotides wherein one (the oligonucleotide that is 3’ of the target-corresponding nucleotide) comprises a base sequence of bridged nucleotide and 2’-deoxy-fluoro nucleic acid residues alternately linked and the other (the second oligonucleotide) comprises a base sequence of 2’O-methyl and bridged nucleic acid residues alternately linked. One would have been motivated to do so because Wettengel et al teaches an oligonucleotide comprised of two oligonucleotides: one that identifies a target RNA and the other that is a recruiting moiety. Wettengel et al teaches that the nucleic acids can be comprised of differing modifications, Prakash et al teaches that oligonucleotides in differing regions can have alternating modifications (up to three different), such as 2’O-methyl, 2’fluoro, and bridged nucleic acid residues, and Shen et al teaches that these modifications increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing. One of skill in the art could look to the teachings of Wettengel et al, in view of Prakash et al and Shen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim 14 is rejected as being unpatentable over Wettengel et al in view of Prakash et al and Shen et al.
Claim 20 is rejected under 35 U.S.C. 103 as being unpatentable over Wettengel et al (supra) in view of Prakash et al (supra) and Shen et al (supra). This is a new rejection that is necessitated by amendment to the claims in the reply filed on 06/22/2026
It is of note that in the amendments filed 06/22/2026, claim 20 substitutes a limitation of amended claim 1 with a different limitation and therefore does not include all of the limitations of the independent claim, see 35 U.S.C. 112(d) rejections above.
Regarding claim 20, Wettengel et al discloses an invention pertaining to artificial chemically-modified nucleic acids for site-directed editing of target RNA. More specifically, the artificial nucleic acid for site-directed editing contains:
(a) a targeting sequence (which reads on claim 20’s first oligonucleotide) comprising a nucleic acid sequence complementary or partially complementary to a target sequence in the target RNA (see Fig. 1A and paragraph [0009]);
(b) a recruiting moiety for recruiting a deaminase (which reads on the claim 20’s second oligonucleotide) (see Fig. 1A and paragraph [0016]);
(c) the recruiting moiety linked to the 5’-side of the targeting sequence (see Fig. 1A and [0076]);
(d) a target corresponding nucleotide is an adenosine residue (see Fig. 1A and paragraphs [0014] and [0015]);
(e) between 9 and 16 nucleotides linked to the 3’-side of the target corresponding nucleotide residue having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(f) six nucleotides linked to the 5’-side of the target corresponding nucleotide having complementarity to the target RNA (see Fig. 5A first oligonucleotide listed and paragraph [0018]);
(g) no nucleotide residue corresponding to a nucleotide residue of the target RNA or has a nucleotide residue which does not form a complementary pair with a nucleotide residue of the target RNA, at the 3’end thereof (see Fig. 1A, Fig. 3B, Fig. 5A, and Fig. 5B);
(h) anywhere from 6 nucleotides to 200, with preferred embodiments of, “the artificial nucleic acid comprises at least about 15, preferably at least about 20, more preferably at least about 25, even more preferably at least about 30, even more preferably at least about 35, most preferably at least about 40, nucleotides. Alternatively, the length of the artificial nucleic acid is in the range from about 10 to about 200 nucleotides, preferably from about 15 to about 100 nucleotides, more preferably from about 15 to about 70 nucleotides, most preferably from about 20 to about 70 nucleotides.” (paragraph [0018]);
(i) forms a double-stranded structure complementary to the target RNA (see Fig. 1A and paragraph [0019]);
(j) a counter region (see Fig. 8e, Fig. 9b, Fig. 10A-B, and paragraphs [0161], [0164] [0193], [0199]);
(k) the nucleotide linked to the 3’-side of the target-corresponding nucleotide is a 2’-deoxynucleotide residue (see Fig. 10A and paragraph [0050]); and
(l) the third nucleotide in the 3’-direction from the target-corresponding nucleotide is 2'-deoxy-2'-fluoronucleotide (paragraphs [0025], [0026], and [0027] covering variants of nucleotides; and see Fig. 5A, Fig. 7b).
Wettengel et al does not teach (a) wherein the oligonucleotide linked to the 3’-side of the target corresponding nucleotide residue has a base sequence in which 2’-O-alkyl ribonucleotide and 2’-deoxy-fluoronucleotide residues are alternately linked; and (b) the second oligonucleotide has a base sequence in which 2’O-alkyl ribonucleotide residues and 2’-deoxy-fluoro residues are alternately linked.
Regarding claim 20, Prakash et al teaches, “In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2’-OMe, 2’-F, 2’-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2’-F and 2’- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.”, (p. 57, lines 4-10).
Moreover, Prakash et al teaches, “In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB)xAy wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; or
ABABBAABBABABAA;
wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2’-F, 2’-OMe, BNA, and MOE.”, (p. 57, lines 11-28). “In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5’ terminal nucleoside, such as those of formula IIc or IIe. In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A)2-(B)x-(A)2-(C)y-(A)3- wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another.”, (p. 58, lines 1-6).
Wettengel et al and Prakash et al do not teach properties of nucleotide modifications.
Regarding claim 20, Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide in Fig. 5A of Wettengel et al with the teachings of Prakash et al, i.e., alternating nucleotide residue modifications in differing regions of an oligonucleotide, and the teachings of Shen et al, i.e., the benefits of the modifications to oligonucleotides, to yield the predictable results of an oligonucleotide comprising two oligonucleotides wherein one (the oligonucleotide that is 3’ of the target-corresponding nucleotide) comprises a base sequence of 2’O-methyl ribonucleotide and 2’-deoxy-fluoro nucleic acid residues alternately linked and the other (the second oligonucleotide) comprises a base sequence of 2’O-methyl and 2’-deoxy-fluoronucleotide residues alternately linked. One would have been motivated to do so because Wettengel et al teaches an oligonucleotide comprised of two oligonucleotides: one that identifies a target RNA and the other that is a recruiting moiety. Wettengel et al teaches that the nucleic acids can be comprised of differing modifications, Prakash et al teaches that oligonucleotides can have alternating modifications such as 2’O-methyl and 2’fluoro, and Shen et al teaches that these modifications increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increasing the thermal stability of complementary hybridization. One of skill in the art could look to the teachings of Wettengel et al, in view of Prakash et al and Shen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim 20 is rejected as being unpatentable over Wettengel et al in view of Prakash et al and Shen et al.
Claim(s) 21 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over Wettengel et al (supra) in view of Prakash et al (supra) and Shen et al (supra) as applied to claim(s) 1-11, 15-18, 22-23, 25-32, and 48 above, and in view of Watkins et al (Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes, Nucleic Acids Research, Vol 33, Issue 19, Pages 6258-6267, 2005; cited on PTO 892 filed 01/22/2026) in further view of Wright et al (Stability of RNA duplexes containing inosine/cytosine pairs, Nucleic Acids Research, Vol 46, Issue 22, Pages 12099-12108, 2018; cited on PTO 892 filed 01/22/2026). This new rejection is necessitated by the amendment to the claims in the reply filed on 06/22/2026.
Wettengel et al teaches in Fig. 6B and Fig. 8e that on the 5’ side of the nucleic acid to be modified, a cytosine is in that place. Fig. 8e discloses that on the 5’ side of the nucleic acid to be modified, a guanosine is in that place. Wettengel et al also discloses a guanosine that is 3’ to the target-corresponding nucleic acid in Fig. 6B.
Wettengel et al does not explicitly teach an inosine located on the 3’ side of the target-corresponding nucleic acid.
Watkins et al discloses performing nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes (Abstract). More specifically, Watkins et al demonstrates that, “The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5’ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3’ of I·X is the same.”, (Abstract). Watkins et al suggests that “The most common application of inosine is in the determination of a mRNA sequence using degenerate hybridization probes…The inosine thermodynamic parameters presented here enable a more accurate design of primers and probes to protein coding regions, or other templates with ambiguous sequences…. Inosine may also be substituted in difficult guanine rich PCR primers to reduce G-quartet formation as well as primer–dimer artifacts.”, (Page 6258, Column 2, Paragraphs 1 and 2). Watkins et al teaches deoxyinosine 3’ of a cytosine (reading on the target corresponding nucleic acid) in Table 4, rows 1 and 2, and Table 5, probes 1, 7, 8, and 18. Where inosine occurs 3’ in the dimer the stabilities are: AI/IA>> CI/IC > TI/ IT >> GI/IG (Page 6265, Column 1, Paragraph 2).
Watkins et al does not teach deoxyinosine in an RNA duplex.
Wright et al discloses performing optical melting experiments on a series of RNA duplexes containing I·C pairs, namely, to derive nearest neighbor parameters for a single I·C pair adject to Watson-Crick pairs (Page 12100, Column 2, Paragraph 1). Wright et al teaches that because inosine is the same as guanosine but without the exocyclic amino group, inosine tends to behave as guanosine (Page 12099, Column 1, paragraph 1). Wright et al suggests that because of inosine’s promiscuity, it can be used in an oligonucleotide probe when the exact sequence of the nucleic acid target is unknown. Probes containing deoxyinosine have been used to screen high complexity genomic DNA and cDNA libraries.”, (Page 12099, Column 2, Paragraph 3). More specifically, Wright et al demonstrates that, “The I·C nearest neighbor combinations in every duplex in this study had a stabilizing effect on duplex thermodynamics. This was true for single internal I·C pairs, terminal I·C pairs, and tandem I·C pairs.”, (Page 12102, Column 2, Paragraph 2). Lastly, Wright et al suggests that “Scientists can use these new nearest neighbor parameters to calculate the stability of ADAR products and to calculate the stability of an RNA duplex in which G-to-I substitution was used to determine the role of the exocyclic amino group of G.”, (Page 12106, Column 2, Paragraph 1).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the guanosine at the 3’ location in relation to the target-corresponding nucleic acid in the combined teachings of Wettengel et al (in Fig. 8e) in view of Prakash et al and Shen et al, with a 2’-deoxyinosine as taught by Watkins et al, to yield the predictable results of a 2’-deoxyinosine at the 3’ location in relation to the target-corresponding nucleic. Both the structure and function of guanosine and 2’deoxyinosine were known in the art before the filing date of the claimed invention. One of skill could substitute one for another for constructing degenerate oligonucleotide probes when an mRNA or nucleic acid target is unknown, as taught by both Watkins et al and Wright et al. One would be motivated to make such a substitution in an oligonucleotide made up of mostly ribonucleic acids due to inosine’s promiscuity, tendency to behave as guanosine, and nearest neighbor contributions (as taught by Watkins et al and Wright et al) for the benefit of increasing stability of RNA duplexes. One of skill could look to the combined teachings of Wettengel/Prakash/Shen and to the teachings of Watkins and Wright and arrive at the claimed invention with a high likelihood of success.
Thus, claim(s) 21 and 24 are obvious over Wettengel et al in view of Prakash et al and Shen et al in view of Watkins et al in further view of Wright et al.
Response to Arguments - Claim Rejections - 35 USC § 103
The previous rejection of claim(s) 12 and 19 under 35 U.S.C 103 for Anticipation is moot in view of Applicant’s cancellation of the claim filed 06/22/2026.
The previous rejection of claim(s) 13-14, 16, 17, 20, 30, and 31 under 35 U.S.C 103 as being unpatentable over Wettengel et al (supra) in view of Shen et al (supra), Applicant’s argument on pages 12-13 of the reply filed 06/22/2026 has been fully considered but is not persuasive for at least the following reasons:
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., the lack of stem loop) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
It is of note that Wettengel et al (supra) in view of Prakash et al (supra) and Shen et al (supra) does teach the amended claim 1, and the 35 U.S.C. 102(a)(2) rejection over Wettengel et al has been rewritten as a 35 U.S.C. 103 rejection above to include the newly added limitations. Thus, the argument provided has drawn merely conclusory statements but has not provided substantial reasoning as to why Wettengel et al in view of Shen are not obvious over claim(s) 13-14, 16, 17, 20, 30, and 31.
Further, in the amendments filed 06/22/2026, claim(s) 13-14 and 20 substitute the limitations of amended claim 1 with different limitations and therefore do not include all the limitations of the independent claim, see 35 U.S.C. 112(d) rejections above.
Thus, the 35 U.S.C 103 rejections on claim(s) 13-14 and 20 as being unpatentable over Wettengel et al (supra) in view of Shen et al (supra) are maintained.
The previous rejection of claim(s) 21 and 24 under 35 U.S.C 103 as being unpatentable over Wettengel et al (supra) in view of Watkins (supra) in further view of Wright (supra), Applicant’s argument on page 14 of the reply filed 06/22/2026 has been fully considered but is not persuasive for at least the following reasons:
Applicant contends that Watkins and Wright do not cure the deficiencies of Wettengel with respect to the amended claim 1 and claims dependent thereon.
It is of note that Wettengel et al (supra) in view of Prakash et al (supra) in view of Shen et al (supra) in view of Watkins et al (supra) in further view of Wright et al (supra) does teach the amended claim 1, and the 35 U.S.C. 103 rejection above has been rewritten to include the newly added limitations. Thus, the argument provided has drawn merely conclusory statements, but has not provided substantial reasoning as to why Wettengel et al in view of Watkin et al in further view of Wright et al are not obvious over claim(s) 21 and 24.
Double Patenting – New
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim(s) 1-7, 10-11, 15, and 27-30 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 1-4, 6-7, 10, 12-14, and 16-23 of copending Application No. 19/513, 287 in view of Prakash et al (supra) and Shen et al (supra). This is a new NSDP rejection because the filing date of the copending application is after the Office Action filed 01/22/2026.
Claim 1 of 287 recites, “An oligonucleotide or a pharmaceutically acceptable salt thereof, the oligonucleotide comprising: a first oligonucleotide that identifies a target RNA; and a second oligonucleotide linked to the 5' side of the first oligonucleotide, wherein the first oligonucleotide is composed of: a target-corresponding nucleoside residue corresponding to an adenosine residue in the target RNA; an oligonucleotide containing 3 to 6 residues, linked to the 5' side of the target- corresponding nucleoside residue, and having a base sequence complementary to the target RNA; and an oligonucleotide containing 10 to 24 residues, linked to the 3' side of the target- corresponding nucleoside residue, and having a base sequence complementary to the target RNA, wherein, in the oligonucleotide linked to the 3' side of the target-corresponding nucleoside residue, at least one phosphorus-containing linking group selected from the group consisting of a phosphorus-containing linking group linking a 1st nucleoside residue and a 2nd nucleoside residue and a phosphorus-containing linking group linking a 4th nucleoside residue and a 5th nucleoside residue, counting in the 3' direction from the target-corresponding nucleoside residue, is at least one selected from the group consisting of an alkylphosphonic residue, an alkyl phosphate residue, and a substituted phosphoramide residue, wherein, at the 3' end of the second oligonucleotide, a nucleoside residue corresponding to a nucleoside residue of the target RNA is deleted, or, at the 3' end, the second oligonucleotide has a nucleoside residue that does not form a complementary pair with the nucleoside residue of the target RNA, wherein the second oligonucleotide contains 2 to 10 residues, and nucleoside residues at least other than at the 3' end of the second oligonucleotide form a double-stranded structure complementary to the target RNA, wherein at least one of the first oligonucleotide or the second oligonucleotide comprises a phosphorothioate bond, and wherein the oligonucleotide or a pharmaceutically acceptable salt thereof induces site- specific editing in the target RNA.”
Claim 2 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein a nucleoside residue linked to the 3' side of the target- corresponding nucleoside residue is a 2'-deoxynucleoside residue.”
Claim 3 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein, in the oligonucleotide linked to the 3' side of the target-corresponding nucleoside residue, a 3rd nucleoside residue counting in the 3' direction from the target-corresponding nucleoside residue is a 2'-deoxy-2'-fluoronucleoside residue.”
Claim 4 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the second oligonucleotide contains 4 to 8 residues.”
Claim 6 of ‘287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the site-specific editing is caused by an enzymatic reaction due to adenosine deaminase 1.”
Claim 7 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the first oligonucleotide comprises a phosphorothioate bond.
Claim 10 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the first oligonucleotide comprises at least one modified nucleoside residue selected from the group consisting of a 2'-0- alkylribonucleoside residue, a 2'-deoxy-2'-fluororibonucleoside residue, a bridged nucleoside residue, and a 2'-deoxyribonucleoside residue.”
Claim 12 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein a nucleoside residue linked to the 5' side of the target-corresponding nucleoside residue is a 2'-O-alkylribonucleoside residue.”
Claim 13 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the second oligonucleotide comprises at least one modified nucleoside residue selected from the group consisting of a 2'-0- alkylribonucleoside residue, a 2'-deoxy-2'-fluororibonucleoside residue, and a bridged nucleoside residue.”
Claim 14 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the oligonucleotide linked to the 3' side of the target-corresponding nucleoside residue has a base sequence in which 2'-deoxy-2'- fluoronucleoside residues and 2'-O-alkylribonucleoside residues are alternately linked.
Claim 16 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein, in the first oligonucleotide, the oligonucleotide linked to the 5' side of the target-corresponding nucleoside residue has a base sequence in which 2'-O-alkylribonucleoside residues are consecutive.”
Claim 17 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the second oligonucleotide has a base sequence in which 2'-O-alkylribonucleoside residues and bridged nucleoside residues are alternately linked.
Claim 18 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the target-corresponding nucleoside residue is an N-alkylpyrimidine nucleoside residue or a 2'-deoxycytidine residue.”
Claim 19 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the second oligonucleotide comprises nucleoside residues linked by a phosphorothioate bond.”
Claim 20 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the first oligonucleotide contains a bridged nucleoside residue as the 10th or a subsequent nucleoside residue counting in the 3' direction from the target-corresponding nucleoside residue.”
Claim 21 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 20, wherein, in the first oligonucleotide, an oligonucleotide containing the 10th nucleoside residue and subsequent nucleoside residues counting in the 3' direction from the target-corresponding nucleoside residue has a base sequence in which 2'-0- alkylribonucleoside residues and bridged nucleoside residues are alternately linked.”
Claim 22 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein the second oligonucleotide contains a bridged nucleoside residue as the 2nd or a subsequent nucleoside residue counting in the 5' direction from a nucleoside residue at the 3' end of the second oligonucleotide.”
Claim 23 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 22, wherein the second oligonucleotide comprises three or more nucleoside residues, and wherein an oligonucleotide containing the 2nd nucleoside residue and subsequent nucleoside residues counting in the 5' direction from the nucleoside residue at the 3' end of the second oligonucleotide has a base sequence in which 2'-O-alkylribonucleoside residues and bridged nucleoside residues are alternately linked.”
Claim 1 of 287, does not require that (a) the oligonucleotide linked to the 3’ side of the target corresponding nucleotide residue has a base sequence in which a 2’-deoxy-2’fluoro residue and a 2’-O-alkyl ribonucleotide residue are alternately linked, and (b) the second oligonucleotide has a base sequence in which a 2’-O-alkyl ribonucleotide residue and a bridged nucleotide are alternately linked.
Prakash et al teaches, “In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2’-OMe, 2’-F, 2’-MOE, LNA, and cEt. In certain embodiments, the alternating modifications are 2’-F and 2’- OMe. Such regions may be contiguous or may be interrupted by differently modified nucleosides or conjugated nucleosides.”, (p. 57, lines 4-10).
“In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5’ terminal nucleoside, such as those of formula IIc or IIe. In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A)2-(B)x-(A)2-(C)y-(A)3- wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another.”, (p. 58, lines 1-6).
Claim 1 of 287 and Prakash et al do not require/teach properties of nucleotide modifications.
Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify claim 1 of 287 with the teachings of Prakash et al, i.e., alternating nucleotide modifications in differing regions of an oligonucleotide, in further view of the teachings of Shen et al, i.e., the benefits of the modifications to oligonucleotides, to yield the predictable results of an oligonucleotide comprising two oligonucleotides wherein one comprises a base sequence of 2’-deoxy-fluoro and 2’O-methyl alternately linked and the other comprises a base sequence of 2’O-methyl and a bridged nucleic acid alternately linked. One would have been motivated to do so because claim 1 of 287 requires an oligonucleotide comprised of two oligonucleotides, wherein one of the two oligonucleotides identifies a target RNA and the other oligonucleotide is a recruiting moiety, Prakash et al teaches that oligonucleotides can have altering modifications in different regions, even up to three different modifications, such as 2’O-methyl, 2’fluoro, and a bridged nucleic acid, and Shen et al teaches that these modifications increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing. One of skill in the art could look to the teachings of claim 1 of 287, in view of Prakash et al, in further view of Shen et al, and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim(s) 1-7, 10-11, 15, and 27-30 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending Application No. 19/513,287 in view of Prakash et al (supra) and Shen et al (supra).
This is a provisional nonstatutory double patenting rejection.
Claim 13 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 15 of copending Application No. 19/513, 287 in view of Prakash et al (supra) and Shen et al (supra). This is a new NSDP rejection because the filing date of the copending application is after the Office Action filed 01/22/2026.
It is of note that in the amendments filed 06/22/2026, claim 13 substitutes a limitation of amended claim 1 with a different limitation and therefore does not include all of the limitations of the independent claim, see 35 U.S.C. 112(d) rejections above.
Claim 15 of 287 recites, “The oligonucleotide or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 14, wherein the oligonucleotide linked to the 3' side of the target-corresponding nucleoside residue has a base sequence in which bridged nucleoside residues and 2'-O-alkylribonucleoside residues are alternately linked.” Claim 1 can be found recited in the above rejection.
Claim 15 of 287 does not require the second oligonucleotide has a base sequence in which 2’O-alkyl ribonucleotide residues and bridge nucleotide residues are alternately linked.
Prakash et al teaches, “In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2’-OMe, 2’-F, 2’-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2’-F and 2’- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.”, (p. 57, lines 4-10).
Moreover, Prakash et al teaches, “In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB)xAy wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; or
ABABBAABBABABAA;
wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2’-F, 2’-OMe, BNA, and MOE.”, (p. 57, lines 11-28). “In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5’ terminal nucleoside, such as those of formula IIc or IIe. In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A)2-(B)x-(A)2-(C)y-(A)3- wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another.”, (p. 58, lines 1-6).
Claim 15 of 287 and Prakash et al do not require/teach properties of nucleotide modifications.
Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide of claim 15 of 287 with the teachings of Prakash et al, i.e., alternating nucleotide residue modifications in differing regions of an oligonucleotide, and the teachings of Shen et al, i.e., the benefits of the modifications to oligonucleotides, to yield the predictable results of an oligonucleotide comprising two oligonucleotides wherein one (the oligonucleotide that is 3’ of the target-corresponding nucleotide) comprises a base sequence of bridged nucleotide and 2’O-methyl nucleic acid residues alternately linked and the other (the second oligonucleotide) comprises a base sequence of 2’O-methyl and bridged nucleic acid residues alternately linked. One would have been motivated to do so because claim 15 of 287 requires an oligonucleotide comprised of two oligonucleotides: one that identifies a target RNA and the other that is second oligonucleotide. Prakash et al teaches that oligonucleotides can have alternating modifications, such as 2’O-methyl, 2’fluoro, and bridged nucleic acid residues, and Shen et al teaches that these modifications increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing. One of skill in the art could look to the requirements of claim 15 of 287 and the teachings of Prakash et al and Shen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim 13 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending Application No. 19/513,287 in view of Prakash et al (supra) and Shen et al (supra).
Claim 14 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of copending Application No. 19/513, 287 in view of Prakash et al (supra) and Shen et al (supra). This is a new NSDP rejection because the filing date of the copending application is after the Office Action filed 01/22/2026.
It is of note that in the amendments filed 06/22/2026, claim 14 substitutes a limitation of amended claim 1 with a different limitation and therefore does not include all of the limitations of the independent claim, see 35 U.S.C. 112(d) rejections above.
The recitation of claim 1 of 287 can be found in the above rejection.
Claim 1 of 287 does not require (a) wherein the oligonucleotide linked to the 3’-side of the target corresponding nucleotide residue has a base sequence in which bridged nucleotide residues and 2’-deoxy-fluoronucleotide residues are alternately linked; and (b) the second oligonucleotide has a base sequence in which 2’O-alkyl ribonucleotide residues and bridge nucleotide residues are alternately linked.
Prakash et al teaches, “In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2’-OMe, 2’-F, 2’-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2’-F and 2’- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.”, (p. 57, lines 4-10).
Moreover, Prakash et al teaches, “In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB)xAy wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; or
ABABBAABBABABAA;
wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2’-F, 2’-OMe, BNA, and MOE.”, (p. 57, lines 11-28). “In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5’ terminal nucleoside, such as those of formula IIc or IIe. In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A)2-(B)x-(A)2-(C)y-(A)3- wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another.”, (p. 58, lines 1-6).
Claim 1 of 287 and Prakash et al do not require/teach properties of nucleotide modifications.
Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1). Shen et al further teaches that, “The 2’ -oxygen can also be linked through bridging carbons to the 4’ carbon of the ribose to form a bridged nucleic acid (BNA). Perhaps the most commonly used BNA in laboratories is locked nucleic acid (LNA) characterized by a 2’ ,4’ -methylene linkage… BNA is an especially useful type of modification for increasing the strength of hybridization. The 2’ ,4’ -constraint locks the ribose in a conformation that is ideal for binding complementary sequences, reducing the entropic price paid during Watson–Crick base-pairing.”, (Page 1585, Column 2, Paragraph 3 and 4).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide of claim 1 of 287 with the teachings of Prakash et al, i.e., alternating nucleotide residue modifications in differing regions of an oligonucleotide, and the teachings of Shen et al, i.e., the benefits of the modifications to oligonucleotides, to yield the predictable results of an oligonucleotide comprising two oligonucleotides wherein one (the oligonucleotide that is 3’ of the target-corresponding nucleotide) comprises a base sequence of bridged nucleotide and 2’-deoxy-fluoro nucleic acid residues alternately linked and the other (the second oligonucleotide) comprises a base sequence of 2’O-methyl and bridged nucleic acid residues alternately linked. One would have been motivated to do so because claim 1 of 287 requires an oligonucleotide comprised of two oligonucleotides: one that identifies a target RNA and the second oligonucleotide. Prakash et al teaches that oligonucleotides in differing regions can have alternating modifications (up to three different), such as 2’O-methyl, 2’fluoro, and bridged nucleic acid residues, and Shen et al teaches that these modifications increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety, increasing the thermal stability of complementary hybridization, and reducing the entropic price paid during Watson–Crick base-pairing. One of skill in the art could look to the requirements of claim 1 of 287 and the teachings of Prakash et al and Shen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim 14 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending Application No. 19/513,287 in view of Prakash et al (supra) and Shen et al (supra).
Claim 20 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of copending Application No. 19/513, 287 in view of Prakash et al (supra) and Shen et al (supra). This is a new NSDP rejection because the filing date of the copending application is after the Office Action filed 01/22/2026.
It is of note that in the amendments filed 06/22/2026, claim 20 substitutes a limitation of amended claim 1 with a different limitation and therefore does not include all of the limitations of the independent claim, see 35 U.S.C. 112(d) rejections above.
The recitation of claim 1 of 287 can be found in the above rejection.
Claim 1 of 287 does not require (a) wherein the oligonucleotide linked to the 3’-side of the target corresponding nucleotide residue has a base sequence in which 2’-O-alkyl ribonucleotide and 2’-deoxy-fluoronucleotide residues are alternately linked; and (b) the second oligonucleotide has a base sequence in which 2’O-alkyl ribonucleotide residues and 2’-deoxy-fluoro residues are alternately linked.
Prakash et al teaches, “In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2’-OMe, 2’-F, 2’-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2’-F and 2’- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.”, (p. 57, lines 4-10).
Moreover, Prakash et al teaches, “In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB)xAy wherein A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; or
ABABBAABBABABAA;
wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2’-F, 2’-OMe, BNA, and MOE.”, (p. 57, lines 11-28). “In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5’ terminal nucleoside, such as those of formula IIc or IIe. In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A)2-(B)x-(A)2-(C)y-(A)3- wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another.”, (p. 58, lines 1-6).
Claim 1 of 287 and Prakash et al do not require/teach properties of nucleotide modifications.
Shen et al teaches how modifications to an oligonucleotide and their uses in clinical settings. More specifically, Shen et al teaches, “Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease.”, (Abstract). Shen et al suggests, “Identification of a lead compound that can bind to an RNA target with high affinity can be as simple as designing a complementary oligonucleotide followed by routine synthesis and testing.”, (Page 1584, Column 1, Paragraph 1). Shen et al continues to suggest, “Single-stranded DNA and RNA oligonucleotides have properties that complicate drug development. Unfavorable properties include: (i) degradation by nucleases when introduced into biological systems, (ii) poor uptake through cell membranes, (iii) unfavorable biodistribution and pharmacokinetic properties and (iv) sub-optimal binding affinity for complementary sequences. To improve these properties, oligonucleotides must be chemically modified by changing the phosphodiester linkages, the ribose backbone or the nucleobases.”, (Page 1585, Column 1, Paragraph 1 and 2; and Figure 2).
Shen et al continues to teach that 2’-Ribose modifications are a common class of alterations and can be done through the replacement of the 2’-hydroxyl by 2’-O-methyl, 2’-O-methoxyethyl and 2’-fluoro. These modifications increase stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increases the thermal stability of complementary hybridization (Page 1585, Column 1, Paragraph 5 to Column 2, Paragraph 1).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligonucleotide of claim 1 of 287 with the teachings of Prakash et al, i.e., alternating nucleotide residue modifications in differing regions of an oligonucleotide, and the teachings of Shen et al, i.e., the benefits of the modifications to oligonucleotides, to yield the predictable results of an oligonucleotide comprising two oligonucleotides wherein one (the oligonucleotide that is 3’ of the target-corresponding nucleotide) comprises a base sequence of 2’O-methyl ribonucleotide and 2’-deoxy-fluoro nucleic acid residues alternately linked and the other (the second oligonucleotide) comprises a base sequence of 2’O-methyl and 2’-deoxy-fluoronucleotide residues alternately linked. One would have been motivated to do so because claim 1 of 287 requires an oligonucleotide comprised of two oligonucleotides: one that identifies a target RNA and the second oligonucleotide. Prakash et al teaches that oligonucleotides can have alternating modifications such as 2’O-methyl and 2’fluoro, and Shen et al teaches that these modifications increasing stability toward digestion by nucleases by blocking the nucleophilic 2’ hydroxy moiety and increasing the thermal stability of complementary hybridization. One of skill in the art could look to the requirements of claim 1 of 287 and the teachings of Prakash et al and Shen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim 20 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending Application No. 19/513,287 in view of Prakash et al (supra) and Shen et al (supra).
Conclusion
No claim(s) allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights