Prosecution Insights
Last updated: July 17, 2026
Application No. 18/265,773

LENTIVIRAL VECTORS FOR THERAPEUTIC EXPRESSION OF BTK IN HEMATOPOIETIC CELLS

Non-Final OA §101§102§103§112§DP
Filed
Jun 07, 2023
Priority
Dec 07, 2020 — provisional 63/122,017 +3 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Noga Therapeutics Ltd.
OA Round
1 (Non-Final)
38%
Grant Probability
At Risk
1-2
OA Rounds
11m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
282 granted / 741 resolved
-21.9% vs TC avg
Strong +53% interview lift
Without
With
+52.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
55 currently pending
Career history
807
Total Applications
across all art units

Statute-Specific Performance

§101
0.4%
-39.6% vs TC avg
§103
57.8%
+17.8% vs TC avg
§102
6.6%
-33.4% vs TC avg
§112
10.0%
-30.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 741 resolved cases

Office Action

§101 §102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 1-2, 5-10, 12, 16, 20-27 and 29-30 are pending in the present application. Applicant’s election of Group I in the reply filed on 05/11/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Applicant also elected the following species: (i) SEQ ID NO: 4 for the first nucleic acid molecule; (ii) SEQ ID NO: 10 for the second nucleic acid molecule; (iii) SEQ ID NO: 24 for the polynucleotide; and (iv) B cell for a cell. Accordingly, claims 20-27 and 29-30 were withdrawn from further consideration because they are directed to a non-elected invention. Claims 1-2, 5-10, 12 and 16 are examined on the merits herein with the above elected species. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-2, 5-9, 12 and 16 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (a product of nature exception) without significantly more. The instant claims are directed to a polynucleotide comprising: (a) a first nucleic acid molecule comprising a sequence of between 799 to 1,533 nucleotides of a human endogenous Bruton’s tyrosine kinase (BTK) promoter; and (b) a second nucleic acid molecule comprising a codon optimized sequence encoding a BTK or a functional analog thereof (e.g., the wild-type human BTK coding sequence of SEQ ID NO: 8, see dependent claim 7, paragraph [077] and Table 2), wherein said first nucleic acid molecule and said second nucleic acid molecule are operably linked, and wherein said codon optimized is for BTK expression in a subject, cell derived therefrom, or both; a cell (e.g., a B cell, a myeloid cell, and a hematopoietic stem cell) comprising the same polynucleotide and a composition comprising the same polynucleotide or the same cell, and an acceptable carrier. Thus, the instant claims are product claims. (Step 1, YES). These claims encompass at least a naturally occurring human wild-type BTK gene and a naturally occurring human B cell containing the wild-type BTK gene in physiological fluid/blood. In the instant case, there is no indication at least that the claimed polynucleotide, human B cell or composition possesses any characteristics (structural, functional, or otherwise) that is different from its naturally occurring counterpart; and therefore it is a “product of nature” exception and the claims are directed to an exception. Additionally, patent eligibility also requires more than the “hand of man” (e.g., the term isolated or purified); and to be eligible the claimed product must be both non-naturally occurring and markedly different from naturally occurring products. In addition to the second nucleic acid molecule comprising the human wild-type BTK coding sequence of SEQ ID NO: 8, the first nucleic acid molecule comprises the human wild-type BTK promoter sequence of SEQ ID NO: 4 and the third nucleic acid molecule comprises human wild-type 5’-UTR sequence of SEQ ID NO: 14 as evidenced at least by the disclosed human Bruton agammaglobulinemia tyrosine kinase DNA of SEQ ID NO: 622 (2579 bp) comprising the sequence of nucleotides 165-2144 that is 100% identical to SEQ ID NO: 8, and the 5’ flanking UTR sequence of nucleotides 5-164 that is 100% identical to SEQ ID NO: 14 by Bancel et al (US 9,587,003; IDS) and the human BTK promoter of SEQ ID NO: 44,197 (2,300 nucleotides) having the sequence of nucleotides 1071-2103 that is 100% identical to SEQ ID NO: 4 that is taught by Trinklein et al (US 2007/0161031; IDS). Please also see attached sequence searches below. When viewed individually or in their context within the claims as a whole, dependent claims 2, 5-9, 12 and 16 recite additional claim elements that do not provide meaningful limitations to the invention such that the claimed invention amounts to significantly more than the natural product itself. With respect to dependent claims 6-9, it is noted that the limitation “a nucleic acid sequence set forth in” is not necessarily limited to the full-length nucleic acid sequence set forth in any one of the recited SEQ ID NOs. For example, a polynucleotide comprising a nucleic acid sequence set forth in SEQ ID NO: 24 (the combination of SEQ ID NO: 4 + SEQ ID NO: 14 + Kozak sequence + SEQ ID NO: 10; see Table 4 of the instant specification and dependent claim 9) includes a polynucleotide comprising any nucleic acid sequence as long as the nucleic acid sequence is in the sequence of SEQ ID NO: 24. Accordingly, claims 1-2, 5-9, 12 and 16 are directed to an exception (Step 2A, prong one: YES). Since the claims are directed to a composition comprising a natural product, the claims do not recite additional steps that integrate the judicial exception into a practical application, and therefore it does not add a meaningful limitation to distinguish the claimed purified RNA molecule from its naturally occurring counterpart. (Step 2A, prong two: NO). In view of the above and considered as a whole, the claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the recited first, second and third nucleic acid molecules, a cell and an acceptable carrier (e.g., a physiological solution) still do not render the claimed polynucleotide, a cell or a composition markedly different from its naturally occurring counterpart. (Step 2B: NO). For these reasons, claims 1-2, 5-9, 12 and 16 are rejected under section 101 as being directed to non-statutory subject matter. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 5 and 8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 5 recites the limitation "said regulatory element" in line 1 of the claim. There is insufficient antecedent basis for this limitation in the claim. This is because independent claim 1 from which claim 5 is dependent upon does not recite any regulatory element. Accordingly, it is unclear which particular regulatory element does Applicant refer to. Clarification is requested because the metes and bounds of the claim are not clearly determined. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1-2, 6-7, 9-10, 12 and 16 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Rawlings et al (WO 2018/195297; IDS). The instant claims are directed to a polynucleotide (e.g., a polynucleotide comprising a nucleic acid sequence set forth in the elected SEQ ID NO: 24) comprising: (a) a first nucleic acid molecule comprising a sequence of between 799 to 1,533 nucleotides of a human endogenous Bruton’s tyrosine kinase (BTK) promoter (e.g., a nucleic acid sequence set forth in the elected SEQ IDNO: 4) ; and (b) a second nucleic acid molecule comprising a codon optimized sequence encoding a BTK or a functional analog thereof (e.g., a nucleic acid sequence set forth in the elected SEQ ID NO: 10), wherein said first nucleic acid molecule and said second nucleic acid molecule are operably linked, and wherein said codon optimized is for BTK expression in a subject, cell derived therefrom, or both; an expression vector (e.g., a lentivirus-based expression vector) or a cell (e.g., a B cell or a hematopoietic stem cell) comprising the same polynucleotide; and a composition comprising the same polynucleotide, expression vector or cell and an acceptable carrier. Please note that a nucleic acid sequence set forth in SEQ ID NO: 4, 10, or 24 includes any nucleic acid sequence that is set forth in SEQ ID NO: 4, 10, or 24; and not necessarily limited to the sequence of SEQ ID NO: 4, 10, or 24. Rawlings et al already disclosed at least a lentiviral-based vector comprising a BTK promoter, preferably a BTK promoter comprising the nucleic acid sequence of SEQ ID NO:5 which is the human 837-nucleotide BTK gene promoter that is operably linked to a codon-optimized sequence encoding BTK for expression in humans (e.g., the sequence of SEQ ID NO: 6 or SEQ ID NO: 7), wherein the vector mediates sustained BTK expression in B and myeloids cells derived from hematopoietic stem cells; a B cell or a CD34+ hematopoietic stem cell comprising the same lentiviral-based vector, and a composition comprising the same genetically modified B cell or CD34+ hematopoietic stem cell to be administered into a subject in need of treating, inhibiting or ameliorating X linked agammaglobulinemia (XLA) (see at least Abstract; Summary of the Invention; particularly paragraphs [0006]-[0010], [0012] and [0258]; FIGs. 2, 9, 17, 23; SEQ ID NOs: 5 and attached sequence searches below). SEQ ID NO: 5 contains the nucleotide sequence of residues 1-799 that is 100% identical to the sequence of nucleotides 235-1033 of SEQ ID NO: 4 of the present application (a sequence set forth in SEQ ID NO: 4); and SEQ ID NO: 7 also contains a nucleic acid sequence (e.g., nucleotides 58-68, 304-323, 592-626) that is 100% identical to a corresponding nucleic acid sequence set forth in SEQ ID NO: 10. Accordingly, a lentiviral-based vector Rawlings et al also contains a nucleotide sequence set forth in SEQ ID NO: 24 (the combination of SEQ ID NO: 4 + SEQ ID NO: 14 + Kozak sequence + SEQ ID NO: 10) of the present application. Rawlings et al also taught that the lentiviral vector further comprises a truncated ubiquitous chromatin opening element (UCOE) element, a conserved enhancer element derived from intronic regions within the human BTK locus in association with the human BTK proximal promoter to drive expression of a human codon-optimized BTK cDNA (paragraph [0006]). The administered composition for XLA treatment must contain an acceptable carrier (e.g., a sterile physiological solution and/or cell culture medium), otherwise the genetically modified B cell or CD34+ hematopoietic stem cell would not be viable and/or amenable for administering into a subject in need thereof. The teachings of Rawlings et al meet every limitation of the instant claims. Therefore, the reference anticipates the instant claims. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Alternatively, claims 1 and 16 (the embodiment c.) are rejected under 35 U.S.C. 103 as being unpatentable over Rawlings et al (WO 2018/195297; IDS). Rawlings et al already disclosed at least a lentiviral-based vector comprising a BTK promoter, preferably a BTK promoter comprising the nucleic acid sequence of SEQ ID NO:5 which is the human 837-nucleotide BTK gene promoter that is operably linked to a codon-optimized sequence encoding BTK for expression in humans (e.g., the sequence of SEQ ID NO: 6 or SEQ ID NO: 7), wherein the vector mediates sustained BTK expression in B and myeloids cells derived from hematopoietic stem cells; a B cell or a CD34+ hematopoietic stem cell comprising the same lentiviral-based vector, and a composition comprising the same genetically modified B cell or CD34+ hematopoietic stem cell to be administered into a subject in need of treating, inhibiting or ameliorating X linked agammaglobulinemia (XLA) (see at least Abstract; Summary of the Invention; particularly paragraphs [0006]-[0010], [0012] and [0258]; FIGs. 2, 9, 17, 23; SEQ ID NOs: 5 and attached sequence searches below). SEQ ID NO: 5 contains the nucleotide sequence of residues 1-799 that is 100% identical to the sequence of nucleotides 235-1033 of SEQ ID NO: 4 of the present application (a sequence set forth in SEQ ID NO: 4); and SEQ ID NO: 7 also contains a nucleic acid sequence (e.g., nucleotides 58-68, 304-323, 592-626) that is 100% identical to a corresponding nucleic acid sequence set forth in SEQ ID NO: 10. Accordingly, a lentiviral-based vector Rawlings et al also contains a nucleotide sequence set forth in SEQ ID NO: 24 (the combination of SEQ ID NO: 4 + SEQ ID NO: 14 + Kozak sequence + SEQ ID NO: 10) of the present application. Rawlings et al also taught that the lentiviral vector further comprises a truncated ubiquitous chromatin opening element (UCOE) element, a conserved enhancer element derived from intronic regions within the human BTK locus in association with the human BTK proximal promoter to drive expression of a human codon-optimized BTK cDNA (paragraph [0006]). Although Rawlings et al did not teach explicitly a composition comprising the genetically modified B cell or CD34+ hematopoietic stem cell, and an acceptable carrier to be administered into a subject in need of XLA treatment, it would have been obvious for an ordinary skilled in the art before the effective filing date of the present application that a composition containing the genetically modified B cell or hematopoietic stem cell to be administered into a subject in need of XLA treatment must contain an acceptable carrier such as a sterile physiological solution and/or a suitable culture medium to keep the administered cell viable and/or in a suitable form for administration with a predictable expectation of success. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claims 1-2, 5 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Rawlings et al (WO 2018/195297; IDS) in view of Bancel et al (US 9,587,003; IDS). Rawlings et al already disclosed at least a lentiviral-based vector comprising a BTK promoter, preferably a BTK promoter comprising the nucleic acid sequence of SEQ ID NO:5 which is the human 837-nucleotide BTK gene promoter that is operably linked to a codon-optimized sequence encoding BTK for expression in humans (e.g., the sequence of SEQ ID NO: 6 or SEQ ID NO: 7), wherein the vector mediates sustained BTK expression in B and myeloids cells derived from hematopoietic stem cells; a B cell or a CD34+ hematopoietic stem cell comprising the same lentiviral-based vector, and a composition comprising the same genetically modified B cell or CD34+ hematopoietic stem cell to be administered into a subject in need of treating, inhibiting or ameliorating X linked agammaglobulinemia (XLA) (see at least Abstract; Summary of the Invention; particularly paragraphs [0006]-[0010], [0012] and [0258]; FIGs. 2, 9, 17, 23; SEQ ID NOs: 5 and attached sequence searches below). SEQ ID NO: 5 contains the nucleotide sequence of residues 1-799 that is 100% identical to the sequence of nucleotides 235-1033 of SEQ ID NO: 4 of the present application (a sequence set forth in SEQ ID NO: 4); and SEQ ID NO: 7 also contains a nucleic acid sequence (e.g., nucleotides 58-68, 304-323, 592-626) that is 100% identical to a corresponding nucleic acid sequence set forth in SEQ ID NO: 10. Accordingly, a lentiviral-based vector Rawlings et al also contains a nucleotide sequence set forth in SEQ ID NO: 24 (the combination of SEQ ID NO: 4 + SEQ ID NO: 14 + Kozak sequence + SEQ ID NO: 10) of the present application. Rawlings et al also taught that the lentiviral vector further comprises a truncated ubiquitous chromatin opening element (UCOE) element, a conserved enhancer element derived from intronic regions within the human BTK locus in association with the human BTK proximal promoter to drive expression of a human codon-optimized BTK cDNA (paragraph [0006]). Rawlings et al did not teach specifically a lentiviral-based vector further comprising a sequence derived from an untranslated region (UTR) of a human BTK transcript (e.g., a nucleic acid sequence set forth in the elected SEQ ID NO: 14) that is located between the promoter sequence and the codon optimized sequence encoding BTK. Before the effective filing date of the present application, Bancel et al already disclosed a wild-type human Bruton agammaglobulinemia tyrosine kinase DNA of SEQ ID NO: 622 (2579 bp) comprising the sequence of nucleotides 165-2144 that is 100% identical to SEQ ID NO: 8 (human 1980-nucleotide BTK coding sequence) of the present application, and the 5’ flanking UTR sequence of nucleotides 5-164 that is 100% identical to SEQ ID NO: 14 (160-nucleotide sequence) of the present application as an oncology-related primary construct for therapeutic use of polynucleotides, primary transcripts and modified mRNA molecules (see at least the Abstract; particularly col. 9, line 56 continues to line 23 on col. 10; col. 28, lines 37-63; col. 37, line 20 continues to line 59 on col. 38; col. 69, line 65 continues to line 6 on col. 72; Table 6; Figure 1; and attached sequence searches). Bancel et al stated “The oncology-related polypeptides of interest or “targets” or oncology-related proteins and oncology-related peptides of the present invention are listed in Lengthy Table 6 and Table 7” (col. 70, lines 47-50). Moreover, Bancel et al also stated clearly “There is growing body of evidence about the regulatory roles played by the UTRs in terms of stability of the nucleic acid molecule and translation. The regulatory features of a UTR can be incorporated into the oncology-related polynucleotides, oncology-related primary constructs and/or oncology-related mmRNA of the present invention to enhance the stability of the molecule” (col. 28, lines 43-49). Accordingly, it would have been obvious for an ordinary skilled artisan before the effective filing date of the present application to modify the teachings of Rawlings et al by also incorporating at least the 5’-UTR sequence of human BTK having SEQ ID NO: 14 immediately upstream of the human BTK coding sequence for BTK expression in a lentiviral-based vector, in light of the teachings of Bancel et al as presented above. An ordinary skilled artisan would have been motivated to carry out the above modification because Bancel et al already disclosed a wild-type human BTK DNA of SEQ ID NO: 622 (2579 bp) comprising the sequence of nucleotides 165-2144 that is 100% identical to SEQ ID NO: 8 (human 1980-nucleotide BTK coding sequence) of the present application, and the 5’ flanking UTR sequence of nucleotides 5-164 that is 100% identical to SEQ ID NO: 14 (160-nucleotide sequence) of the present application; as well as disclosing the regulatory roles played by the UTRs in terms of stability of the nucleic acid molecule and translation. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Rawlings et al and Bancel et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-2, 5-10, 12 and 16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 of U.S. Patent No. 11,464,872. Although the claims at issue are not identical, they are not patentably distinct from each other because a polynucleotide comprising: a) a first nucleic acid molecule comprising a sequence of between 799 to 1,533 nucleotides of a human endogenous Bruton”s tyrosine kinase (BTK) promoter; and b) a second nucleic acid molecule comprising a codon optimized sequence encoding a BTK or a functional analog thereof, wherein said first nucleic acid molecule and said second nucleic acid molecule are operably linked, and wherein said codon optimized sequence is for BTK expression in a human subject, cell derived therefrom, or both, and wherein said polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 23 (the combination of SEQ ID NO: 4 + SEQ ID NO: 14 + Kozak sequence + SEQ ID NO: 9; see Table 4); an expression vector or a hematopoietic stem cell comprising the same polynucleotide; and a composition comprising the same hematopoietic stem cell and a pharmaceutically acceptable carrier in claims 1-5 of U.S. Patent 11,464,872 anticipate a polynucleotide, an expression vector, a cell and a composition in the application being examined and, therefore, a patent to the genus would, necessarily, extend the rights of the species or sub- should the genus issue as a patent after the species of sub-genus. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Trinklein et al (US 2007/0161031; IDS) already disclosed high throughput methods for structural and functional characterization of gene expression regulatory elements (e.g., transcriptional promoters) in a human genome, including SEQ ID NO: 44,197 (2,300 nucleotides) having the sequence of nucleotides 1071-2103 that is 100% identical to SEQ ID NO: 4 (1033 nucleotides), that is operably linked with a reporter sequence in an expression vector (Abstract; Summary of the Invention; particularly paragraphs [0008], [0013] and [0311]; and attached sequence search below). Examiner’s Comment The prior art does not teach or fairly suggest a polynucleotide comprising the sequence of SEQ ID NO: 24 of the present application. Conclusions No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s acting SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/Primary Examiner, Art Unit 1631 Human BTK gene promoter, SEQ ID 5. WO2018195297-A1. Query Match 77.3%; Score 799; DB 60; Length 837; Best Local Similarity 100.0%; Matches 799; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 235 TGCATTTCCTAGGAGAATCCCTGGGGGAATCATTGCAGTTGGAGCATAATGTAGGGGGCC 294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 TGCATTTCCTAGGAGAATCCCTGGGGGAATCATTGCAGTTGGAGCATAATGTAGGGGGCC 60 Qy 295 CCTGAGAAAACCTCCAGGCTTCAAGTGACATACCTAGTCTGCTTTACCGGTTTACAGGAC 354 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCTGAGAAAACCTCCAGGCTTCAAGTGACATACCTAGTCTGCTTTACCGGTTTACAGGAC 120 Qy 355 TCAAGAGAAAGGTGGACATTGAGAGTTAATCCCTGAGGCCAAATCTTAAATGGAGAAAGT 414 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TCAAGAGAAAGGTGGACATTGAGAGTTAATCCCTGAGGCCAAATCTTAAATGGAGAAAGT 180 Qy 415 CAACATCCACAGAAAATGGGGAAGGGCACAAGTATTTCTGTGGGCTTATATTCCGACATT 474 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CAACATCCACAGAAAATGGGGAAGGGCACAAGTATTTCTGTGGGCTTATATTCCGACATT 240 Qy 475 TTTATCTGTAGGGGAAAAATGCTTTCTTAGAAAATGACTCAGCACGGGGAAGTCTTGTCT 534 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TTTATCTGTAGGGGAAAAATGCTTTCTTAGAAAATGACTCAGCACGGGGAAGTCTTGTCT 300 Qy 535 CTACCTCTGTCTTGTTTTGTCCTTTGGGGTCCCTTCACTATCAAGTTCAACTGTGTGTCC 594 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CTACCTCTGTCTTGTTTTGTCCTTTGGGGTCCCTTCACTATCAAGTTCAACTGTGTGTCC 360 Qy 595 CTGAGACTCCTCTGCCCCGGAGGACAGGAGACTCGAAAAACGCTCTTCCTGGCCAGTCTC 654 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CTGAGACTCCTCTGCCCCGGAGGACAGGAGACTCGAAAAACGCTCTTCCTGGCCAGTCTC 420 Qy 655 TTTGCTCTGTGTCTGCCAGCCCCCAGCATCTCTCCTCTTTCCTGTAAGCCCCTCTCCCTG 714 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TTTGCTCTGTGTCTGCCAGCCCCCAGCATCTCTCCTCTTTCCTGTAAGCCCCTCTCCCTG 480 Qy 715 TGCTGACTGTCTTCATAGTACTTTAGGTATGTTGTCCCTTTACCTCTGGGAGGATAGCTT 774 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TGCTGACTGTCTTCATAGTACTTTAGGTATGTTGTCCCTTTACCTCTGGGAGGATAGCTT 540 Qy 775 GATGACCTGTCTGCTCAGGCCAGCCCCATCTAGAGTCTCAGTGGCCCCAGTCATGTTGAG 834 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GATGACCTGTCTGCTCAGGCCAGCCCCATCTAGAGTCTCAGTGGCCCCAGTCATGTTGAG 600 Qy 835 AAAGGTTCTTTCAAAGATAGACTCAAGATAGTAGTGTCAGAGGTCCCAAGCAAATGAAGG 894 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AAAGGTTCTTTCAAAGATAGACTCAAGATAGTAGTGTCAGAGGTCCCAAGCAAATGAAGG 660 Qy 895 GCGGGGACAGTTGAGGGGGTGGAATAGGGACGGCAGCAGGGAACCAGATAGCATGCTGCT 954 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GCGGGGACAGTTGAGGGGGTGGAATAGGGACGGCAGCAGGGAACCAGATAGCATGCTGCT 720 Qy 955 GAGAAGAAAAAAAGACATTGGTTTAGGTCAGGAAGCAAAAAAAGGGAACTGAGTGGCTGT 1014 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 GAGAAGAAAAAAAGACATTGGTTTAGGTCAGGAAGCAAAAAAAGGGAACTGAGTGGCTGT 780 Qy 1015 GAAAGGGTGGGGTTTGCTC 1033 ||||||||||||||||||| Db 781 GAAAGGGTGGGGTTTGCTC 799 Human BTK coding codon-optimized DNA, SEQ ID 7. WO2018195297-A1. Query Match 78.3%; Score 1551.2; Length 1980; Best Local Similarity 86.5%; Matches 1712; Conservative 0; Mismatches 268; Indels 0; Gaps 0; Qy 1 ATGGCCGCTGTGATTCTGGAGAGCATCTTCCTCAAGAGGTCCCAGCAGAAGAAGAAGACC 60 |||||||| ||||| ||||| ||||||||||| ||| || ||||||||||||||| ||| Db 1 ATGGCCGCCGTGATCCTGGAAAGCATCTTCCTGAAGCGGAGCCAGCAGAAGAAGAAAACC 60 Qy 61 AGCCCCCTCAACTTCAAGAAGAGGCTGTTCCTCCTCACCGTCCATAAGCTGAGCTACTAC 120 |||||||| |||||||||||| |||||||||| || ||||| || |||||| ||||||| Db 61 AGCCCCCTGAACTTCAAGAAGCGGCTGTTCCTGCTGACCGTGCACAAGCTGTCCTACTAC 120 Qy 121 GAGTACGACTTCGAAAGGGGAAGAAGGGGCTCCAAAAAGGGCTCCATCGACGTGGAGAAG 180 |||||||||||||| |||| ||| ||||| ||| |||||| ||||||||| |||||| Db 121 GAGTACGACTTCGAGCGGGGCAGACGGGGCAGCAAGAAGGGCAGCATCGACGTCGAGAAG 180 Qy 181 ATCACATGCGTGGAAACCGTGGTCCCCGAAAAAAATCCCCCCCCCGAAAGGCAGATCCCC 240 ||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||||||||| Db 181 ATCACCTGCGTGGAGACCGTGGTGCCCGAGAAGAACCCCCCTCCCGAGCGGCAGATCCCC 240 Qy 241 AGAAGGGGAGAGGAGTCCAGCGAAATGGAGCAGATCTCCATCATCGAAAGGTTCCCCTAC 300 ||| |||| ||||| |||||| ||||| |||||| ||||||||| ||||||| ||| Db 241 AGACGGGGCGAGGAAAGCAGCGAGATGGAACAGATCAGCATCATCGAGCGGTTCCCTTAC 300 Qy 301 CCCTTCCAAGTGGTGTACGACGAAGGCCCTCTGTACGTGTTCTCCCCCACCGAAGAACTG 360 || |||||||||||||||||||| ||||| |||||||||||| ||||||||| |||||| Db 301 CCATTCCAAGTGGTGTACGACGAGGGCCCCCTGTACGTGTTCAGCCCCACCGAGGAACTG 360 Qy 361 AGAAAGAGGTGGATCCACCAGCTGAAGAACGTCATTAGATACAACTCCGACCTCGTGCAG 420 | ||| ||||||| ||||||||||||||||| || | |||||| |||||| |||||| Db 361 CGGAAGCGGTGGATTCACCAGCTGAAGAACGTGATCCGGTACAACAGCGACCTGGTGCAG 420 Qy 421 AAATACCACCCTTGCTTCTGGATCGACGGCCAGTATCTGTGTTGCAGCCAAACAGCCAAG 480 || |||||||| ||||| ||||||||||||||||| ||||| |||||||| || |||||| Db 421 AAGTACCACCCCTGCTTTTGGATCGACGGCCAGTACCTGTGCTGCAGCCAGACCGCCAAG 480 Qy 481 AACGCTATGGGCTGCCAGATTCTGGAGAATAGAAACGGCAGCCTCAAGCCCGGCAGCAGC 540 |||||||||||||||||||||||||| || | ||||||||||| ||||||||||||||| Db 481 AACGCTATGGGCTGCCAGATTCTGGAAAACCGGAACGGCAGCCTGAAGCCCGGCAGCAGC 540 Qy 541 CATAGGAAGACCAAAAAGCCTCTGCCTCCCACCCCCGAGGAGGATCAGATTCTGAAGAAG 600 || || |||||||| ||||| ||||| ||||||||||| ||||| ||||| ||||||||| Db 541 CACAGAAAGACCAAGAAGCCCCTGCCCCCCACCCCCGAAGAGGACCAGATCCTGAAGAAG 600 Qy 601 CCTCTGCCTCCCGAGCCCGCCGCTGCTCCCGTGAGCACATCCGAGCTGAAGAAGGTGGTC 660 |||||||||||||||||||||||||| || |||||||| |||||||||||| ||||| Db 601 CCTCTGCCTCCCGAGCCCGCCGCTGCACCTGTGAGCACCAGCGAGCTGAAGAAAGTGGTG 660 Qy 661 GCTCTGTACGACTACATGCCCATGAACGCCAATGACCTCCAACTGAGAAAGGGAGACGAG 720 || ||||||||||||||||||||||||||||| ||||| || ||| | ||||| |||||| Db 661 GCCCTGTACGACTACATGCCCATGAACGCCAACGACCTGCAGCTGCGGAAGGGCGACGAG 720 Qy 721 TACTTTATTCTGGAGGAGAGCAACCTCCCTTGGTGGAGAGCTAGGGATAAGAATGGCCAA 780 ||||| || ||||| || |||||||| || |||||| | || ||||| ||||| ||||| Db 721 TACTTCATCCTGGAAGAAAGCAACCTGCCCTGGTGGCGGGCCAGGGACAAGAACGGCCAG 780 Qy 781 GAGGGATACATCCCCAGCAACTATGTGACCGAGGCCGAGGACAGCATTGAGATGTACGAG 840 || || ||||||||||||||||| |||||||||||||||||| ||| |||||||||||| Db 781 GAAGGCTACATCCCCAGCAACTACGTGACCGAGGCCGAGGACTCCATCGAGATGTACGAG 840 Qy 841 TGGTACAGCAAGCATATGACAAGATCCCAAGCCGAGCAACTGCTGAAGCAAGAGGGCAAG 900 |||||||||||||| ||||| ||| ||| ||||| || ||||||||||| || ||||| Db 841 TGGTACAGCAAGCACATGACCAGAAGCCAGGCCGAACAGCTGCTGAAGCAGGAAGGCAAA 900 Qy 901 GAGGGCGGCTTCATTGTGAGAGACAGCTCCAAGGCTGGCAAATACACCGTGAGCGTGTTC 960 |||||||||||||| || | |||||| |||||| ||||| |||||||||||||||||| Db 901 GAGGGCGGCTTCATCGTCCGGGACAGCAGCAAGGCCGGCAAGTACACCGTGAGCGTGTTC 960 Qy 961 GCCAAGAGCACCGGCGATCCCCAAGGCGTGATCAGACATTACGTCGTGTGCAGCACCCCT 1020 ||||||||||||||||| ||||| ||||||||| | || ||||| |||||||||||||| Db 961 GCCAAGAGCACCGGCGACCCCCAGGGCGTGATCCGGCACTACGTGGTGTGCAGCACCCCC 1020 Qy 1021 CAGTCCCAGTACTACCTCGCCGAGAAACACCTCTTCTCCACAATCCCCGAGCTGATTAAC 1080 ||| |||||||||||| |||||||| ||||| ||| ||| |||||||||||||| ||| Db 1021 CAGAGCCAGTACTACCTGGCCGAGAAGCACCTGTTCAGCACCATCCCCGAGCTGATCAAC 1080 Qy 1081 TACCACCAGCACAACTCCGCCGGCCTCATTTCTAGACTGAAGTACCCCGTCAGCCAGCAG 1140 || |||||||||||| ||| || || |||||| | |||||||||||||| ||||||| Db 1081 TATCACCAGCACAACAGCGCTGGACTGATTTCTCGGCTGAAGTACCCCGTGTCCCAGCAG 1140 Qy 1141 AATAAGAATGCTCCCTCCACAGCTGGACTGGGCTACGGAAGCTGGGAGATCGACCCCAAA 1200 || || || || ||| |||||| || ||||||||||| |||||||||||||||||||| Db 1141 AACAAAAACGCCCCCAGCACAGCCGGCCTGGGCTACGGCAGCTGGGAGATCGACCCCAAG 1200 Qy 1201 GATCTGACCTTTCTGAAAGAACTGGGCACCGGCCAATTTGGCGTGGTGAAGTACGGCAAG 1260 || |||||||| |||||||| |||||||||||||| || ||||||||||||||||||||| Db 1201 GACCTGACCTTCCTGAAAGAGCTGGGCACCGGCCAGTTCGGCGTGGTGAAGTACGGCAAG 1260 Qy 1261 TGGAGGGGCCAGTACGACGTGGCTATTAAGATGATCAAGGAGGGAAGCATGTCCGAGGAC 1320 ||||||||||||||||||||||| || |||||||||||||| || |||||| ||||||| Db 1261 TGGAGGGGCCAGTACGACGTGGCCATCAAGATGATCAAGGAAGGCAGCATGAGCGAGGAC 1320 Qy 1321 GAGTTCATCGAGGAAGCTAAGGTGATGATGAATCTGAGCCACGAGAAGCTGGTGCAGCTC 1380 ||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||| Db 1321 GAGTTCATCGAGGAAGCCAAAGTGATGATGAACCTGAGCCACGAGAAGCTGGTGCAGCTG 1380 Qy 1381 TACGGCGTGTGTACCAAGCAAAGGCCCATCTTCATTATCACAGAGTATATGGCCAATGGC 1440 ||||||||||| |||||||| ||||||||||||| ||||| ||||| |||||||| ||| Db 1381 TACGGCGTGTGCACCAAGCAGCGGCCCATCTTCATCATCACCGAGTACATGGCCAACGGC 1440 Qy 1441 TGCCTCCTCAACTATCTGAGAGAGATGAGGCATAGATTCCAGACCCAACAGCTGCTGGAG 1500 ||||| || ||||| ||| | |||||| |||| || |||||||| || |||||||| || Db 1441 TGCCTGCTGAACTACCTGCGGGAGATGCGGCACAGGTTCCAGACACAGCAGCTGCTCGAA 1500 Qy 1501 ATGTGCAAAGATGTGTGCGAGGCCATGGAGTACCTCGAAAGCAAGCAGTTTCTGCATAGA 1560 |||||||| || ||||||||||| ||||| ||||| ||| ||||||||| ||||| | Db 1501 ATGTGCAAGGACGTGTGCGAGGCTATGGAATACCTGGAATCCAAGCAGTTCCTGCACCGG 1560 Qy 1561 GACCTCGCCGCTAGAAATTGTCTGGTGAACGATCAAGGCGTCGTGAAGGTGAGCGATTTT 1620 ||||| ||||| ||||| || ||||||||||| || || || ||||||||| ||| || Db 1561 GACCTGGCCGCCAGAAACTGCCTGGTGAACGACCAGGGGGTGGTGAAGGTGTCCGACTTC 1620 Qy 1621 GGACTGAGCAGATACGTGCTGGACGATGAGTACACCAGCAGCGTCGGATCCAAGTTCCCC 1680 || ||||||||||||||||||||||| ||||||||||||||||| || |||||||||| Db 1621 GGCCTGAGCAGATACGTGCTGGACGACGAGTACACCAGCAGCGTGGGCAGCAAGTTCCCC 1680 Qy 1681 GTGAGATGGAGCCCTCCCGAGGTGCTGATGTACTCCAAGTTCAGCTCCAAGTCCGACATC 1740 ||| | |||||||| || ||||||||||||||| |||||||||| |||| ||||||| Db 1681 GTGCGGTGGAGCCCCCCTGAGGTGCTGATGTACAGCAAGTTCAGCAGCAAGAGCGACATC 1740 Qy 1741 TGGGCCTTTGGCGTGCTGATGTGGGAGATTTACTCTCTGGGCAAGATGCCCTACGAGAGG 1800 |||||||| |||||||||||||||||||| ||| ||||||||||||||||||||| || Db 1741 TGGGCCTTCGGCGTGCTGATGTGGGAGATCTACAGCCTGGGCAAGATGCCCTACGAGCGG 1800 Qy 1801 TTTACCAACAGCGAGACAGCCGAACACATCGCCCAAGGACTGAGGCTGTATAGGCCCCAC 1860 || |||||||||||||| ||||| ||||||||||| || ||| ||||||| ||||||||| Db 1801 TTCACCAACAGCGAGACCGCCGAGCACATCGCCCAGGGCCTGCGGCTGTACAGGCCCCAC 1860 Qy 1861 CTCGCCTCCGAGAAGGTGTACACCATTATGTACAGCTGCTGGCACGAGAAGGCCGACGAG 1920 || ||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| Db 1861 CTGGCCAGCGAGAAGGTGTACACCATCATGTACAGCTGCTGGCACGAGAAGGCCGACGAG 1920 Qy 1921 AGGCCCACATTCAAGATTCTGCTGTCCAACATTCTGGACGTGATGGACGAAGAGTCCTGA 1980 |||||||| |||||||| |||||||||||||| ||||||||||||||||| || |||| Db 1921 AGGCCCACCTTCAAGATCCTGCTGTCCAACATCCTGGACGTGATGGACGAGGAAAGCTGA 1980 Sequence 44197, Publication No. US20070161031A1 Query Match 100.0%; Score 1033; DB 27; Length 2300; Best Local Similarity 100.0%; Matches 1033; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACCCCATTTTTTTTGTTTGCTTGTTTGTTTGTTTTTTAGACAAAATAAAGAAAAAAAAAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1071 ACCCCATTTTTTTTGTTTGCTTGTTTGTTTGTTTTTTAGACAAAATAAAGAAAAAAAAAT 1130 Qy 61 AAGGTCCTGTTGACTTAAAACTTCGGATGAAATTGTAGTGGGACCTGTGATCTGTTTCTA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1131 AAGGTCCTGTTGACTTAAAACTTCGGATGAAATTGTAGTGGGACCTGTGATCTGTTTCTA 1190 Qy 121 CATTAGGATACAGTGCCTTGGGGCAAGGAAATATGGCAGTGCCCGAGGTGTCAAGGTGGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1191 CATTAGGATACAGTGCCTTGGGGCAAGGAAATATGGCAGTGCCCGAGGTGTCAAGGTGGG 1250 Qy 181 CAGGCAGATCAGTCAGCAGGGGCTCCACCATCATGGTCTGCATTCAATACTGGCTGCATT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1251 CAGGCAGATCAGTCAGCAGGGGCTCCACCATCATGGTCTGCATTCAATACTGGCTGCATT 1310 Qy 241 TCCTAGGAGAATCCCTGGGGGAATCATTGCAGTTGGAGCATAATGTAGGGGGCCCCTGAG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1311 TCCTAGGAGAATCCCTGGGGGAATCATTGCAGTTGGAGCATAATGTAGGGGGCCCCTGAG 1370 Qy 301 AAAACCTCCAGGCTTCAAGTGACATACCTAGTCTGCTTTACCGGTTTACAGGACTCAAGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1371 AAAACCTCCAGGCTTCAAGTGACATACCTAGTCTGCTTTACCGGTTTACAGGACTCAAGA 1430 Qy 361 GAAAGGTGGACATTGAGAGTTAATCCCTGAGGCCAAATCTTAAATGGAGAAAGTCAACAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1431 GAAAGGTGGACATTGAGAGTTAATCCCTGAGGCCAAATCTTAAATGGAGAAAGTCAACAT 1490 Qy 421 CCACAGAAAATGGGGAAGGGCACAAGTATTTCTGTGGGCTTATATTCCGACATTTTTATC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1491 CCACAGAAAATGGGGAAGGGCACAAGTATTTCTGTGGGCTTATATTCCGACATTTTTATC 1550 Qy 481 TGTAGGGGAAAAATGCTTTCTTAGAAAATGACTCAGCACGGGGAAGTCTTGTCTCTACCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1551 TGTAGGGGAAAAATGCTTTCTTAGAAAATGACTCAGCACGGGGAAGTCTTGTCTCTACCT 1610 Qy 541 CTGTCTTGTTTTGTCCTTTGGGGTCCCTTCACTATCAAGTTCAACTGTGTGTCCCTGAGA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1611 CTGTCTTGTTTTGTCCTTTGGGGTCCCTTCACTATCAAGTTCAACTGTGTGTCCCTGAGA 1670 Qy 601 CTCCTCTGCCCCGGAGGACAGGAGACTCGAAAAACGCTCTTCCTGGCCAGTCTCTTTGCT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1671 CTCCTCTGCCCCGGAGGACAGGAGACTCGAAAAACGCTCTTCCTGGCCAGTCTCTTTGCT 1730 Qy 661 CTGTGTCTGCCAGCCCCCAGCATCTCTCCTCTTTCCTGTAAGCCCCTCTCCCTGTGCTGA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1731 CTGTGTCTGCCAGCCCCCAGCATCTCTCCTCTTTCCTGTAAGCCCCTCTCCCTGTGCTGA 1790 Qy 721 CTGTCTTCATAGTACTTTAGGTATGTTGTCCCTTTACCTCTGGGAGGATAGCTTGATGAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1791 CTGTCTTCATAGTACTTTAGGTATGTTGTCCCTTTACCTCTGGGAGGATAGCTTGATGAC 1850 Qy 781 CTGTCTGCTCAGGCCAGCCCCATCTAGAGTCTCAGTGGCCCCAGTCATGTTGAGAAAGGT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1851 CTGTCTGCTCAGGCCAGCCCCATCTAGAGTCTCAGTGGCCCCAGTCATGTTGAGAAAGGT 1910 Qy 841 TCTTTCAAAGATAGACTCAAGATAGTAGTGTCAGAGGTCCCAAGCAAATGAAGGGCGGGG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1911 TCTTTCAAAGATAGACTCAAGATAGTAGTGTCAGAGGTCCCAAGCAAATGAAGGGCGGGG 1970 Qy 901 ACAGTTGAGGGGGTGGAATAGGGACGGCAGCAGGGAACCAGATAGCATGCTGCTGAGAAG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1971 ACAGTTGAGGGGGTGGAATAGGGACGGCAGCAGGGAACCAGATAGCATGCTGCTGAGAAG 2030 Qy 961 AAAAAAAGACATTGGTTTAGGTCAGGAAGCAAAAAAAGGGAACTGAGTGGCTGTGAAAGG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2031 AAAAAAAGACATTGGTTTAGGTCAGGAAGCAAAAAAAGGGAACTGAGTGGCTGTGAAAGG 2090 Qy 1021 GTGGGGTTTGCTC 1033 ||||||||||||| Db 2091 GTGGGGTTTGCTC 2103 Sequence 622, Patent No. 9587003 Query Match 100.0%; Score 160; DB 31; Length 2579; Best Local Similarity 100.0%; Matches 160; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGACTGTCCTTCCTCTCTGGACTGTAAGAATATGTCTCCAGGGCCAGTGTCTGCTGCGAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5 AGACTGTCCTTCCTCTCTGGACTGTAAGAATATGTCTCCAGGGCCAGTGTCTGCTGCGAT 64 Qy 61 CGAGTCCCACCTTCCAAGTCCTGGCATCTCAATGCATCTGGGAAGCTACCTGCATTAAGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 65 CGAGTCCCACCTTCCAAGTCCTGGCATCTCAATGCATCTGGGAAGCTACCTGCATTAAGT 124 Qy 121 CAGGACTGAGCACACAGGTGAACTCCAGAAAGAAGAAGCT 160 |||||||||||||||||||||||||||||||||||||||| Db 125 CAGGACTGAGCACACAGGTGAACTCCAGAAAGAAGAAGCT 164 Sequence 622, Patent No. 9587003 Query Match 100.0%; Score 1980; DB 31; Length 2579; Best Local Similarity 100.0%; Matches 1980; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCCGCAGTGATTCTGGAGAGCATCTTTCTGAAGCGATCCCAACAGAAAAAGAAAACA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 165 ATGGCCGCAGTGATTCTGGAGAGCATCTTTCTGAAGCGATCCCAACAGAAAAAGAAAACA 224 Qy 61 TCACCTCTAAACTTCAAGAAGCGCCTGTTTCTCTTGACCGTGCACAAACTCTCCTACTAT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 225 TCACCTCTAAACTTCAAGAAGCGCCTGTTTCTCTTGACCGTGCACAAACTCTCCTACTAT 284 Qy 121 GAGTATGACTTTGAACGTGGGAGAAGAGGCAGTAAGAAGGGTTCAATAGATGTTGAGAAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 285 GAGTATGACTTTGAACGTGGGAGAAGAGGCAGTAAGAAGGGTTCAATAGATGTTGAGAAG 344 Qy 181 ATCACTTGTGTTGAAACAGTGGTTCCTGAAAAAAATCCTCCTCCAGAAAGACAGATTCCG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 345 ATCACTTGTGTTGAAACAGTGGTTCCTGAAAAAAATCCTCCTCCAGAAAGACAGATTCCG 404 Qy 241 AGAAGAGGTGAAGAGTCCAGTGAAATGGAGCAAATTTCAATCATTGAAAGGTTCCCTTAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 405 AGAAGAGGTGAAGAGTCCAGTGAAATGGAGCAAATTTCAATCATTGAAAGGTTCCCTTAT 464 Qy 301 CCCTTCCAGGTTGTATATGATGAAGGGCCTCTCTACGTCTTCTCCCCAACTGAAGAACTA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 465 CCCTTCCAGGTTGTATATGATGAAGGGCCTCTCTACGTCTTCTCCCCAACTGAAGAACTA 524 Qy 361 AGGAAGCGGTGGATTCACCAGCTCAAAAACGTAATCCGGTACAACAGTGATCTGGTTCAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 525 AGGAAGCGGTGGATTCACCAGCTCAAAAACGTAATCCGGTACAACAGTGATCTGGTTCAG 584 Qy 421 AAATATCACCCTTGCTTCTGGATCGATGGGCAGTATCTCTGCTGCTCTCAGACAGCCAAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 585 AAATATCACCCTTGCTTCTGGATCGATGGGCAGTATCTCTGCTGCTCTCAGACAGCCAAA 644 Qy 481 AATGCTATGGGCTGCCAAATTTTGGAGAACAGGAATGGAAGCTTAAAACCTGGGAGTTCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 645 AATGCTATGGGCTGCCAAATTTTGGAGAACAGGAATGGAAGCTTAAAACCTGGGAGTTCT 704 Qy 541 CACCGGAAGACAAAAAAGCCTCTTCCCCCAACGCCTGAGGAGGACCAGATCTTGAAAAAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 705 CACCGGAAGACAAAAAAGCCTCTTCCCCCAACGCCTGAGGAGGACCAGATCTTGAAAAAG 764 Qy 601 CCACTACCGCCTGAGCCAGCAGCAGCACCAGTCTCCACAAGTGAGCTGAAAAAGGTTGTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 765 CCACTACCGCCTGAGCCAGCAGCAGCACCAGTCTCCACAAGTGAGCTGAAAAAGGTTGTG 824 Qy 661 GCCCTTTATGATTACATGCCAATGAATGCAAATGATCTACAGCTGCGGAAGGGTGATGAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 825 GCCCTTTATGATTACATGCCAATGAATGCAAATGATCTACAGCTGCGGAAGGGTGATGAA 884 Qy 721 TATTTTATCTTGGAGGAAAGCAACTTACCATGGTGGAGAGCACGAGATAAAAATGGGCAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 885 TATTTTATCTTGGAGGAAAGCAACTTACCATGGTGGAGAGCACGAGATAAAAATGGGCAG 944 Qy 781 GAAGGCTACATTCCTAGTAACTATGTCACTGAAGCAGAAGACTCCATAGAAATGTATGAG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 945 GAAGGCTACATTCCTAGTAACTATGTCACTGAAGCAGAAGACTCCATAGAAATGTATGAG 1004 Qy 841 TGGTATTCCAAACACATGACTCGGAGTCAGGCTGAGCAACTGCTAAAGCAAGAGGGGAAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1005 TGGTATTCCAAACACATGACTCGGAGTCAGGCTGAGCAACTGCTAAAGCAAGAGGGGAAA 1064 Qy 901 GAAGGAGGTTTCATTGTCAGAGACTCCAGCAAAGCTGGCAAATATACAGTGTCTGTGTTT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1065 GAAGGAGGTTTCATTGTCAGAGACTCCAGCAAAGCTGGCAAATATACAGTGTCTGTGTTT 1124 Qy 961 GCTAAATCCACAGGGGACCCTCAAGGGGTGATACGTCATTATGTTGTGTGTTCCACACCT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1125 GCTAAATCCACAGGGGACCCTCAAGGGGTGATACGTCATTATGTTGTGTGTTCCACACCT 1184 Qy 1021 CAGAGCCAGTATTACCTGGCTGAGAAGCACCTTTTCAGCACCATCCCTGAGCTCATTAAC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1185 CAGAGCCAGTATTACCTGGCTGAGAAGCACCTTTTCAGCACCATCCCTGAGCTCATTAAC 1244 Qy 1081 TACCATCAGCACAACTCTGCAGGACTCATATCCAGGCTCAAATATCCAGTGTCTCAACAA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1245 TACCATCAGCACAACTCTGCAGGACTCATATCCAGGCTCAAATATCCAGTGTCTCAACAA 1304 Qy 1141 AACAAGAATGCACCTTCCACTGCAGGCCTGGGATACGGATCATGGGAAATTGATCCAAAG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1305 AACAAGAATGCACCTTCCACTGCAGGCCTGGGATACGGATCATGGGAAATTGATCCAAAG 1364 Qy 1201 GACCTGACCTTCTTGAAGGAGCTGGGGACTGGACAATTTGGGGTAGTGAAGTATGGGAAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1365 GACCTGACCTTCTTGAAGGAGCTGGGGACTGGACAATTTGGGGTAGTGAAGTATGGGAAA 1424 Qy 1261 TGGAGAGGCCAGTACGACGTGGCCATCAAGATGATCAAAGAAGGCTCCATGTCTGAAGAT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1425 TGGAGAGGCCAGTACGACGTGGCCATCAAGATGATCAAAGAAGGCTCCATGTCTGAAGAT 1484 Qy 1321 GAATTCATTGAAGAAGCCAAAGTCATGATGAATCTTTCCCATGAGAAGCTGGTGCAGTTG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1485 GAATTCATTGAAGAAGCCAAAGTCATGATGAATCTTTCCCATGAGAAGCTGGTGCAGTTG 1544 Qy 1381 TATGGCGTCTGCACCAAGCAGCGCCCCATCTTCATCATCACTGAGTACATGGCCAATGGC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1545 TATGGCGTCTGCACCAAGCAGCGCCCCATCTTCATCATCACTGAGTACATGGCCAATGGC 1604 Qy 1441 TGCCTCCTGAACTACCTGAGGGAGATGCGCCACCGCTTCCAGACTCAGCAGCTGCTAGAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1605 TGCCTCCTGAACTACCTGAGGGAGATGCGCCACCGCTTCCAGACTCAGCAGCTGCTAGAG 1664 Qy 1501 ATGTGCAAGGATGTCTGTGAAGCCATGGAATACCTGGAGTCAAAGCAGTTCCTTCACCGA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1665 ATGTGCAAGGATGTCTGTGAAGCCATGGAATACCTGGAGTCAAAGCAGTTCCTTCACCGA 1724 Qy 1561 GACCTGGCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTTAAAGTATCTGATTTC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1725 GACCTGGCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTTAAAGTATCTGATTTC 1784 Qy 1621 GGCCTGTCCAGGTATGTCCTGGATGATGAATACACAAGCTCAGTAGGCTCCAAATTTCCA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1785 GGCCTGTCCAGGTATGTCCTGGATGATGAATACACAAGCTCAGTAGGCTCCAAATTTCCA 1844 Qy 1681 GTCCGGTGGTCCCCACCGGAAGTCCTGATGTATAGCAAGTTCAGCAGCAAATCTGACATT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1845 GTCCGGTGGTCCCCACCGGAAGTCCTGATGTATAGCAAGTTCAGCAGCAAATCTGACATT 1904 Qy 1741 TGGGCTTTTGGGGTTTTGATGTGGGAAATTTACTCCCTGGGGAAGATGCCATATGAGAGA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1905 TGGGCTTTTGGGGTTTTGATGTGGGAAATTTACTCCCTGGGGAAGATGCCATATGAGAGA 1964 Qy 1801 TTTACTAACAGTGAGACTGCTGAACACATTGCCCAAGGCCTACGTCTCTACAGGCCTCAT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1965 TTTACTAACAGTGAGACTGCTGAACACATTGCCCAAGGCCTACGTCTCTACAGGCCTCAT 2024 Qy 1861 CTGGCTTCAGAGAAGGTATATACCATCATGTACAGTTGCTGGCATGAGAAAGCAGATGAG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2025 CTGGCTTCAGAGAAGGTATATACCATCATGTACAGTTGCTGGCATGAGAAAGCAGATGAG 2084 Qy 1921 CGTCCCACTTTCAAAATTCTTCTGAGCAATATTCTAGATGTCATGGATGAAGAATCCTGA 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2085 CGTCCCACTTTCAAAATTCTTCTGAGCAATATTCTAGATGTCATGGATGAAGAATCCTGA 2144
Read full office action

Prosecution Timeline

Jun 07, 2023
Application Filed
Jun 30, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680074
ANTIGEN PRESENTING T CELLS, SENSITIZED, MANUFACTURED T CELLS AND METHODS OF TREATMENT USING THE SAME
3y 8m to grant Granted Jul 14, 2026
Patent 12680076
METHODS FOR ENGINEERING ALLOGENEIC AND HIGHLY ACTIVE T CELL FOR IMMUNOTHERAPHY
3y 8m to grant Granted Jul 14, 2026
Patent 12673116
COMPOSITIONS AND METHODS FOR TREATING NON-AGE-ASSOCIATED HEARING IMPAIRMENT IN A HUMAN SUBJECT
5y 3m to grant Granted Jul 07, 2026
Patent 12655427
Recombinant Adeno-Associated Virus Delivery of Exon 2-Targeted U7SNRNA Polynucleotide Constructs
4y 6m to grant Granted Jun 16, 2026
Patent 12649928
RNA-Guided Human Genome Engineering
6y 0m to grant Granted Jun 09, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.9%)
4y 0m (~11m remaining)
Median Time to Grant
Low
PTA Risk
Based on 741 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month