DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Response to Amendment/Status of Claims
Receipt of Arguments/Remarks filed on 05/13/2026 is acknowledged. Claims 55,61,62,68,71 and 72 were amended. Claims 73-77 are new. Claims 51-77 are pending and under examination.
Withdrawn Objections and Rejections
Applicant’s arguments and amendments, see page 7, filed 05/13/2026, with respect to the objections to the drawings have been fully considered and are persuasive due to replacement of Figures 21F and 29G. The objection has been withdrawn.
Applicant’s arguments and amendments, see page 7, filed 05/13/2026, with respect to the objection to claims 55 and 62 have been fully considered and are partially persuasive due to the amendment to recite “replaced” in claim 55 and recite the names of the diseases in claim 62. The objection to claim 55 has been partially withdrawn and objection to claim 62 has been withdrawn. However, claim 55 remains objected to regarding the missing period after the claim number “55”.
Applicant’s arguments and amendments, see page 8, filed 05/13/2026, with respect to the 35 U.S.C. 112(b) rejection of claims 71 and 72 have been fully considered and are persuasive due to the amendments thereto to recite “the antisense oligonucleotide” rather than “the method”, as claims 57 and 71 did not recite a method. The 35 U.S.C. 112(b) rejection of claims 71 and 72 has been withdrawn.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. See page 157 and 163 which recite “www.” which is still browser-executable code.
Response to Arguments
Applicant's arguments, filed 05/13/2026 have been fully considered but they are not persuasive. While Applicant amended pages 157 and 163 to remove “https”, it was replaced with “www.” which is still browser executable code, and therefore the objection to the specification remains.
Claim Objections
Claim 55 is objected to because of the following informalities: claim 55 is missing a period after the claim number “55”. Appropriate correction is required.
Written Description Rejection
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 51-53,58-66 and 73-77 are rejected under 35 U.S.C. 112, first
paragraph, as failing to comply with the written description requirement. The claim(s)
contain subject matter which was not described in the specification in such a way as to
reasonably convey to one skilled in the relevant art that the inventor(s), at the time the
application was filed, had possession of the claimed invention.
Claims 51 and 58-60 encompass an antisense oligonucleotide 13-30 nucleotides in length that is complementary to at least any 13 nucleotides of SEQ ID NO: 1 and which has the function of reducing expression of the UNC13A cryptic exon splice variant of UNC13A mature mRNA in a cell. SEQ ID NO: 1 is 1288 nucleotides in length, and therefore the claims encompass that the antisense oligonucleotide is complementary to at least 13 nucleotides of any region of SEQ ID NO: 1 and result in the recited function. Claim 52 encompasses any antisense oligonucleotide that is 13-30 nucleotides in length and that is complementary to at least any 13 nucleotides or SEQ ID NO: 2, which is 128 nucleotides in length and claim 53 encompasses any antisense oligonucleotide that is 13-30 nucleotides in length and that is complementary to at least any 13 nucleotides of SEQ ID NO: 3, which is 178 nucleotides in length and results in the recited function of reducing expression of the UNC13A cryptic exon splice variant of UNC13A mature mRNA in a cell. Claims 54-57 and 67-70 encompass specific nucleotide sequences of SEQ ID NOs: 190-546, and therefore are not included in the rejection.
Claims 61,73 and 74 encompass a method of treating any neurodegenerative disorder associated with TDP-43 pathology in a subject comprising administering to the subject the antisense oligonucleotide of claim 51 in amount effective to treat the neurodegenerative disorder and therefore encompasses administering the antisense oligonucleotide that is 13-30 nucleotides in length and is complementary to at least any 13 nucleotides of any region of SEQ ID NO: 1 and results in the recited function. Claims 62-64 recite specific neurodegenerative disorders, amyotrophic lateral sclerosis, frontotemporal dementia, Alzheimer’s disease, Parkinson’s disease, FOSMN, or Perry Syndrome. Claim 65 encompasses a method of treating any neurodegenerative disorder associated with TDP-43 pathology in a subject comprising administering to the subject any antisense oligonucleotide that is 13-30 nucleotides in length and that is complementary to at least 13 nucleotides or SEQ ID NO: 2, which is 128 nucleotides in length and claim 66 encompasses administering any antisense oligonucleotide that is 13-30 nucleotides in length and that is complementary to at least 13 nucleotides or SEQ ID NO: 3, which is 178 nucleotides in length and results in the recited function. Claims 75-77 encompass a method of reducing expression of UNC13A cryptic exon splice variant of UNC13A mature mRNA in a neuronal cell of the central nervous system in vivo comprising delivering an antisense oligonucleotide of claim 51 (an antisense oligonucleotide 13-30 nucleotides in length that is complementary to at least any 13 nucleotides of SEQ ID NO: 1) directly to the central nervous system, and having the function of reducing expression of UNC13A cryptic exon splice variant of UNC13A mature mRNA in the neuronal cell.
The specification discloses SEQ ID NO: 1 as a portion of UNC13A transcribed mRNA intron sequence with cryptic exon-cords, chr19:17,641,557-17642844 and shows the sequence on pages 130-131 and that the long variant (SEQ ID NO: 3) is underlined, the shorter variant is in italics (SEQ ID NO: 2), and the SNPs are bolded and the branch points are highlighted and lower case bases denote the bases immediately flanking the splice sites (paragraph 0492).
PNG
media_image1.png
250
647
media_image1.png
Greyscale
PNG
media_image2.png
544
644
media_image2.png
Greyscale
The specification discloses ASO sequences that bind to crucial elements involved in UNC13A cryptic exon splicing, starting in Table 1 on page 132 which include SEQ ID NOs: 4-104 which target the branchpoint, Table 2, pages 136-143 SEQ ID NOs: 105-189 that target the 3’-splice site, SEQ ID NOs: 270-352 that target the 5’-splice site, Table 3, pages 143-156 SEQ ID NOs: 190-269 that target the cryptic site, SEQ ID NOs: 353-426 that target the intron SNP, SEQ ID NOs: 427-474 that target the downstream TDP-43 binding site, and SEQ ID NOs: 475-546 that target the enhancer. However, as seen above in SEQ ID NO: 1, there are portions of SEQ ID NO: 1 that do not contain the branchpoint, splice sites, cryptic sites, intron SNP, TDP-43 binding site and enhancer and that the disclosed antisense oligonucleotides do not target.
For example, SEQ ID NO: 4 is complementary to nucleotides 146-134 of instant SEQ ID NO: 1 as shown in the alignment below:
PNG
media_image3.png
66
216
media_image3.png
Greyscale
However, SEQ ID NO: 4 is only complementary to 8 nucleotides of instant SEQ ID NO: 2 and instant SEQ ID NO: 3:
PNG
media_image4.png
66
141
media_image4.png
Greyscale
PNG
media_image5.png
67
137
media_image5.png
Greyscale
As another example, the ASO of SEQ ID NO: 427 which targets a downstream TDP-43 binding site is complementary to 13 nucleotides 1041-1029 of instant SEQ ID NO: 1:
PNG
media_image6.png
67
198
media_image6.png
Greyscale
However, the alignments below show the complementarity of SEQ ID NO: 427 to SEQ ID NOs: 2 and 3 respectively, and show that SEQ ID NO: 427 is not complementary to at least 13 nucleotides of instant SEQ ID NOs: 2 or 3:
PNG
media_image7.png
64
160
media_image7.png
Greyscale
PNG
media_image8.png
64
177
media_image8.png
Greyscale
Therefore, not all of the antisense oligonucleotides that are complementary to 13 nucleotides of portions of SEQ ID NO: 1 are complementary to 13 nucleotides of SEQ ID NOs: 2 or 3, and the disclosed antisense oligonucleotides do not target the entire range of nucleotides of SEQ ID NO: 1 and result in the recited functions.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. In the instant case, the specification discloses ASO sequences that bind to portions of instant SEQ ID NO: 1,2 and 3. However, as seen above, the specification does not provide written description for the genus of ASO sequences that are complementary to 13 nucleotides of the entire range of nucleotides of instant SEQ ID NOs: 1,2 or 3. While the genus encompasses a large number of antisense oligonucleotide sequences that have the same activity, the genus of antisense oligonucleotides encompasses a large number of molecules that have a different structure (nucleotide sequence), and the specification does not describe a common core structure of the species of the large genus of antisense oligonucleotides 13-30 nucleotides in length, complementary to at least 13 nucleotides of instant SEQ ID NO: 1,2 or 3 and which result in the functional limitations of the instant claims (reducing expression of the UNC13A cryptic exon splice variant of UNC13A mature mRNA in a cell; Treating a neurodegenerative disorder associated with TDP-43 pathology in a subject).
Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111, (Fed. Cir. 1991), makes clear that "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the 'written description' inquiry, whatever is now claimed." (See page 1117.) The specification does not "clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed." (See Vas-Cath at page 1116.)
With the exception of the antisense oligonucleotides of SEQ ID NOs:190-546, the skilled artisan cannot envision the detailed chemical structure of the encompassed antisense oligonucleotides with the functions recited in the instant claims. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method for isolating it. The chemical structure itself is required. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Circ. 1993) and Amgen Inc. V. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016, (Fed. Cir. 1991). In Fiddes v. Baird, 30 USPQ2d 1481, 1483, (Bd. Pat. App. & Int. 1993), claims directed to mammalian FGF's were found unpatentable due to lack of written description for the broad class. The specification provided only the bovine sequence. Finally, University of California v. Eli Lilly and Co., 43 USPQ2d 1398, 1404, 1405 (Fed. Cir. 1997) held that:
...To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that "the inventor invented the claimed invention." Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997); In re Gosteli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) (" [T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed."). Thus, an applicant complies with the written description requirement "by describing the invention, with all its claimed limitations, not that which makes it obvious," and by using "such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention." Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966.
Next, then, it is determined whether a representative number of species have
been sufficiently described by other relevant identifying characteristics (i.e. other than
nucleotide sequence), specific features and functional attributes that would distinguish
different members of the claimed genus. To the extent that a functional description can
meet the requirement for an adequate written description, it can do so only in accordance with PTO guidelines stating that the requirement can be met by disclosing “sufficiently detailed, relevant identifying characteristics,” including “functional characteristics when coupled with a known or disclosed correlation between function and structure.” Univ. of Rochester v. G.D. Searle, 68 USPQ2d 1424, 1432 (DC WNY 2003). In the instant case, no identifying characteristics of the antisense oligonucleotides are disclosed. Applicant’s attention is directed to the Guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112(a) or Pre-AIA 35 U.S.C. 112, first paragraph, "Written Description" Requirement (MPEP2163). Applicant’s attention is directed to the Guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112(a) or Pre-AIA 35 U.S.C. 112, first paragraph, "Written Description" Requirement (MPEP2163).
In conclusion, Applicant’s disclosure of the species of antisense oligonucleotides of SEQ ID NOs:190-546 of the claimed broad genus of antisense oligonucleotides that are 13-30 nucleotides in length and complementary to at least any 13 nucleotides of SEQ ID NOs: 1,2 or 3 is not deemed sufficient to reasonably convey to one skilled in the art that Applicant was in possession of the claimed broad genus at the time the application was filed. Thus it is concluded that the written description requirement is not satisfied for the claimed genus.
Response to Arguments
Applicant's arguments filed 05/13/2026 have been fully considered but they are not persuasive.
Applicant cites MPEP 2163.02 citing Vas-Cath, Inc. V. Mahurkur on page 8 and that the antisense oligonucleotides in the claims are defined by a clear structural relationship to a known, fully disclosed target sequence, not merely by function. Applicant argues SEQ ID NO: 1 is fully disclosed in the application and because the rules of Watson-Crick base pairing apply and are well understood in the art, a person of ordinary skill can immediately envision the complete antisense oligonucleotide sequence of every member of the claimed genus, and there is a known, deterministic correlation between the target sequence (SEQ ID NOs: 1,2 or 3) and the structure of the complementary antisense oligonucleotide, and cites Eli Lilly from MPEP 2163.
This is not found persuasive. While the Examiner agrees that a person of ordinary skill in the art can use the target sequence to design complementary antisense oligonucleotides, the issue at hand is whether Applicant has possession of the genus that would carry out the recited functions, as the claims recite a genus of the antisense oligonucleotides that are 13-30 nucleotides in length and complementary to at least 13 nucleotides of SEQ ID NO: 1 (as well as SEQ ID NOs: 2 or 3), that performs the functions recited in the instant claims. SEQ ID NOs: 4-104 and 105-189 are not specifically recited in the claims, but they are encompassed by claim 51. SEQ ID NOs: 4-104 target the branchpoint, but has the specification shown they perform the functions recited in claims 51-53,61-66 and 73-77?
Applicant argues on page 9 that MPEP 2163 states “written description requirement may be satisfied through disclosure of function and minimal structure when there is a well-established correlation between structure and function, and here, the correlation between target sequence and the ASO structure is not merely “well-established” but it deterministic based on Watson-Crick base pair rules.
This is not found persuasive because as stated above the issue is not whether an ASO structure can be designed or determined based on knowing the target sequence, but whether the genus of the recited ASOs are capable of carrying out the functions recited in the instant claims.
Applicant argues on page 9 that the application discloses a representative number of species spanning the structural diversity of the claimed genus, as specification discloses 543 specific ASO sequences (SEQ ID NOs: 4-546) that collectively target distinct functional regions across SEQ ID NO:1 and subsequences of SEQ ID NOs: 2 and 3. These sequence include ASOs targeting the branchpoint (SEQ ID NOs: 4-104), ASOs targeting splice sites (SEQ ID NOs: 105-189 and 270-352), ASOs targeting sequences within UNC13A cryptic exon (SEQ ID NOs: 190-269), ASOs targeting an SNP in the intronic flanking region (SEQ ID NOs: 353-426), ASOs targeting downstream TDP-43 binding sites (SEQ ID NOs: 427-474) and ASOs targeting splice enhancers (SEQ ID NOs: 474-546) and these 543 species span 6 distinct functional regions across SEQ ID NO: 1, representing substantial structural diversity within the genus. Applicant states the Office has interpreted the claims as encompassing any ASO complementary to 13 nucleotides of SEQ ID NO: 1 regardless of function and overstates the breadth of the claimed genus by disregarding the functional “wherein” clause in claim 51. Applicant argues the application discloses a plurality of ASOs that satisfy the requirements of claim 51 (see Tables 1-4). ASOs complementary to regions of SEQ ID NO: 1 that do not reduce expression of the UNC13A mature mRNA in a cell would not satisfy the wherein clause and the genus is therefore narrower than the examiner has concluded (pages 9-10).
This is not found persuasive. Disclosing hundreds of sequences if there is no structure-function correlation does not satisfy the written description requirement. As stated in the rejection and shown by the alignments in the written description rejection above, not all of the antisense oligonucleotides that are complementary to 13 nucleotides of portions of SEQ ID NO: 1 are complementary to 13 nucleotides of SEQ ID NOs: 2 or 3, and the disclosed antisense oligonucleotides do not target the entire range of nucleotides of SEQ ID NO: 1 and result in the recited functions. Therefore, the rejection is maintained.
Scope of Enablement Rejection
Claims 61-70 and 73-77 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of reducing expression of UNC13A cryptic exon spicing variant of UNC13A mature mRNA in a neuronal cell of the central nervous system of a subject in vivo and treating amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) in said subject, comprising directly delivering the antisense oligonucleotides of SEQ ID NOs: 555-571,579 and 580 to the cell of the central nervous system, whereby the expression of UNC13A cryptic splice variant is reduced in the neuronal cells of the central nervous system of said subject and treats ALS and FTD in said subject, the specification is not enabling for the claimed method of treating a genus of neurodegenerative disorders associated with TDP-43 pathology in a subject or a method of reducing expression of UNC13A cryptic exon splice variant of UNC13A mature mRNA in a neuronal cell of the central nervous system in vivo, comprising directly delivering the antisense oligonucleotides of 13-30 nucleotides in length and that is complementary to at least 13 nucleotides of SEQ ID NO: 1,2 or 3, or the unmodified antisense oligonucleotides comprising SEQ ID NOs: 190-546. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
As stated in MPEP §2164.01(a), “there are many factors to consider when determining whether there is sufficient evidence to support a determination that a disclosure does not satisfy the enablement requirement and whether any experimentation is ‘undue’.” These factors include, but are not limited to:
1. The breadth of the claims;
2. The nature of the invention;
3. The state of the prior art;
4. The level of skill in the art;
5. The level of predictability in the art;
6. The amount of direction provided by the inventor;
7. The presence or absence of working examples;
8. The quantity of experimentation necessary needed to make or use the invention based on the disclosure.
See In re Wands USPQ 2d 1400 (CAFC 1988).
The Breadth of the Claims and The Nature of the Invention
Based on the broadest reasonable interpretation, claims 61-70 and 73-77 encompass a method of treating any neurodegenerative disorder associated with TDP-43 pathology in a subject comprising delivering any antisense oligonucleotide that is 13-30 nucleotides in length and that is complementary to at least 13 nucleotides of SEQ ID NO: 1,2 or 3 or the antisense oligonucleotides of SEQ ID NOs: 190-546 directly to the CNS. For the claims to be enabled for the full scope, the recited ASOs would need to be able to inhibit aberrant splicing at the cryptic splice site and increase the production of functional protein, consequently resulting in treatment of the neurodegenerative disorder associated with TDP-43 pathology in a subject (ALS, FTD, Alzheimer’s disease, Parkinson’s disease, FOSMN, or Perry Syndrome), or reducing expression of UNC13A cryptic exon splice variant of UN13A mature mRNA in a neuronal cell of the CNS in vivo.
The State of the Prior Art
At the time of the filing of the application, in vivo delivery of ASOs to cells of a subject, particularly to brain or neuronal cells has challenges. Additionally, delivery to the CNS has its own obstacle of blood brain barrier.
Roberts et al. (Nature Reviews: Drug Discovery Vol. 19, October 2020, pages 673-693) teach the majority of oligonucleotide therapeutics focus on either local delivery or delivery to the liver (page 677, right column), or direct injection of oligonucleotides into the cerebrospinal fluid by lumbar puncture for distribution through the CNS (page 679, left column). Roberts et al. teach “the establishment of therapeutic platforms capable of delivering oligonucleotide drugs to specific organs or tissues will likely involve defined patterns of chemical modification, combined with conjugation/complexation strategies that confer predictable pharmacokinetic and pharmacodynamic properties and well-understood mechanisms of action” (page 689, left column).
Bennett et al. (Annu Rev Neurosci 08 July 2019; 42: 385-406) teach that molecular mechanisms through which an ASO modulates RNA functions are dependent on the chemical modifications, the position of modifications and where in the target RNA the oligonucleotide binds (Antisense Therapeutics, pages 2-3). Bennett et al. teach that chemical modifications have a major impact on pharmacokinetic properties of ASO drugs (page 3 bottom). While Bennet et al. teach injection of single-stranded phosphorothioate-modified and 2’-MOE modified ASOs into the CSF resulted in rapid distribution throughout the spinal cord and into most brain regions, and that intrathecal administration shows highest drug concentrations in the lumbar spinal cord and cortical regions of the brain (page 4, first paragraph), there is no guidance whether an ASO that targets aberrant splicing of UNC13A would reach neuronal cells affected by ALS in effective amounts to be able to inhibit the aberrant splicing.
Therefore, the state of the art shows that a method of delivering ASOs to brain and neuronal cells in general and to ALS lesions in particular had challenges and was unpredictable at the time of the filing of the instant specification. The art cited above suggests that a vast amount of experimentation is needed to enable a method of delivering ASOs to brain and neuronal cells in general and to ALS lesions in a subject in vivo.
The Level of Predictability in the Art
The instant claimed invention is highly unpredictable. If one skilled in the art cannot readily anticipate the effect of a change within the subject matter to which that claimed invention pertains (i.e. a method of treating a neurodegenerative disorder associated with TDP-43 pathology in a subject, comprising delivering the antisense oligonucleotide of 13-30 nucleotides in length and that is complementary to at least 13 contiguous nucleotides of SEQ ID NO: 1,2 or 3, or the antisense oligonucleotides comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 190-546 directly to the CNS of the subject; a method of reducing expression of UNC13A cryptic exon splice variant of UNC13A mature mRNA in a neuronal cell of the CNS in vivo comprising delivering an antisense oligonucleotide of claim 51 directly to the CNS), then there is a lack of predictability in the art. Moreover, it is noted that the pharmaceutical art is unpredictable, requiring each embodiment to be individually assessed for physiological activity. The court has indicated that the more unpredictable an area is, the more specific enablement is necessary in order to satisfy the statute. (See In re Fisher, 427 F.2d 833, 166 USPQ 18 (CCPA 1970)). This is because it is not obvious from the disclosure of one species, what other species will work.
The lack of predictability stems from the lack of evidence that the method when carried out in vivo in a subject will result in treatment of the neurodegenerative diseases associated with TDP-43 pathology, including ALS, FTD, Alzheimer’s disease, Parkinson’s disease, FOSMN or Perry Syndrome that will result in the treatment of any of the encompassed neurodegenerative diseases. Since the specification only exemplifies in-vitro cell models and does not demonstrate any data or evidence that the recited ASOs would result in treatment of any of the recited neurodegenerative disorders when delivered to a subject, there would be no way of determining without undue experimentation whether the recited ASOs exhibits such a desired result. Therefore, without more experimentation demonstrating the efficacy of the claimed ASOs, the level of unpredictability remains high and it is unpredictable that the claimed ASOs that are complementary to at least 13 contiguous nucleotides of SEQ ID NO: 1,2 or 3 or the ASOs comprising SEQ ID NOs: 190-546 will result in treating the genus of neurodegenerative disorders associated with TPD-43 pathology in a subject or result in reducing expression of UNC13A cryptic exon splice variant of UNC13A mature mRNA in a neuronal cell of the CNS in vivo).
The Amount of Direction Provided by the Inventor and
The Presence or Absence of Working Examples
The specification does not enable any person skilled in the art to which it pertains (i.e. a method of treating a neurodegenerative disorder associated with TDP-43 pathology in a subject comprising delivering the antisense oligonucleotide 13-30 nucleotides in length and that is complementary to at least 13 contiguous nucleotides of SEQ ID NO: 1,2 or 3, or the antisense oligonucleotides comprising SEQ ID NOs: 190-546 directly to the CNS of the of subject; or a method of reducing expression of UNC13A cryptic exon splice variant of UNC13A mature mRNA in a neuronal cell of the CNS in vivo comprising delivering an ASO of claim 51 directly to the CNS), to make and/or use the invention commensurate in scope with the claims. There is a lack of adequate guidance from the specification or prior art with regard to the method being carried out in vivo regarding administration of the genus of antisense oligonucleotides and the genus of neurodegenerative disorders associated with TDP-43 being treated.
The specification discloses that the present disclosure relates to novel therapeutics for treatment of neurodegenerative disorders, more particularly ALS and FTD, or those associated with TDP-43 pathology (paragraph 0002), and that TDP-43 is depleted from the nucleus and accumulated in cytoplasm inclusions in a number of neurodegenerative disorders, including >95% ALS cases and approximately 50% TFD cases, approximately 30% of Alzheimer disease cases, Parkinson disease and other rare neurodegenerative disorders (paragraph 0005). The specification discloses the novel cryptic exon in UNC13A was detected in patient postmortem brain regions affected by TDP-43 proteinopathy, including both ALS and FTD and was found to overlap with the disease-associated variant rs12973192 that was previously identified as linked to ALS/FTLD risk and disease aggressiveness (paragraph 0034). Therefore, the instant specification shows the link between the novel cryptic exon in UNC13A and ALS and FTD affected by TDP-43 proteinopathy, but does not describe the link with other TDP-43 pathologies.
The specification discloses that the method of delivering an antisense polynucleotide to a cell, wherein the ASO modulates splicing of UNC13A to prevent inclusion of a cryptic exon in UNC13A RNA, may be an in vitro or an in vivo method, (paragraph 0382), however the specification does not provide any guidance as to how to deliver the claimed ASO to a subject. Since the delivery of ASO is intended to brain lesions or neuronal cells in a subject that have TDP-43 dysfunction or cryptic splice event, the ASO would need to be delivered to the brain or neuronal cells to be able to inhibit cryptic splice site as claimed. The specification does not provide any guidance regarding delivering the ASO to the brain or neuronal cell of a subject.
The specification discloses the detection of UNC13A cryptic event in patient samples (paragraph 0488); characterization of SEQ ID NO: 1 comprising minor allele of the SNP (the risk variant) or the major allele at rs12973192 and/or rs12608932 and that SEQ ID NO:1 also encompasses the sequence wherein the emboldened G (at rs12973192) is replaced with a C, and the emboldened U (rs12608932) corresponding to the rs12608932 cryptic exon SNP may be replaced with a G (paragraph 0495). The specification further discloses that SEQ ID NO: 2 is the shorter UNC13A cryptic exon sequence which may encompass the minor allele of the SNP (the risk variant) or the major allele at rs12973192 and also encompasses the sequence wherein the emboldened G (at rs12973192) is replaced with a C (paragraph 0496), and SEQ ID NO: 3 is the longer UNC13A cryptic exon sequence which may encompass the risk variant of the SNP (the risk variant), or the major allele at rs12973192, and the sequence wherein the emboldened G (at rs12973192) is replaced with C (paragraph 0497).
The specification shows in Example 7, Table 5 on pages 158-159 ASO sequences tested for rescue effect against the UNC13A cryptic exon, and the sequences are SEQ ID NOs: 555-571,579 and 580 and these sequences have specific modifications including phosphorothioate, LNA and 2’-O-methyl RNA. It is not clear what sequences these modified sequences correspond to regarding the range of SEQ ID NOs: 4-546. The ASO’s of SEQ ID NOs: 555-571,579 and 580 were transfected into SK-N-DZ cells with TDP-43 knockdown, and these human, neuron-like cells have been previously demonstrated to replicate numerous aberrant splicing events found in ALS/FTD patients and are a suitable model (paragraph 0510). The results are shown in Figures 14A and 14B, paragraph 0511-0513, Figure 17, paragraph 0516. Example 8 and Figure 33 shows the ability of ASOs to induce the correct splicing event in disease-state cells and that the ASOs targeting donor splice site can rescue the splicing in SHSY5Y cells (paragraph 0521).
The amount of direction or guidance presented in the specification regarding the method being carried out in vivo comprising administering the ASO of claims 51-70 and 73-77 and resulting in treatment of a neurodegenerative disorder associated with TDP-43 pathology is limited, as the examples only pertain to in-vitro cell models. The specification provides no evidence that administering the genus of claimed ASOs would result in treatment of a neurodegenerative disorder associated with TDP-43 pathology in a subject, and therefore does not provide adequate support for the breadth of the instant claims.
The Quantity of Experimentation Necessary
In light of the unpredictability surrounding the claimed subject matter, and the lack of adequate guidance, one wishing to practice the presently claimed invention would be unable to do so without engaging in undue experimentation. Absent a reasonable a priori expectation of success for delivering an antisense oligonucleotide of 13-30 nucleotides in length and that is complementary to at least 13 contiguous nucleotides of SEQ ID NO: 1,2, or 3 or the antisense oligonucleotides of SEQ ID NOs: 190-546 directly to the CNS of the subject, to treat any neurodegenerative disorder associated with TDP-43 pathology in a subject, one skilled in the art would have to extensively test the ASOs in vivo in an appropriate model of these diseases. Since each prospective embodiment, and indeed future embodiments as the art progresses, would have to be empirically tested, and those which initially failed tested further, an undue amount of experimentation would be required to practice the invention as it is claimed in its current scope, because the specification provides inadequate guidance to do otherwise. Therefore, without any evidence that the claimed method of delivering of the recited ASOs would provide a treatment effect for ALS, FTD, Alzheimer’s disease, Parkinson’s disease, FOSMN or Perry Syndrome, a person of ordinary skill in the art would reasonably require an undue quantity of experimentation.
Conclusion of 35 U.S.C. 112(a) (Enablement) Analysis
MPEP §2164.01(a), 4th paragraph, provides that, “A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1157, 1562; 27 USPQ2d 1510, 1513 (Fed. Cir. 1993).
After applying the Wands factors and analysis to claims 61-70 and 73-77, in view of the applicant’s entire disclosure and considering the In re Wright decision discussed above, it is concluded that the specification is not enabled for the full scope as discussed above. Therefore, claims 61-70 and 73-77 are rejected under 35 U.S.C. §112(a) for failing to disclose sufficient information to enable a person of skill in the art to use the invention commensurate in scope with these claims.
Response to Arguments
Applicant's arguments filed 05/13/2026 have been fully considered but they are not persuasive.
Applicant states on page 10 of response that claim 61 has been amended to recite the step of delivering the antisense oligonucleotide of claim 51 directly to the CNS of the subject, clarifying that the antisense oligonucleotide recited in the claims reaches the CNS of the subject and can therefore perform the recited function to treat the neurodegenerative disorder, and new claim 74 recites similar language with the function being reducing expression of a UNC13A cryptic exon splice variant in the cell. Applicant argues each of the method claims provide claim elements that require that the ASO come into direct contact with a neuronal cell and/or CNS so that the recited function can be performed. Without such contact, reduced expression of the splice variant and treatment of the neurodegenerative disorder cannot occur.
This is not found persuasive. While the amendment to claim 61 requiring delivering the recited ASO directly to the CNS of the subject, and new claims 73 and 74 reciting delivery by injection which is intrathecal injection or intracerebroventricular injection and the recitation in new claim 75 that the ASO is delivered directly to the CNS with claim 76 reciting injection and claim 77 reciting intrathecal injection or intracerebroventricular injection have further narrowed the scope of the claims regarding the site and method of delivery, there are still issues remaining that were not addressed either by amendment or arguments or unexpected results regarding the other issues pointed out in the rejection. An issue that remains pertaining to the scope of the claims include that the specification is not enabled for treating the genus of neurodegenerative diseases associated with TDP-43 pathology.
As stated in the scope of enablement rejection, the specification discloses that the present disclosure relates to novel therapeutics for treatment of neurodegenerative disorders, more particularly ALS and FTD, or those associated with TDP-43 pathology (paragraph 0002), and that TDP-43 is depleted from the nucleus and accumulated in cytoplasm inclusions in a number of neurodegenerative disorders, including >95% ALS cases and approximately 50% TFD cases, approximately 30% of Alzheimer disease cases, Parkinson disease and other rare neurodegenerative disorders (paragraph 0005). The specification discloses the novel cryptic exon in UNC13A was detected in patient postmortem brain regions affected by TDP-43 proteinopathy, including both ALS and FTD and was found to overlap with the disease-associated variant rs12973192 that was previously identified as linked to ALS/FTLD risk and disease aggressiveness (paragraph 0034). Therefore, the instant specification shows the link between the novel cryptic exon in UNC13A and ALS and FTD affected by TDP-43 proteinopathy, but does not describe the link with other TDP-43 pathologies.
Applicant did not amend or respond to this part of the scope of enablement rejection.
The other remaining issue regarding the scope of enablement rejection pertains to the genus of antisense oligonucleotides that are being delivered since the claims refer to claim 51 which are ASOs that are 13-30 nucleotides in length and complementary to at least 13 nucleotides of SEQ ID NO: 1. Applicant did not amend or respond to this issue brought up in the scope of enablement rejection.
As stated in the scope of enablement rejection, Example 7, Table 5 on pages 158-159 discloses ASO sequences tested for rescue effect against the UNC13A cryptic exon, and the sequences are SEQ ID NOs: 555-571,579 and 580 and these sequences have specific modifications including phosphorothioate, LNA and 2’-O-methyl RNA. It is not clear what sequences these modified sequences correspond to regarding the range of SEQ ID NOs: 4-546. The ASO’s of SEQ ID NOs: 555-571,579 and 580 were transfected into SK-N-DZ cells with TDP-43 knockdown, and these human, neuron-like cells have been previously demonstrated to replicate numerous aberrant splicing events found in ALS/FTD patients and are a suitable model (paragraph 0510). The results are shown in Figures 14A and 14B, paragraph 0511-0513, Figure 17, paragraph 0516. Example 8 and Figure 33 shows the ability of ASOs to induce the correct splicing event in disease-state cells and that the ASOs targeting donor splice site can rescue the splicing in SHSY5Y cells (paragraph 0521).
These specific sequences that were tested for the rescue effect against the UNC13A cryptic exon have chemical modifications, and as stated above it is not clear which ASO sequences these correspond to regarding the genus of claimed ASOs, and therefore the Examples that show the effect of these specific ASOs with chemical modifications to induce the correct splicing event in the cells in the examples are not commensurate in scope with the claims.
Claim Rejections - 35 USC § 102
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claim Interpretation: For the following 35 U.S.C. 102(a)(1) rejections, the “wherein clause” in claim 51, “wherein the oligonucleotide reduces expression of the UNC13A cryptic exon splice variant of UNC13A mature mRNA in a cell” is not being considered as a claim limitation as it does not limit the claim to a particular structure. Therefore, art that teaches an antisense oligonucleotide comprising a nucleotide sequence 13-30 nucleotides in length and that is complementary to at least 13 nucleotides of instant SEQ ID NO: 1,2 or 3 meets the required structure of claims 51-53 and would read on the claims, and the “wherein clause” would be a result of the recited structure. See MPEP 2111.04.
In addition, sequences that are complementary to at least 13 nucleotides of instant SEQ ID NOs: 2 and 3 would also be complementary to at least 13 nucleotides of SEQ ID NO: 1 as SEQ ID NOs: 2 and 3 fall within SEQ ID NO: 1.
Claim 51 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Meissner et al. (US 20190309259, Published 10 Oct 2019).
Regarding claim 51, Meissner et al. teach ribonucleic acids comprising a sequence selected from the group consisting of SEQ ID NOs: 2-817976 (paragraph 0205). Nucleotides 20-1 of SEQ ID NO: 79449 of Meissner et al. are complementary to nucleotides 791-810 of instant SEQ ID NO:1. SEQ ID NO: 79449 is identified as a gRNA sequence below. Therefore, Meissner et al. teach an antisense oligonucleotide 20 nucleotides in length and complementary to 20 nucleotides of instant SEQ ID NO: 1. As the structure of the gRNA of SEQ ID NO: 79449 meets the structural limitations recited by instant claim 51, the function of the oligonucleotide reducing expression of UNC13A cryptic exon splice variant of UNC13A mature mRNA in a cell would be carried out.
PNG
media_image9.png
699
701
media_image9.png
Greyscale
Response to Arguments
Applicant's arguments filed 05/13/2026 have been fully considered but they are not persuasive.
Applicant argues on pages 11-12, that they disagree with the Office’s position regarding the claim interpretation of the “wherein clause” in claim 51, but that the cited references still fail to disclose the structural requirement of claim 51, and the Office’s rejections are based on a fundamental misunderstanding of the distinction between sequence identity and sequence complementary. Applicant further explains what complementarity is, and that an antisense oligonucleotide that is complementary to a target sequence would therefore have a sequence that is the reverse complement of the target, not a sequence that shares identity with the target. Applicant argues that the Office has not established that any of the oligonucleotides disclosed in the cited art are complementary to any of SEQ ID NOs, 1,2 or 3, and the various alignments in the Office Action confirm that oligonucleotides disclosed in Meissner, Bentwich, Rigoutsos and Krieg share sequence identity with portions of instant SEQ ID NOs: 1,2 and/or 3, not complementarity. Applicant argues that with respect to Meissner, the Office identified SEQ ID NO: 79449 as being complementary to nucleotides 791-810 of instant SEQ ID NO: 1, but the alignment shows sequence identity, not complementarity. In addition, SEQ ID NO: 79449 is expressly identified as a “CRISPR gRNA sequence”, not an antisense oligonucleotide.
This is not found persuasive. The Examiner cited in the above rejection that Nucleotides 20-1 of SEQ ID NO: 79449 of Meissner et al. are complementary to nucleotides 791-810 of instant SEQ ID NO:1. Applicant appears to have missed the reverse order or numbering of the positions cited in the rejection. Positions 20-1 of SEQ ID NO: 79449 indicates the reverse order, and therefore complementarity. SEQ ID NO: 79449 of Meissner et al. has the sequence “tccatccatccatccatcca”. To further prove that SEQ ID NO: 79449 of Meissner is complementary to nucleotides 791-810 of instant SEQ ID NO:1 the Examiner is providing the below alignment of SEQ ID NO: 79449 of Meissner with positions 791-810 of instant SEQ ID NO: 1, which shows the Watson-Crick base pairing. As “tccatccatccatccatcca” (SEQ ID NO: 79449) is in the 5’-3’ direction, when the direction is changed to 3’-5’ in order to be complementary, this is show below:
PNG
media_image10.png
164
1014
media_image10.png
Greyscale
Regarding Applicant’s argument that SEQ ID NO: 79449 is expressly identified as a “CRISPR gRNA sequence”, not an antisense oligonucleotide, this is not found persuasive. The recitation of “an antisense oligonucleotide” occurs only the preamble. “Antisense” can be both structural and functional. Structurally it is antisense orientation, and functionally, this is an intended use. Structurally it satisfies the structure of “antisense oligonucleotide” as the structure recited in the body of the claim is fully satisfied by the sequence above of Meissner. Therefore, the rejection is maintained.
Claims 51-53 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bentwich (U.S. Patent No. 7,655,785, Patented 2 Feb 2010).
Regarding claims 51-53, Bentwich teach human regulatory microRNA-like oligonucleotides referred to as Genomic Address Messenger (GAM) oligonucleotides, which inhibits translation of one or more target genes by hybridization of an RNA transcript encoded by the GAM to a site located in an UTR of the mRNA of one or more target genes (Column 3, lines 52-61). Bentwich teach the oligonucleotides of the invention comprise non-protein coding oligonucleotides which modulate expression of thousands of proteins and are associated with numerous major diseases (Column 4, lines 34-38), as well as improved methods and systems for specific modulation of the expression of specific target genes involved in significant human diseases, and for detection of the expression of oligonucleotides of the invention which modulate these target genes (Column 4, lines 63-67 to Column 5 lines 1-2). Therefore, the purpose of Bentwich is to find oligonucleotides that are regulatory elements, and discusses the use of these oligonucleotides for modulation of the expression of target genes associated with diseases, and Bentwich teach inhibitory oligonucleotide sequences as discussed below, and will have the function as claimed.
Bentwich teach isolated oligonucleotides which anneals to a portion of an mRNA transcript of a target gene, wherein binding of the oligonucleotide to the mRNA transcript represses expression of the target gene, and wherein the oligonucleotide has at least 80% sequence identity with the complement of a sequence selected from the group consisting of SEQ ID NOs: 1555476-1616125; SEQ ID NOs: 1656865-1680643 (Colum 38 lines 55-67 to Column 39 line 3 and Column 40, lines 1-15). Below are alignments of the sequences of Bentwich which are complementary to instant SEQ ID NOs: 2 and 3. As seen in the alignments below, the oligonucleotides of Bentwich are between 13-21 nucleotides in length and are complementary to at least 13 nucleotides of SEQ ID NOs: 2 and 3.
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO: 1611900 of Bentwich:
PNG
media_image11.png
201
568
media_image11.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO: 1611900 of Bentwich:
PNG
media_image12.png
194
565
media_image12.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO: 1678132 of Bentwich:
PNG
media_image13.png
205
567
media_image13.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO: 1678132 of Bentwich:
PNG
media_image14.png
195
563
media_image14.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO: 1669354 of Bentwich:
PNG
media_image15.png
198
557
media_image15.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO: 1669354 of Bentwich:
PNG
media_image16.png
194
558
media_image16.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO: 1679507 of Bentwich:
PNG
media_image17.png
185
559
media_image17.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO: 1679507 of Bentwich:
PNG
media_image18.png
185
559
media_image18.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO: 1660835 of Bentwich:
PNG
media_image19.png
180
553
media_image19.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO: 1660835 of Bentwich:
PNG
media_image20.png
194
552
media_image20.png
Greyscale
Response to Arguments
Applicant's arguments filed 05/13/2026 have been fully considered but they are not persuasive.
Applicant’s arguments regarding the art rejections have been summarized above. Applicant argues that the same fundamental error applies in that the alignments provided in the Office Action show the prior art sequences share sequence identity with instant SEQ ID NOs: 2 and 3 and not complementarity.
This is not found persuasive, for the same reasons cited in the response to arguments above regarding Meissner. The alignments above provide that the sequences of the reference (Db) are in the reverse orientation from the sequences of the query which are either instant SEQ ID NO: 2 or 3, and are therefore indicated as being complementary thereto. See the response to Meissner above for how the sequence results are shown as being complementary to the query sequence. This is how complementary results are shown in the sequence results.
Claims 51-53 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Rigoutsos et al. (U.S. Patent No. 8,178,503 Patented 15 May 2012).
Regarding claims 51-53, Rigoutsos et al. teach ribonucleic acid interference molecules (Field of Invention, column 1), and sequences that can be used in the context of gene regulation, referred to as “pyknons”, comprising SEQ ID NOs: 1-747326 (Summary of Invention, Column 1). Rigoutsos et al. teach determining associations between non-coding and gene-coding sequences in the genome of an organism, which includes that the identified conserved regions (conserved motifs) of the intergenic/intronic non-coding sequences are linked to gene coding regions of the genome, and these identified sequences link the coding an non-coding region of the genome which provides for an association to be made with the biological processes of the organism (Column 3, lines 52-54 and Column 4, lines 4-19,59-61). Rigoutsos et al. teach methods for regulating the expression of a transcript comprises using at least one of SEQ ID NOs: 1-747326 to design an interfering RNA molecule that contains a region the corresponds to the reverse complement of one or more sequences having SEQ ID NOs: 1-747326 (Column 2, lines 9-16). Therefore, Rigoutsos et al. teach oligonucleotides which are regulatory elements and teach inhibitory sequences as discussed below and which will have the function as claimed.
Below are alignments of the sequences of Rigoutsos et al. which are complementary to instant SEQ ID NOs: 2 and 3. As seen in the alignments below, the oligonucleotides of Rigoutsos et al. are between 13-16 nucleotides in length and complementary to at least 13 nucleotides of SEQ ID NOs: 2 and 3.
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:48759 of Rigoutsos:
PNG
media_image21.png
189
566
media_image21.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:48759 of Rigoutsos:
PNG
media_image22.png
184
555
media_image22.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:106708 of Rigoutsos:
PNG
media_image23.png
185
552
media_image23.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:106708 of Rigoutsos:
PNG
media_image24.png
185
557
media_image24.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:367147 of Rigoutsos:
PNG
media_image25.png
183
548
media_image25.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:367147 of Rigoutsos:
PNG
media_image26.png
185
550
media_image26.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:393218 of Rigoutsos:
PNG
media_image27.png
180
555
media_image27.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:393218 of Rigoutsos:
PNG
media_image28.png
178
552
media_image28.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:590896 of Rigoutsos:
PNG
media_image29.png
191
548
media_image29.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO: 590896 of Rigoutsos:
PNG
media_image30.png
186
551
media_image30.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:606247 of Rigoutsos:
PNG
media_image31.png
183
546
media_image31.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:606247 of Rigoutsos:
PNG
media_image32.png
199
559
media_image32.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:647478 of Rigoutsos:
PNG
media_image33.png
189
550
media_image33.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:647478 of Rigoutsos:
PNG
media_image34.png
194
551
media_image34.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:666012 of Rigoutsos:
PNG
media_image35.png
188
549
media_image35.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:666012 of Rigoutsos:
PNG
media_image36.png
188
549
media_image36.png
Greyscale
Response to Arguments
Applicant's arguments filed 05/13/2026 have been fully considered but they are not persuasive.
Applicant’s arguments regarding the art rejections have been summarized above. Applicant argues that the same fundamental error applies in that the alignments provided in the Office Action show the prior art sequences share sequence identity with instant SEQ ID NOs: 2 and 3 and not complementarity.
This is not found persuasive, for the same reasons cited in the response to arguments above regarding Meissner. The alignments above provide that the sequences of the reference (Db) are in the reverse orientation from the sequences of the query which are either instant SEQ ID NO: 2 or 3, and are therefore indicated as being complementary thereto. See the response to Meissner above for how the sequence results are shown as being complementary to the query sequence. This is how complementary results are shown in the sequence results.
Claims 51-53 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Krieg et al. (U.S. Patent No. 10,058,623 Patented 28 Aug 2018).
Regarding claims 51-53, Krieg et al. teach single stranded oligonucleotides that have a region of complementarity that is complementary with at least 8 consecutive oligonucleotides of a PRC2-associated region of a UTRN gene (Column 2, lines 29-33), and the single stranded oligonucleotide comprises a nucleotide sequence as set forth in SEQ ID NOs: 463-497728 (Column 3, lines 29-31).
Below are alignments of the sequences of Krieg et al. which are complementary to instant SEQ ID NOs: 2 and 3. As seen in the alignments below, the oligonucleotides of Krieg et al. are between 15 nucleotides in length and complementary to at least 13 nucleotides of SEQ ID NOs: 2 and 3.
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:311552 of Krieg:
PNG
media_image37.png
192
548
media_image37.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:311552 of Krieg:
PNG
media_image38.png
190
547
media_image38.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:311554 of Krieg:
PNG
media_image39.png
197
551
media_image39.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:311554 of Krieg:
PNG
media_image40.png
184
547
media_image40.png
Greyscale
Qy is instant SEQ ID NO: 2, Db is SEQ ID NO:311555 of Krieg:
PNG
media_image41.png
186
554
media_image41.png
Greyscale
Qy is instant SEQ ID NO: 3, Db is SEQ ID NO:311555 of Krieg:
PNG
media_image42.png
187
552
media_image42.png
Greyscale
Response to Arguments
Applicant's arguments filed 05/13/2026 have been fully considered but they are not persuasive.
Applicant’s arguments regarding the art rejections have been summarized above. Applicant argues that the same fundamental error applies in that the alignments provided in the Office Action show the prior art sequences share sequence identity with instant SEQ ID NOs: 2 and 3 and not complementarity. Applicant further argues that Krieg is directed to oligonucleotides targeting PRC2-associated regions of the UTRN gene for treating muscular dystrophy which is entirely different from the claimed invention.
This is not found persuasive, for the same reasons cited in the response to arguments above regarding Meissner. The alignments above provide that the sequences of the reference (Db) are in the reverse orientation from the sequences of the query which are either instant SEQ ID NO: 2 or 3, and are therefore indicated as being complementary thereto. See the response to Meissner above for how the sequence results are shown as being complementary to the query sequence. This is how complementary results are shown in the sequence results. Regarding the arguments that Krieg is directed to oligonucleotides targeting a different gene, this is not found persuasive, as structurally it satisfies the structure of “antisense oligonucleotide” as the structure recited in the body of the claim is fully satisfied by the sequence above of Krieg et al. Therefore, the rejection is maintained.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 58-60 are rejected under 35 U.S.C. 103 as being unpatentable over Krieg et al. (U.S. Patent No. 10,058,623 Patented 28 Aug 2018) as applied to claims 51-53.
The teachings of Krieg et al. as applicable to claims 51-53 are described above.
Krieg et al. does not explicitly teach the recited claim limitations of claims 58-60 for the sequences of Krieg et al. cited above.
However, Krieg et al. teaches at least one nucleotide of the oligonucleotide comprises 2’-O methyl, and in some embodiments, each nucleotide of the oligonucleotide comprises a 2’-O-methyl; in some embodiments the oligonucleotide comprises at least one bridged nucleotide which is an LNA nucleotide, cET nucleotide or ENA nucleotide or each nucleotide is an LNA nucleotide (Column 4, lines 48-57); or the single stranded oligonucleotide may consist entirely of bridged nucleotides (Column 16, lines 45-46).
Krieg et al. teach in some embodiments, the single-stranded oligonucleotide comprises modified internucleotide linkages (e.g. phosphorothioate internucleotide linkages, between at least 2, at least 3, at least 4, at least 5, or more nucleotides, or between all nucleotides (Column 5, lines 9-16).
Krieg et al. teach the oligonucleotides of the invention can be stabilized against nucleolytic degradation by the incorporation of a modification, for example nucleic acid sequences of the invention include a phosphorothioate at the first, second or third internucleotide linkage at the 5’ or 3’ end of the nucleotide sequence; another example is a 2’-O-methyl, 2’-O-methoxyethyl modification; the nucleic acid sequence comprise a locked nucleic acid (Column 15, lines 14-32).
Krieg et al. teach pharmaceutical compositions are provided that comprise any of the oligonucleotides disclosed herein and a pharmaceutically acceptable carrier (Column 5, lines 35-38). Krieg et al. teach the pharmaceutical composition can be used in treatment of a disease (Column 15, lines 45-49).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to have provided any of the single-stranded oligonucleotides of Krieg et al., including the sequences of SEQ ID NOs: 311552, 311554 or 311555, with a backbone selected from LNA (locked nucleic acid), 2’-O-Me-RNA, 2’-O-methoxyethyl nucleic acids or a combination thereof, and would have been obvious to have provided the single-stranded oligonucleotide with any of the above modifications with one or more phosphorothioate linkages with a reasonable expectation of success. There would be a reasonable expectation of success, because Krieg et al. suggests modifications to any of the single stranded oligonucleotides of the invention with the above recited modifications, and therefore would have amounted to applying a known technique of these chemical modifications to a known product ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to provide the single-stranded oligonucleotides of SEQ ID NOs: 311552, 311554 or 311555, with a backbone selected from LNA (locked nucleic acid), 2’-O-Me-RNA, 2’-O-methoxyethyl nucleic acids, as well as one or more phosphorothioate linkages because Krieg et al. teach the oligonucleotides of the invention can be stabilized against nucleolytic degradation by the incorporation of a modification, for example nucleic acid sequences of the invention include a phosphorothioate at the first, second or third internucleotide linkage at the 5’ or 3’ end of the nucleotide sequence; another example is a 2’-O-methyl, 2’-O-methoxyethyl modification; the nucleic acid sequence comprise a locked nucleic acid (Column 15, lines 14-32).
Accordingly the limitations of claims 58 and 59 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
It would have been obvious to one of ordinary skill in the art before the effective filing date, to have provided any of the single-stranded oligonucleotides of Krieg et al., including the sequences of SEQ ID NOs: 311552, 311554 or 311555, with a pharmaceutically acceptable carrier to form a pharmaceutical composition with a reasonable expectation of success. There would be a reasonable expectation of success, because Krieg et al. suggests a pharmaceutical composition comprising any of the disclosed oligonucleotides herein and a pharmaceutically acceptable carrier. One of ordinary skill in the art would be motivated to do so because Krieg et al. teach the pharmaceutical composition can be used in treatment of a disease (Column 15, lines 45-49).
Accordingly the limitations of claim 60 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Response to Arguments
Applicant's arguments filed 05/13/2026 have been fully considered but they are not persuasive.
Applicant argues on pages 12-13 of response that for the reasons set above regarding the 102 rejection, Krieg does not disclose an antisense oligonucleotide complementary to at least 13 nucleotides of instant SEQ ID NO: 1 as recited in independent claim 51 and that the alignments provided in the rejection only share sequence identity to portions of instant SEQ ID NOs: 2 and 3 and not complementarity. Applicant argues that as independent claim 51 is not anticipated by Krieg, there is no primary reference upon which to build an obviousness rejection for dependent claims 58-60.
This is not found persuasive, for the same reasons cited in the response to arguments above regarding Meissner and Krieg et al. above. The alignments above provide that the sequences of the reference (Db) are in the reverse orientation from the sequences of the query which are either instant SEQ ID NO: 2 or 3, and are therefore indicated as being complementary thereto. See the response to Meissner above for how the sequence results are shown as being complementary to the query sequence. This is how complementary results are shown in the sequence results. As the 35 U.S.C. 102 rejection of claims 51-53 as anticipated by Krieg et al. stands, it is a proper primary reference for the obviousness rejection of claims 58-60. Therefore, the rejection is maintained.
Conclusion
No claims are allowed.
Claims 54-57,71 and 72 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached on 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/STEPHANIE L SULLIVAN/Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635