Prosecution Insights
Last updated: April 18, 2026
Application No. 18/266,464

GENOMIC EDITING OF COMPLEMENT

Non-Final OA §103§112§DP
Filed
Jun 09, 2023
Examiner
HUMPHRIES, NICHOLAS ADAM
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Apellis Pharmaceuticals, Inc.
OA Round
1 (Non-Final)
38%
Grant Probability
At Risk
1-2
OA Rounds
3y 9m
To Grant
99%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allow Rate
9 granted / 24 resolved
-22.5% vs TC avg
Strong +82% interview lift
Without
With
+82.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
47 currently pending
Career history
71
Total Applications
across all art units

Statute-Specific Performance

§101
4.3%
-35.7% vs TC avg
§103
36.0%
-4.0% vs TC avg
§102
18.0%
-22.0% vs TC avg
§112
28.7%
-11.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 24 resolved cases

Office Action

§103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Election/Restriction Applicant’s election of Group 1, claims 1-4, 10, 12, 14, 19-20, 22-24, 29-30, 32, 34, 39, and 45 in the reply filed on 09 January 2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Claims 40 and 41 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 09 January 2026. C laim Status Claims 5-9, 11, 13, 15-18, 21, 25-28, 31, 33, 35-38, 42-44, and 46 were previously cancelled; claims 40-41 have been withdrawn; and claims 1-4, 10, 12, 14, 19-20, 22-24, 29-30, 32, 34, 39, and 45 have been considered on their merits. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.821 - 1.825 because it does not contain a "Sequence Listing" as a separate part of the disclosure or a CRF of the “Sequence Listing.”. Required response - Applicant must provide: A "Sequence Listing" part of the disclosure; together with An amendment specifically directing its entry into the application in accordance with 37 CFR 1.825(a)(2) ; A statement that the "Sequence Listing" includes no new matter as required by 37 CFR 1.821(a)(4); and A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(a)(3). If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. If the "Sequence Listing" part of the disclosure is submitted according to item 1) c) or d) above, applicant must also provide: A CRF in accordance with 37 CFR 1.821(e)(1) or 1.821(e)(2) as required by 1.825(a)(5); and A statement according to item 2) a) or b) above. Claim Objections Claim 1 is objected to because of the following informalities: The second instance of “a subject”, in the first line of the claim, should read as “the subject”. The first instance of “C3”, in the fifth line of the claim, should be spelled out . Claim 20 is objected to because of the following informalities: The second instance of “a cell”, in the first line of the claim, should read as “the cell”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.— The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-4, 10, 12, 14, 19-20, 22-24, 29-30, 32, 34, and 45 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claims 1 and 20, the limitations in parentheses (e.g., a Cas endonuclease) , (e.g., a single guide RNA) , and/or (e.g., reduced by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) , are indefinite because it is not clear whether the information in parentheses is exemplary or is required by the claim. Regarding claims 1 and 20, the phrase " e.g ” (for example) renders the claims indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d). Regarding claim s 4 and 24 , the claims refer to one or more base portions recited in Tables 2 , 3, or 4 , which is not found in the claims. Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola , 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993). See MPEP § 2173.05(s). It is suggested to amend the claims to include the data from Tables 2 , 3, and/or 4 into the claims. The dependent claims are included in the rejection be because they do not resolve the issues. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis ( i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-4, 10, 14, 19-20, 22-24, 29, 30, 34 , and 39 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US 20 20/0190487, published 18 June 2020 , IDS ref. , of record ). Regarding claim s 1 , 14, 19 -20 , 34 , and 39 , Zhang et al. teach a method of treating a subject ( claim 1 preamble ) , comprising inducing gene editing by transforming the subject with the polynucleotide encoding a single vector provid ing the CRISPR enzyme and a t least one guide RNA ( claim s 1(ii) , 1 4 , 20(ii) , and 34 ) (para. [0528]). Zhang et al. teach in some embodiments, the condition to be treated or targeted is a macular degeneration (MD) (para. [1004]); proteins associated with MD include but are not limited to C3 Complement components (C3) ( claim s 1(ii) , 19 , 39, and claim 20 preamble ) (para. [1018]). Zhang et al. teach the Cas effector protein is modified in that it is linked to a functional domain ( fusion protein comprising endonuclease ) (para. [0641]) . Zhang et al. teach an alternative approach to make point mutations on DNA has been developed that relies on using dead Cas9 to recruit adenine deaminases to achieve base editing of genomic DNA ( claim 1( i ) ) (para. [1321]). The point mutations on DNA taught by Zhang et al. reads on comprising at least one genomic edit ( claim 20(ii) ). Zhang et al. teach the method comprising decreasing expression of a target polynucleotide by using a CRISPR complex that binds to the polynucleotide wherein a target polynucleotide can be inactivated to effect the modification of the expression in a cell ( claim 1, subject exhibits reduced activity ) (para. [1131] -[ 1132]). Zhang et al. are silent to the C3 gene specifically being human C3 gene. However, Zhang et al. contemplates several instances of treatments for humans; such as, editing hepatocytes for Hemophilia B in humans (para. [1036]). Therefore, it would have been obvious to one of ordinary skill in the art to target the human C3 gene with a reasonable expectation of success because Zhang et al. contemplates several instances of treatments for humans; such as, editing hepatocytes for Hemophilia B in humans (para. [1036]). One would be motivated to target the human C3 gene because Zhang et al. teach in some embodiments, the condition to be treated or targeted is a macular degeneration (MD) (para. [1004]); proteins associated with MD include but are not limited to C3 Complement components (C3) (para. [1018]) and MD is a disease which affects humans. Claims 2 , 3 , 22, and 23 are interpreted as requiring the target domain to complement any nucleotide found in the human C3 gene and does not require a specific binding site, as the sequence found in SEQ ID NO: 1 comprises both exons and introns. Claims 4 and 24 are interpreted as requiring the gRNA to target the base editor to one base position recited in Tables 2, 3, or 4. Tables 2, 3, and 4 recite exons of the human C3 gene. Therefore, any gRNA disclosed by Zhang et al. would be capable of complement ing one base position of an exon of the human C3 gene. Zhang et al. teach several sgRNA designs to include SEQ ID NOs: 471-482. Regarding claim s 10 and 30 , Zhang et al. teach the CRISPR-Cas systems may comprise a Cas protein and a guide molecule, wherein the Cas protein is a nickase form (para. [0158]). Regarding claim 29, Zhang et al. teach in some embodiments the Cas protein lacks nuclease activity, wherein, the Cas is a dead Cas protein (para. [0012]). Lacks nuclease activity reads as inactive Cas endonuclease. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claims 12 and 32 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US 20 20/0190487, published 18 June 2020 , IDS ref., of record ) as applied to claims 1 and 20 above, and further in view of Gehrke et al. (Nature Biotechnology, Vol. 36, No. 10, October 2018) . Regarding claims 12 and 32, Zhang et al. teach the guide molecule forms a duplex with a target RNA comprising at least one target cytosine residue to be edited , wherein, upon hybridization of the guide RNA molecule to the target RNA, the cytidine deaminase binds to the single strand RNA in the duplex made accessible by the mismatch in the guide sequence and catalyzes deamination of one or more target cytosine residues comprised within the stretch of mismatching nucleotides (para. [0200]). However, Zhang et al. is silent to the deaminase being a APOBEC family deaminase. Gehrke et al. teach b ase editor technology, which uses CRISPR–Cas9 to direct cytidine deaminase enzymatic activity to specific genomic loci, enables the highly efficient introduction of precise cytidine-to - thymidine DNA alterations (Abstract) . Gehrke et al. teach reducing bystander mutations using an engineered human APOBEC3A (eA3A) domain (Abstract). Therefore, it would have been obvious to one of ordinary skill in the art to utilize the APOBEC domain of Gehrke et al. in the method of Zhang et al. with a reasonable expectation of success because Gehrke et al. teach existing base editors create unwanted C-to-T alterations when more than one C is present in the enzyme’s five-base-pair editing window (Abstract) . One would be motivated to utilize the APOBEC domain of Gehrke et al. in the method of Zhang et al. because Gehrke et al. teach eA3A-BE3 shows reduced mutation frequencies on known off-target sites of BE3, even when targeting promiscuous homopolymeric sites (Abstract). Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claim 45 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US 20 20/0190487, published 18 June 2020 , IDS ref., of record ) as applied to claim 20 above, and further in view of Lundberg et al. (WO 2018/154380, published 30 August 2018) as evidenced by Wright et al. ( Immunology Letters 76 (2001) ) . Regarding claim 45 , Zhang et al. teach editing a human C3 gene but are silent to specifically editing a human C3 gene in a hepatic cell. However, Lundberg et al. teach methods for treating a patient with one or more conditions associated with PCSK9 wherein, materials and methods for editing and/or modulating the expression of PCSK9 gene in a cell by genome editing (Abstract). Lundberg et al. teach h epatocyte monolayers were transfected 3-5 hours after plating with either P9-1 gRNA or hC3 gRNA (hC3 target sequence: TGGGACTCCCCAGAGCCAGG (SEQ ID NO: 28,732) , wherein hC3 is a non-relevant gRNA that efficiently knocks out the human C3 gene but does not edit the PCSK9 gene) in complex with Cas9 mRNA. SEQ ID NO: 28,732 corresponds to nucleic acids 5116-5136 (part of human C3 gene Exon 1) of instant SEQ ID NO: 1. Therefore, it would have been obvious to one of ordinary skill in the art to edit the human C3 gene in the method of Zhang et al. in a hepatic cell as taught by Lundberg et al. with a reasonable expectation of success because Lundberg et al. demonstrate the ability to knock out the human C3 gene in hepatic cells using gRNA and Cas protein. One would be motivated to edit the human C3 gene in the method of Zhang et al. in a hepatic cell as taught by Lundberg et al. because h epatocytes are known to be the major source of C3 complement components, as evidenced by Wright et al. (p. 119). Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg , 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman , 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi , 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum , 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel , 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington , 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA/25, or PTO/AIA/26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer . Claim s 1-4, 10, 12, 14, 19- 20, 22-24, 30, 32, 34, 39, and 45 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim s 1-41 of copending Application No. 18/563,5 8 8 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the copending application anticipates the instant application . Regarding claim 1, copending claim 1 recites a method of treating a subject, the method comprising contacting a cell of the subject, which reads on administering to a cell of a subject. Copending claim 1( i ) and (ii) are identical to instant claim 1( i ) and (ii). Regarding claims 2-4, 10, and 12, copending claims 2-4, 10, and 12 are identical to the instant claims. Regarding claim 14, copending claim 14 recites contacting a cell with a nucleotide sequence encoding the base editor. Regarding claim 19, copending claim 1 recites treating a complement-mediated disorder. Regarding claim 20 preamble, copending claim 20 recites inhibiting or reducing the level of complement C3 in a cell of a subject by administering to a subject a base editor, which reads on a method of editing a human C3 gene in a cell. Copending claim 20( i ) and (ii) are identical to instant claim 20( i ) and (ii). Regarding claim 22-24 , 30, 32, 34, and 39, copending claims 22-24, 30, 32, 34, and 39 are identical. Regarding claim 45, copending claim 20 recites contacting a hepatic cell. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim 29 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim s 1-41 of copending Application No. 18/563,588 (reference application) in view of Rees et al. (Nat Rev Genet. 2018, IDS ref.) . The copending claims anticipate instant claim 20, thus also render them obvious. Regarding claim 29, copending claim 30 recites the Cas endonuclease is a nickase however, are silent to the Cas endonuclease is an inactive Cas endonuclease. However, Rees et al. teach both inactive and nickase can both be utilized for base editing (p. 3, Cytosine base editors (CBEs): development and mechanism). Therefore, it would have been obvious to one of ordinary skill in the art to substitute an inactive Cas for a nickase with a reasonable expectation of success because Rees et al. teach both can be used as base editors , thus, functional equivalents . Substitution of one known element for another known element, the elements having equivalent effect, is considered to be obvious, absent a showing that the result of the substitution yields more than predictable results. See MPEP 2143(I). This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to FILLIN "Examiner name" \* MERGEFORMAT NICHOLAS A. HUMPHRIES whose telephone number is FILLIN "Phone number" \* MERGEFORMAT (703)756-5556 . The examiner can normally be reached FILLIN "Work Schedule?" \* MERGEFORMAT Monday - Friday, 7:30am - 4:30 pm . Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, FILLIN "SPE Name?" \* MERGEFORMAT James Schultz can be reached at FILLIN "SPE Phone?" \* MERGEFORMAT 571-272-0763 . The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /N.A.H./ Examiner, Art Unit 1631 /LAURA SCHUBERG/ Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Jun 09, 2023
Application Filed
Apr 01, 2026
Non-Final Rejection — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12577536
METHOD FOR ISOLATING URETERIC BUD TIP CELLS
2y 5m to grant Granted Mar 17, 2026
Patent 12533383
Method for Producing Cell Aggregate Including Glial Progenitor Cells
2y 5m to grant Granted Jan 27, 2026
Patent 12492373
PRODUCTION METHOD FOR NERVE TISSUE
2y 5m to grant Granted Dec 09, 2025
Patent 12357659
PRODUCTION OF MEGAKARYOCYTES OR PLATELETS FROM MONOCYTES
2y 5m to grant Granted Jul 15, 2025
Patent 12291720
PRODUCTION METHOD FOR RETINAL TISSUE
2y 5m to grant Granted May 06, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
38%
Grant Probability
99%
With Interview (+82.2%)
3y 9m
Median Time to Grant
Low
PTA Risk
Based on 24 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month